>AT3G63490.1 |  ribosomal protein L1 family protein 
GTGGATTAGGGAGACTCGCACTCTTCTTCTTCTTCTTTGTACCCAGAAAGAAAGAGAGCT 
CCAACAATGGCTGCTTGCGCTACTCACTCCTCTCTCATGCTAGCATACGCCGCCGCATCC 
ACTCGTTCCCAGGACCTTACCCCTACTCCATCTCTTTTCTCTTTTGCCAGCTCCAGACCC 
AACCACTTGAGCTTCCCGCTTCTTCTCCTTGGGGGTTCCAGGGACCGGAGATGTGCTGCT 
ATTGACAGAGCTTCCAACCACAAGTTTATTGTCTCCGCCGTGGCCGCTGAGGCTGACCTC 
GACACGGAGGAGGACCTGGAGCAGACCGCCACCGCCGTCCTTGATCCGCCCAAGCCTAAG 
AAAGGAAAAGCCGCTTTGGTTCTCAAGAGAGATAGAGTATGTGCTTTACCTACTTCAATT 
TCGCTTCCTTTACTCGTGAATCATCACTTTGTTTGCTTACCCATTGACAGACAAGGTCTA 
AGAGGTTTTTGGAAATCCAAAAGCTAAGGGAAACCAAAAAGGAGTATGATGTCAACACTG 
CTATCTCTTTGCTTAAACAAACTGCCAACACAAGGTTTGTTGAGTCTGTTGAAGCCCATT 
TCCGTCTCAACATCGATCCTAAGTACAATGACCAGCAGCTGCGTGCAACGGTCTGCTTTG 
CCTTTTGCTGGATATACACTCTATCTTGTGCTGCTTCATTCCACAACATTTTTTAATCTC 
AATGCATTGTCTTTTTGTATAGGTGAGCCTGCCTAAGGGAACTGGCCAGACTGTTATAGT 
CGCTGTTCTTGCACAAGGTATATTGCCCCACCAAATTCACTGCTAGGACTTAGGACAGAG 
ATTATGCTTTACCATTTCAGTCACCAAATTCACTGTTAGGACTTAGGACAGAGATAATGT 
TTACGGTATCAGTCAGTCAGTCAGTACTTCTCTAGATGCAACATTGTTTGGTGCGATTGA 
CTTTTTATTTATATATTGATTGGATGGAGTTCTTGTGTATCATGTGGCTTATTCTTTCTA 
AATCTTTGGCTTGCACCATTTCCATGCTGAACTTCCAGGTGAGAAGGTTGATGAAGCCAA 
AAGTGCAGGGGCAGATATTGTGGGCAGTGATGATTTAATCGAACAGATTAAAGGAGGCTT 
CATGGAGTTTGACAAGCTGATTGCATCCCCGGATATGATGGTCAAGGTATGTGTTGATGA 
TATAATGTTCTACTTGTTACAGCATATGAAACCGTCATGCTTGGCAAATAAGGTGGCATG 
AGATACTTGTAACTCGTGATCTATTTTCTAACATTCTTGAACTTGGCGCTTAGGTTGCTG 
GCCTGGGAAAGATTCTTGGACCACGGGGGCTCATGCCAAATCCCAAGGCTGGTACAGTCA 
CAGCGAACATTCCCCAGGTAAGCCTACTCTGCAACATCTTTTCCTGATTCTGGTAGTCAT 
GGCTTAAAGATGCATAAATCTCTCAGGCTATTGAAGAGTTCAAGAAGGGGAAAGTTGAAT 
TCAGAGCAGACAAAACTGGGATTGTTCACATTCCATTTGGGAAAGTTAATTTTACAGAGG 
AAGACCTTCTCATAAACTTCCTTGCAGCAGTGGTAGGCTAATTCTCCATTCTTATTACGT 
ATTTCTGTGGTTTAAAATACAAAAAAAAATGAAGAGGGAAAAGTAAATGATGAAATGCAG 
AAATCGGTGGAGACAAACAAGCCAAAGGGAGCTAAAGGAGTGTACTGGAAAAGCGCTCAC 
ATATGCTCGTCAATGGGGCCTTCCATCAAGTTGAACATAAGAGAGATGATAGACTTCAAG 
CCTCCCACTGCGAACTAATCGACAACGCCATTTGTAAATGGGGTCCTTTTGGGAGACGGG 
CAATGCCAGTGTAGACAGAGAAGAGAAACACCAAGTCTAGTCTGTTAGTAATCTTTTCAC 
GCCTCACTGCTTTGTATCACTTTGATGGCCATTTGCTTCTTGTCGTTATTTATTTACTAT 
TGCCTATTAAAATTTGGCAAGGGGCTGTACATGTCAGGACGCAGAACTCTTTAGTACTCT 
CTAAAAGAAAAGACCTTACATTGATCTTTAGGTTACATACGAGGAGGAGGTTTCTGTGTA 
CATTACATGTGATTTACTACTACAAATATTACAAGGCCAGACTCTGCTTCGTC
>AT3G63490.1 |  ribosomal protein L1 family protein 
GTGGATTAGGGAGACTCGCACTCTTCTTCTTCTTCTTTGTACCCAGAAAGAAAGAGAGCT 
CCAACAATGGCTGCTTGCGCTACTCACTCCTCTCTCATGCTAGCATACGCCGCCGCATCC 
ACTCGTTCCCAGGACCTTACCCCTACTCCATCTCTTTTCTCTTTTGCCAGCTCCAGACCC 
AACCACTTGAGCTTCCCGCTTCTTCTCCTTGGGGGTTCCAGGGACCGGAGATGTGCTGCT 
ATTGACAGAGCTTCCAACCACAAGTTTATTGTCTCCGCCGTGGCCGCTGAGGCTGACCTC 
GACACGGAGGAGGACCTGGAGCAGACCGCCACCGCCGTCCTTGATCCGCCCAAGCCTAAG 
AAAGGAAAAGCCGCTTTGGTTCTCAAGAGAGATAGAGTATGTGCTTTACCTACTTCAATT 
TCGCTTCCTTTACTCGTGAATCATCACTTTGTTTGCTTACCCATTGACAGACAAGGTCTA 
AGAGGTTTTTGGAAATCCAAAAGCTAAGGGAAACCAAAAAGGAGTATGATGTCAACACTG 
CTATCTCTTTGCTTAAACAAACTGCCAACACAAGGTTTGTTGAGTCTGTTGAAGCCCATT 
TCCGTCTCAACATCGATCCTAAGTACAATGACCAGCAGCTGCGTGCAACGGTCTGCTTTG 
CCTTTTGCTGGATATACACTCTATCTTGTGCTGCTTCATTCCACAACATTTTTTAATCTC 
AATGCATTGTCTTTTTGTATAGGTGAGCCTGCCTAAGGGAACTGGCCAGACTGTTATAGT 
CGCTGTTCTTGCACAAGGTATATTGCCCCACCAAATTCACTGCTAGGACTTAGGACAGAG 
ATTATGCTTTACCATTTCAGTCACCAAATTCACTGTTAGGACTTAGGACAGAGATAATGT 
TTACGGTATCAGTCAGTCAGTCAGTACTTCTCTAGATGCAACATTGTTTGGTGCGATTGA 
CTTTTTATTTATATATTGATTGGATGGAGTTCTTGTGTATCATGTGGCTTATTCTTTCTA 
AATCTTTGGCTTGCACCATTTCCATGCTGAACTTCCAGGTGAGAAGGTTGATGAAGCCAA 
AAGTGCAGGGGCAGATATTGTGGGCAGTGATGATTTAATCGAACAGATTAAAGGAGGCTT 
CATGGAGTTTGACAAGCTGATTGCATCCCCGGATATGATGGTCAAGGTATGTGTTGATGA 
TATAATGTTCTACTTGTTACAGCATATGAAACCGTCATGCTTGGCAAATAAGGTGGCATG 
AGATACTTGTAACTCGTGATCTATTTTCTAACATTCTTGAACTTGGCGCTTAGGTTGCTG 
GCCTGGGAAAGATTCTTGGACCACGGGGGCTCATGCCAAATCCCAAGGCTGGTACAGTCA 
CAGCGAACATTCCCCAGGTAAGCCTACTCTGCAACATCTTTTCCTGATTCTGGTAGTCAT 
GGCTTAAAGATGCATAAATCTCTCAGGCTATTGAAGAGTTCAAGAAGGGGAAAGTTGAAT 
TCAGAGCAGACAAAACTGGGATTGTTCACATTCCATTTGGGAAAGTTAATTTTACAGAGG 
AAGACCTTCTCATAAACTTCCTTGCAGCAGTGGTAGGCTAATTCTCCATTCTTATTACGT 
ATTTCTGTGGTTTAAAATACAAAAAAAAATGAAGAGGGAAAAGTAAATGATGAAATGCAG 
AAATCGGTGGAGACAAACAAGCCAAAGGGAGCTAAAGGAGTGTACTGGAAAAGCGCTCAC 
ATATGCTCGTCAATGGGGCCTTCCATCAAGTTGAACATAAGAGAGATGATAGACTTCAAG 
CCTCCCACTGCGAACTAATCGACAACGCCATTTGTAAATGGGGTCCTTTTGGGAGACGGG 
CAATGCCAGTGTAGACAGAGAAGAGAAACACCAAGTCTAGTCTGTTAGTAATCTTTTCAC 
GCCTCACTGCTTTGTATCACTTTGATGGCCATTTGCTTCTTGTCGTTATTTATTTACTAT 
TGCCTATTAAAATTTGGCAAGGGGCTGTACATGTCAGGACGCAGAACTCTTTAGTACTCT 
CTAAAAGAAAAGACCTTACATTGATCTTTAGGTTACATACGAGGAGGAGGTTTCTGTGTA 
CATTACATGTGATTTACTACTACAAATATTACAAGGCCAGACTCTGCTTCGTC
>AT3G63490.2 |  ribosomal protein L1 family protein 
GTGGATTAGGGAGACTCGCACTCTTCTTCTTCTTCTTTGTACCCAGAAAGAAAGAGAGCT 
CCAACAATGGCTGCTTGCGCTACTCACTCCTCTCTCATGCTAGCATACGCCGCCGCATCC 
ACTCGTTCCCAGGACCTTACCCCTACTCCATCTCTTTTCTCTTTTGCCAGCTCCAGACCC 
AACCACTTGAGCTTCCCGCTTCTTCTCCTTGGGGGTTCCAGGGACCGGAGATGTGCTGCT 
ATTGACAGAGCTTCCAACCACAAGTTTATTGTCTCCGCCGTGGCCGCTGAGGCTGACCTC 
GACACGGAGGAGGACCTGGAGCAGACCGCCACCGCCGTCCTTGATCCGCCCAAGCCTAAG 
AAAGGAAAAGCCGCTTTGGTTCTCAAGAGAGATAGAGTATGTGCTTTACCTACTTCAATT 
TCGCTTCCTTTACTCGTGAATCATCACTTTGTTTGCTTACCCATTGACAGACAAGGTCTA 
AGAGGTTTTTGGAAATCCAAAAGCTAAGGGAAACCAAAAAGGAGTATGATGTCAACACTG 
CTATCTCTTTGCTTAAACAAACTGCCAACACAAGGTTTGTTGAGTCTGTTGAAGCCCATT 
TCCGTCTCAACATCGATCCTAAGTACAATGACCAGCAGCTGCGTGCAACGGTCTGCTTTG 
CCTTTTGCTGGATATACACTCTATCTTGTGCTGCTTCATTCCACAACATTTTTTAATCTC 
AATGCATTGTCTTTTTGTATAGGTGAGCCTGCCTAAGGGAACTGGCCAGACTGTTATAGT 
CGCTGTTCTTGCACAAGGTATATTGCCCCACCAAATTCACTGCTAGGACTTAGGACAGAG 
ATTATGCTTTACCATTTCAGTCACCAAATTCACTGTTAGGACTTAGGACAGAGATAATGT 
TTACGGTATCAGTCAGTCAGTCAGTACTTCTCTAGATGCAACATTGTTTGGTGCGATTGA 
CTTTTTATTTATATATTGATTGGATGGAGTTCTTGTGTATCATGTGGCTTATTCTTTCTA 
AATCTTTGGCTTGCACCATTTCCATGCTGAACTTCCAGGTGAGAAGGTTGATGAAGCCAA 
AAGTGCAGGGGCAGATATTGTGGGCAGTGATGATTTAATCGAACAGATTAAAGGAGGCTT 
CATGGAGTTTGACAAGCTGATTGCATCCCCGGATATGATGGTCAAGGTATGTGTTGATGA 
TATAATGTTCTACTTGTTACAGCATATGAAACCGTCATGCTTGGCAAATAAGGTGGCATG 
AGATACTTGTAACTCGTGATCTATTTTCTAACATTCTTGAACTTGGCGCTTAGGTTGCTG 
GCCTGGGAAAGATTCTTGGACCACGGGGGCTCATGCCAAATCCCAAGGCTGGTACAGTCA 
CAGCGAACATTCCCCAGGTAAGCCTACTCTGCAACATCTTTTCCTGATTCTGGTAGTCAT 
GGCTTAAAGATGCATAAATCTCTCAGGCTATTGAAGAGTTCAAGAAGGGGAAAGTTGAAT 
TCAGAGCAGACAAAACTGGGATTGTTCACATTCCATTTGGGAAAGTTAATTTTACAGAGG 
AAGACCTTCTCATAAACTTCCTTGCAGCAGTGGTAGGCTAATTCTCCATTCTTATTACGT 
ATTTCTGTGGTTTAAAATACAAAAAAAAATGAAGAGGGAAAAGTAAATGATGAAATGCAG 
AAATCGGTGGAGACAAACAAGCCAAAGGGAGCTAAAGGAGTGTACTGGAAAAGCGCTCAC 
ATATGCTCGTCAATGGGGCCTTCCATCAAGTTGAACATAAGAGAGATGATAGACTTCAAG 
CCTCCCACTGCGAACTAATCGACAACGCCATTTGTAAATGGGGTCCTTTTGGGAGACGGG 
CAATGCCAGTGTAGACAGAGAAGAGAAACACCAAGTCTAGTCTGTTAGTAATCTTTTCAC 
GCCTCACTGCTTTGTATCACTTTGATGGCCATTTGCTTCTTGTCGTTATTTATTTACTAT 
TGCCTATTAAAATTTGGCAAGGGGCTGTACATGTCAGGACGCAGAACTCTTTAGTACTCT 
CTAAAAGAAAAGACCTTACATTGATCTTTAGGTTACATACGAGGAGGAGGTTTCTGTGTA 
CATTACATGTGATTTACTACTACAAATATTACAAGGCCAGACTCTGCTTCGTC
>AT3G63490.2 |  ribosomal protein L1 family protein 
GTGGATTAGGGAGACTCGCACTCTTCTTCTTCTTCTTTGTACCCAGAAAGAAAGAGAGCT 
CCAACAATGGCTGCTTGCGCTACTCACTCCTCTCTCATGCTAGCATACGCCGCCGCATCC 
ACTCGTTCCCAGGACCTTACCCCTACTCCATCTCTTTTCTCTTTTGCCAGCTCCAGACCC 
AACCACTTGAGCTTCCCGCTTCTTCTCCTTGGGGGTTCCAGGGACCGGAGATGTGCTGCT 
ATTGACAGAGCTTCCAACCACAAGTTTATTGTCTCCGCCGTGGCCGCTGAGGCTGACCTC 
GACACGGAGGAGGACCTGGAGCAGACCGCCACCGCCGTCCTTGATCCGCCCAAGCCTAAG 
AAAGGAAAAGCCGCTTTGGTTCTCAAGAGAGATAGAGTATGTGCTTTACCTACTTCAATT 
TCGCTTCCTTTACTCGTGAATCATCACTTTGTTTGCTTACCCATTGACAGACAAGGTCTA 
AGAGGTTTTTGGAAATCCAAAAGCTAAGGGAAACCAAAAAGGAGTATGATGTCAACACTG 
CTATCTCTTTGCTTAAACAAACTGCCAACACAAGGTTTGTTGAGTCTGTTGAAGCCCATT 
TCCGTCTCAACATCGATCCTAAGTACAATGACCAGCAGCTGCGTGCAACGGTCTGCTTTG 
CCTTTTGCTGGATATACACTCTATCTTGTGCTGCTTCATTCCACAACATTTTTTAATCTC 
AATGCATTGTCTTTTTGTATAGGTGAGCCTGCCTAAGGGAACTGGCCAGACTGTTATAGT 
CGCTGTTCTTGCACAAGGTATATTGCCCCACCAAATTCACTGCTAGGACTTAGGACAGAG 
ATTATGCTTTACCATTTCAGTCACCAAATTCACTGTTAGGACTTAGGACAGAGATAATGT 
TTACGGTATCAGTCAGTCAGTCAGTACTTCTCTAGATGCAACATTGTTTGGTGCGATTGA 
CTTTTTATTTATATATTGATTGGATGGAGTTCTTGTGTATCATGTGGCTTATTCTTTCTA 
AATCTTTGGCTTGCACCATTTCCATGCTGAACTTCCAGGTGAGAAGGTTGATGAAGCCAA 
AAGTGCAGGGGCAGATATTGTGGGCAGTGATGATTTAATCGAACAGATTAAAGGAGGCTT 
CATGGAGTTTGACAAGCTGATTGCATCCCCGGATATGATGGTCAAGGTATGTGTTGATGA 
TATAATGTTCTACTTGTTACAGCATATGAAACCGTCATGCTTGGCAAATAAGGTGGCATG 
AGATACTTGTAACTCGTGATCTATTTTCTAACATTCTTGAACTTGGCGCTTAGGTTGCTG 
GCCTGGGAAAGATTCTTGGACCACGGGGGCTCATGCCAAATCCCAAGGCTGGTACAGTCA 
CAGCGAACATTCCCCAGGTAAGCCTACTCTGCAACATCTTTTCCTGATTCTGGTAGTCAT 
GGCTTAAAGATGCATAAATCTCTCAGGCTATTGAAGAGTTCAAGAAGGGGAAAGTTGAAT 
TCAGAGCAGACAAAACTGGGATTGTTCACATTCCATTTGGGAAAGTTAATTTTACAGAGG 
AAGACCTTCTCATAAACTTCCTTGCAGCAGTGGTAGGCTAATTCTCCATTCTTATTACGT 
ATTTCTGTGGTTTAAAATACAAAAAAAAATGAAGAGGGAAAAGTAAATGATGAAATGCAG 
AAATCGGTGGAGACAAACAAGCCAAAGGGAGCTAAAGGAGTGTACTGGAAAAGCGCTCAC 
ATATGCTCGTCAATGGGGCCTTCCATCAAGTTGAACATAAGAGAGATGATAGACTTCAAG 
CCTCCCACTGCGAACTAATCGACAACGCCATTTGTAAATGGGGTCCTTTTGGGAGACGGG 
CAATGCCAGTGTAGACAGAGAAGAGAAACACCAAGTCTAGTCTGTTAGTAATCTTTTCAC 
GCCTCACTGCTTTGTATCACTTTGATGGCCATTTGCTTCTTGTCGTTATTTATTTACTAT 
TGCCTATTAAAATTTGGCAAGGGGCTGTACATGTCAGGACGCAGAACTCTTTAGTACTCT 
CTAAAAGAAAAGACCTTACATTGATCTTTAGGTTACATACGAGGAGGAGGTTTCTGTGTA 
CATTACATGTGATTTACTACTACAAATATTACAAGGCCAGACTCTGCTTCGTC
>AT1G80620.1 |  ribosomal protein S15 family protein 
CAAAAACCCTAAAAGCTCCCGGAGCCGCCAAGATCAGTTTCCATGGCGCTTCATCTCGCC 
AGACCAAAACAAAGGTTACATTCGAATCCATCTCTCATTCACCTTTTCTCAACCTCCTCC 
TCCTCCTCCTCATCATCACCTCAAGACGGGAACGAATCTAATGAACAGCCCTCTCAATCA 
TCGTCGGATTATAAAATCTCTTCCTACTTCAGTGGTATCAGAAGCAGTCTCAAACAGACT 
CAGTCTCAGGACGGGAAGAGACAGTTCGTCAGATTCGATGCCAAACCTCAGAATTCGCTT 
TCCGGTAACCAGGATATCAGGAGGAATCTGAACGAGTTCCGAAGTAGAGCAACAGCTCCG 
CCGCCGAGGGATATGCAGGATCTTTTCAAGCAGAATGTGTTATCAAAATCTGGAGGGACT 
CGTAGAATCGAAGGTGTGCCATTAACAAACATAAAGGCGAACTTAAGGCAGATGAGACCA 
CAACAAGCAACCACTGAGAGCAAATGGGCCAATTTATCTGGGATTCAGAACATTATGAAG 
ACGAACATCAATGATAATATCCGTTCAAATGTAATCGGAGGAGCAGCAGAAGGATTGCCA 
CATTCAGTGGTTGGGAAGGAGTTAGAAGAAGAAGATGTGACAGAGGAGGAGATGAAATCA 
GAGTTTATCAAGAGCTATGATCCAATAGAACTGGGAGAGAAACTAAGATTGTATAGGCCT 
GAGGGAAAGAAAGAAGAAGGTTGGTTCTCATTACAGGAGCTCAATCAGAGGCTTGTTAAG 
CTCAGGGCCATGGAAGAGGAACAATTCCAGAAAACGAGTATAGTGCATCCCTCCTTCGTC 
AACAACTTGAGGTCTGAGTTTCATAAGTTCACCAAGGCTCAGAAATCAGATCCCTGTAGG 
TTCCGAGGCCCTCTCATAACTACTCTTTCTTCGTGTGTGTGTTTATATATATGATGACTT 
GTTTGGTTACAATCTCAAACACTCTGGTATGATCAATTTGCGACCGTAAAGAGTTGGTTT 
TTATGCTTGCTGCTTTCTTGGTTTTGATTTGTTCTCGCTTGTTGTTATTTAATTGGAAGA 
TAAATTTGTTTGCAGTTCAGAATACGAATATTTGGGGAGTTTTAAGTGGTACCCCAAAGT 
ATATGCTCGAGCCTCCAAAAGATCAACTAGTTGAAACTGTAAGTCTTTTCCTTCTTACTT 
ACTGAATCATTTTAGCTTGTAGCCATTTTAAGATTTTTTTGACATCGATTTTGTTGATCA 
AATGCAGTATTTCCATCCGGATAACATGTCATCTGCGGAGAAGATGAAAATCGAGCTTGC 
AAAGGTCAGAGAAGAGTTCAAGATGTCAGAATCGGATTGTGGTTCTGCACGTGTTCAAGG 
TATCTGTTCTTATAAGTGTTGGCTTTTAGCTATTGAAGACGATATTACATTTCCTGAGGC 
TAAATTAAGCCAGCTAATTAGAGGTCACTGCCTTTGTTATTTTTGGGAACAAAATGTCAC 
AAGTACTGATTTAGTGATCTCTATGGCTTTTTCTTGTAGTGGCGCAACTGACCACTAAGA 
TCAAGCATCTATCCTCGGTTCTACATAAAAAGGTAAACTTTCAATCTTTTTTTTTAATCT 
GAAGCTACCAGCTCCGGGTTTCTACTGTAACCTGACCTTGCATCTTTATAACCTTAGGAC 
AAGCATTCGCGGAAAGGACTTATAGCAATGGTGCAGAGACGGAAGAAGCTGTTGAAGTAT 
ATGAGAAGAACGGACTGGGATTCTTACTGCCTTTCACTGTCAAAACTCGGCCTTCGTGAC 
AACCCGGATTACAAGTTTTGAAATTTTTGTGCAAGGGACATCATAGAATTGTGATCTCAG 
TACTCTCTTTTTGTTCTTTTTCATTATGGCAAAAGAGATAATGTGGGTCTCTCTTATCAA 
TCATCTTGGGGAGGAAAGTTGTTCTACTAGAGATTATGATTGCAGGCTGTTTAGGCGAAA 
AGAGAATAAAGCTGTGGGATACTTTCGTTGACATTGTCTTTATTACTTTGAATGTGATAA 
TAAACTTACTTCTCCA
>AT4G30690.1 |  translation initiation factor 3 (IF-3) family protein 
TTAAATCGGATCATTCTAATTGGTGGAGAGACAGACTCTGGACTCTGAAGAAGCAAATGG 
CTGGGATCACCAGCACCGTTGGATTCAACGCCATTCTCGCCGGAGCCACCAAAACGGTGT 
CGCATCCTGTTAAATCTAAGCTCTTTGGTCTTCGACTCTGTGTACCCGAATTCTCAATTG 
TTTCTCTTTCCCCTTATCATCATCGCCGTTGTCCCGCCATCACTTGCCGTTACGGAGGCG 
GTGGTGGCGGAGGCTCTAGATTTCCCGGCGATAGGAGAGGTAGGCAGAAAGAATCCGAGG 
ATGATGATTCGCTTGATATCTCAGCTATTAGGTAATTGTGGAAACTATTAATTGATAGAA 
ATTGAAATTTCTGTAGCTGAAGTTATGATTGATTTTGATGTATCTCAAATTGAGTAGGTC 
AGCCACTGTTAGGCTTATTGATGATCAGCAGAACATGGTAAAATGAAGTGCCTTTTAAAT 
GTTTAAACTTTTTGATTTCAGCAAAAATTGAAAATTTTCCAGTTTCTTTGTTGTTTAGAT 
TGGTTTAGTTTCCAAAGAAGAAGCTGTTCGAAGAGCTGAAGATGCTGAGCTTGATCTGGT 
TTGTGTTTCTTTGGATAATTTACAACTTGTAAGTACCTTTCTTGTAAGCTGAGCTTGATC 
TCATATGGTTTTCAGGTGATTCTTTCGCCGGATGCAGATCCTCCGGTTGTTAGAATGATG 
GATTACAGGTAAATTATCTCAAGGATGATAATTTGTATCATATACATTGTGTAGAGGAAG 
TTTCAAGGAGAATGATTCTTTTTCCTTTTTGCTTCATTATCAGTAAATACAGATATGAGC 
AGCAAAAGAGGAAAAAGGAACAGCAGAAGAAAAGTATTGATCATTCTTCTCTGCTTAACT 
GGAGATAATGTTGAAACTATAAGTGTGTATACTGTGTCGTATTTTACATGAATGGATTGT 
GTAACTGAAGCTTTCTTCTTATGTCAGCTACTCGAATGGACTTGAAGGAGCTTAAAATGG 
GGTGATTTGAGCCATTTTCACTATCTCTTTTATCTGTGTCGTTGTGATGCTTTTGTTTAG 
AAAAGCTTCTTCTCAAAAGGTTTTTGTATTTTGTTTCTCCGGTAGTTATAACATCGATCA 
GCATGATTATTCTGTACGCATGAGAGCAGCCCGGAAGTTCTTGCAAGACGGTGACAAGGT 
TGTCCCCACTTACTTTGTTTTGTGTTATAGGCGAGTTCTGTCACATTTTGTTAATGTGTG 
ACTTGTAATACACTCAGGTTAAAGTGATTGTGAACATGAAAGGCCGAGAAAACGAGTTCA 
GAAATATTGCTATTGAGCTCCTCAGACGTTTTCAGACTGAAATAGGAGAGGTCTGTATTG 
TTTCTCTATGCTCTTTCCTAATACAAGTTTGGTATTGGATTTGCACCTTAATGGATCGTT 
TTTGTTGAGTCACTGAAACTCATCAACATATGCAGCTTGGTACTGAGGAGAGCAAAAACT 
TTCGGGACAGAAATTTGTTTATTGTCTTGGTGCCAAACAAGGAAGTTATTCGGAAAGTGC 
AAGAACCACCCCCAAAAAAGAAGAAAAAGCCAGCGGATGATAAAGTTTCAGCAGCAAATA 
TAACTGCAACACAAGATATATGATGCGGAATTGTCTGATGTAAAATGTTCTGTGACTTTG 
ATAAATTTCTGTATAGTTTCTTTTTTAATATGCTTCTTGCATTTCCATGTAATTGTAACC 
ATAGAAATAGATTATTTGAATGAAGATCTTCGTCAACTTTT
>AT3G03710.1 |  RIF10 (resistant to inhibition with FSM 10) 3-5-exoribonuclease/ RNA binding / nucleic acid binding / polyribonucleotide nucleotidyltransferase 
ATGTTGACGAGTCCCAGTAACGCACTTCACAGTAGTACTCCACAATTCTGGCCACTTCGC 
CGGAGCAAGCTTTGCCGTTCCCGGAATTTCCCTCGTTTTCACTCCGGCGAACGCAGCAGC 
GGCGGAGGAGGAAAATTGTGCTCGCTCTCTCTTCTCTCCGGAAGTGGCGCCGGTAAATTC 
AGTGTCAGAGCTCTAGTTAGGCCTGATGATACCGACGACGCTGACTCCGTCGGCGATGGG 
TCTCTGGCTTTTCCTAACCACGTTTCTGTCAAAATTCCATTCGGAAATAGAGAGGTAATT 
TCTTCAAAAAGCTGTACTCTTTTGATTTCATTGGTTGCAAGTTTGAATTCGGAGTTGATT 
GGTAGGATTTGAGACCTTTAGCTCCATAGTAGAGAAGCAAAGCTCGCTGTTTAGATGAAT 
GTGTTGAACATTGTTCAAAGTTTTTCATCTTTTCTTTCTTTTTGTCTACTCTGTAGATTT 
TAGTTGAGACTGGTCTCATGGGGAGACAAGCAAGTTCTGCAGTCACGGTCACAGATGGAG 
AAACTGTAAGTGTGCTGCTTCATTCAATTTCCAAAACTTTCAACTTTTTAAATGTTTTTG 
CTTATCTCTTAATCGGTTTGTTAGATGCGGAAGCTTTGTTTTATTTTTTACTCTGTCTAC 
TTGTCATTGTAGATTGTCTACACATCCGTTTGTCTAGCTGATGTTCCGAGTGAGCCATCA 
GATTTTCTTCCCCTTTATGTTCACTATCAGGAGCGATTCTCAGCTGTAGGTCGAACTAGG 
TAAGCGTCTTTCAAGCTCTTGCAATTTTGGAGTCTCTTGCTATAAGAAGACCATATCATT 
GCCTAAATGATGATCTAAATGGACCTTCTTATGGTACAGTGGTGGATTTTTTAAGCGAGA 
AGGGAGAACCAAAGATCACGAGGTATGTACTAATGATGGTTTTGGTTTCGTCTAATTCGC 
CATCCTTCTTAACATGTTTCTACTTTTGATTTTTATGCAGGTTCTGATTTGTAGGTTGAT 
CGATAGACCTCTACGCCCCACTATGCCCAAAGGTTTCTACAATGAAACTCAGATTTTATC 
CTGGGTATGCTTCTTCTCCATGGATATCTTTATGTTCCGATAGGCCCTTTTTTTGTCTGT 
TTTGCCTCTCTTTGGTTGAACAAAATACCTTTTGACTTGCGCTTTCTTTTGTCTCTGTAT 
GATGGCGTCTCCTGTTTTGTGTGCCTACTACCTTTTTCGGAAAATGATGTACATTGTTTT 
TTTATACTTAAACATATATGGGATGGTTGTATTCATCTCCTTTGTTTGAGTCTCATTCGT 
AATTGACCTGTTGCTTGTTTGTGGTTTCAGGTTTTGAGCTACGATGGATTACACGCACCT 
GATGCTTTAGCTGTTACATCTGCTGGAATTGCTGTGTATGTAGGGTCATCTTTTTCCGTT 
TACATATGAGTGAAGCTTTTTTATCTTGGCAAAGTTGACATGGCTATGTAATAAATGAAT 
ACCGCAGAGCTCTTTCAGAAGTACCAAATGCGAAAGCGATTGCAGGAGTTCGGGTTGGTC 
TTATTGGGGGTGAATTCATTGTCAATCCAACCGTGAAGGAGATGGAAGAATCACAGCTAG 
ATTTGTTTCTAGCTGGAACAGATACTGCAATTCTAACGATAGAGGTAAACTCTAATCTTT 
ACTTGAGTTTGCAAGATTTGCCCTTTCTCTCCTGTTTTTTTTTTTTTTTCTATACTCAGC 
CCTTGCTCATTGAAAAATCTGGGATTGCAGGGATACAGTAATTTTCTTCCTGAGGAAATG 
CTTCTCCAAGCTGTTAAAGTTGGACAGGTATTTCGATTTTTAATTCGGATTATTTCAATT 
TTTAAAAGTCTGAATTAGATACTAAATGTGAGGCTTTTTCATTTTTACCAGGATGCTGTA 
CAGGCTACATGCATTGCTATTGAAGTTTTAGCAAAGAAATATGGAAAGCCTAAAATGCTT 
GACGCTATCAGATTACCACCTCCAGAGCTATACAAGCATGTGAAAGTATGTTATACACTT 
TGTTTCTGTTTCGTTTTGCCAGAATGGAATTGCATTGATATTATTTTGTAATTCATGTTT 
AAAATGAATTGTTTTATGTACACAGGAACTTGCTGGTGAGGAATTGACAAAAGCGTTACA 
AATTAAGAGTAAAATATCGAGAAGGAAAGCCATATCGTCCCTGGAAGAAAAGGTCTTGAC 
AATACTGACAGAGAAGGGATATGTTATTGATGAGGTAGCTTTTGGAACCATAGAAGCACA 
ACCGGATCTGTTGGAGGATGAAGACGAGGATGAGGAAGTTGTTCCTGAAGGTGAGGTGGA 
CCAAGGCGATGTTCACATTAGACCCATCCCTCGGAAACCTATTCCTTTAGTGAGTCTCTT 
AACCTTTTCAACATGATAACTTGAATGTGACCTTTTATCATATTCATTTTTTCTTAAATG 
TAATGCTAACAAACTAGTCATTTCCCTTTGCTAGCTATTTTCTGAAGTAGATGTCAAGCT 
AGTCTTCAAAGAAGTATCGTCGAAGCTTCTACGTAGGCGAATTGTTGAGGTACAACATCT 
GATTTCTTGGTATTTATACCCTAGACATGTATGTTTAAGGATTTATTTTCTCACTGAAGC 
ATTTTATGAACTACACTACATTAAAGAATCTAACATGTTTGAAGCCACACATCTTTCACA 
TTGTCTCCTAGTAATTCTTTCCTAAATTTTCATTTTTGTTTTCACTTTTTCGGAATGAGC 
TTTATTGATTCCATATGACATCTTTCTTCATCCATAGGGAGGTAAAAGAAGTGATGGTCG 
GACTCTGGATGAGATTCGTCCAATTAATTCAAGATGTGGACTGCTTCCCAGGGCACATGG 
AAGTACTCTGTTCACACGTGGGGAAACACAGGTAACATAGGAATGTTGTCTTCTGGAGAA 
ATCCTGCGTGGCTATTTCATATGTCGATCCTTTCTCTTATCGCCTTTTATGTATTTTAAG 
GCAATTGGTTTGCTAATGAACATTTAGTATGATTCTTTCAGGCACTGGCAGTTGTTACGC 
TTGGTGATAAACAAATGGCGCAGAGAATTGACAACCTTGAGGGTTCTGATGAATACAAGA 
GGTTCTATCTTCAGGTCTCTTTTATATTTGTTCTTCTCACTTTGTTATTATTATTACAGT 
TGACTTTTTATTAGACAAAGTAAACTTTTTGATGTGGTTAGTTGCTTAGTGTCGTTCTTC 
ATTTTTCTTGTTGTGCTTAAAGAGATTTTCTAAGCTAGTCATTGTGATGTTGCAGTACAC 
TTTTCCTCCATCGTCTGTTGGTGAAGTTGGACGAATTGGTGCACCCAGTAGAAGAGAAAT 
AGGTCATGGGACACTAGCAGAGCGAGCATTGGAGACCATTCTACCTAGTGATGATGACTT 
TCCTTACACAATACGTGTTGAAAGTACAGTAATTGAAAGCAATGGTTCTTCAAGGTCAGC 
TTTTTTATCTGGTTTTATGATCTGCACGCCTAGTTTGTTTGAATGACAAATTTGGTAATT 
GCTTCTTACGTTGATCTCAAAATGTGACAGTATGGCATCTGTTTGTGGCGGTTGCTTGGC 
TTTGCAAGATGCTGGAGTTCCAGTCAAATGTTCTGTTGCTGGGATAGCAATGGGAATGGT 
TTGGGATACTGAAGAATTTGGAGGTGATGGATCTCCCCTTATCCTTTCTGACATCACTGG 
AGCTGAAGATGCATCTGGTGATATGGACTTTAAGGTCAGAAAATATGAGGATTCCCTTGA 
AGGACCTTGCATTGACTTGAATGCTGAAGTTTTGATATGTTTGTCAATAGGTTGCTGGGA 
ATGAAGATGGCGTTACCGCCTTTCAGATGGACATCAAGGTCATCATCCGTTTCTTAATTT 
ACACTACCGAAATGGTTTTAAATGGCAATTGAATTAATATGTTGGTAACATCTTTTCTTA 
CTTCTTCTCTTTAATCATGAACTAGGTAGGAGGAATTACTTTAGAGATAATGGAAAAGGC 
TCTAATACAGGCAAAAGCTGGGCGTCGCCATATTCTTGGTAAGGAATGTTATTCATGAAT 
TATTAGTCTCAAGATAGTAGACTTGGGGAGATTTAGTTCCTTGGAAAATGTATGCCACAA 
AAGATGTAATTTACTATATTTTTTTTTTTCCTTTTTGTGCAGCTGAAATGGCAAAGTGCT 
CACCGCCTCCCACGCTAAGCCTCTCAAAATATGCTCCATTGATACTTATTATGAAGGTTT 
GGCTTCAACTAGTTTTTCCAGGATTGCCCAGTCTAATGCCTTTCTGCCTTGAACTAAAGA 
TTGTTGGCGTTTCATGTGCTGCAGGTTCATCCAAGCAAAGTATACTCTCTTATTGGTTCT 
GGAGGTAAGAAAGTAAAGAGCATCATTGAAGAATCTGGAGTTGAGGCCATTGACATGCAA 
GATGATGGAACTGTGAGATATACATGCAAAAAAATGTGATTTTATATTTATTGGGTATTC 
TTTATCCTAACTTCTTAATATTTATCTTTGTCAAGGTCAAAATTATGGCAATTGATGTAG 
CGAGTCTAGAAAGGGCGAAAGCGATTATTAGTGGATTGACAATGGTTCCCTCTGTTGGTG 
ATATCTACAGGTATGTATCCTTCATATACCTTCTCTGACCAAAAAGCGTAAATAGATTTG 
GATTCTTACCTTTCTTTTTGTATCAGGAATTGTGAAATCAAGTCAATGGCTCCTTATGGT 
GCATTTGTAGAGATAGCGCCTGGGCGGGAAGGTCTTTGCCATATCAGTGAGCTGAGTGCT 
GAATGGCTTGCAAAACCAGAGGATGTGAGCATTACTCATTGATTCCCTTCCTTTATAGAA 
ATTGTTTCATCTTTTATTCAGGTTTTCACATACGCTCATTCTTGTCCTTTCAGGCCTATA 
AAGTAGGAGACCGCATTGACGTCAAATTAATAGAGGTCAGCGAGTTATTGTGTCTTTATA 
ACTCAAGAGACAATATAACTAATCGGAAATGATAATTAGAGAGTTGTTGAACAAAGAAAC 
ATGGATAATGCAGGTAAATGAAAAGGGTCAGCTTCGACTTAGTGTACGGGCTTTACTTCC 
CGAATCAGAGACAGACAAAGACAGTCAGAAACAACAGCCGGCAGGTGATTCTACCAAAGA 
CAAGAGTTCGCAAAGGAAATATGTAAATACTTCGTCAAAGGACCGTGCAGCTGCAGGAGC 
ATCAAAGGTTTCATCTGGGGATGAACTTGTCCTGAAGAAGAAAGATGTAAGGAGAGCAAC 
TGGTGGTAGTAGTGACAAGACAATGAATAGCAATAGCAGTACCAACGAAGAAAGTTTAGT 
CAACGGTGAAGCTACAATCAGCTAGTGGAATGCAAACAAGATCACTGTTCATATCTGTGT 
CTCGTGAGACTCATTACGAAAGGAGGAGAGTTTCTTCCAACGGAACCACAGGTGCGACTT 
GAGAAATCTTGAAAACTTGAGACAAGACAAGTTGCAAATGTCTTTTCTTGATTTTTTTTC 
TAATGTTTTGTAATTATGTTTCTTGGCAGTTTCTTGAAGCTGTGCATATATGTTGGCAAG 
TCTGGTGTGGAGGAGGATAACATTTTTGAAGACGTCATATGTTGGGAGATTCTCAGACAT 
TTCATCAGTTCTTTCTGTTGTCTTCTCTCTTGCAAACTCATTAGTCCGTTTAGGTTACTT 
GATATATTAATGTTTTTGACTAAATTTTATTTGGGATAGATGATTTTTCTTCAGCTTGTC 
AAAGTTTCCCAATTTTTGTTATGTTTCGAGTTATTAG
>ATCG00740.1 |  RNA polymerase alpha subunit 
ATGGTTCGAGAGAAAGTCAAAGTATCTACTCGGACACTACAGTGGAAGTGTGTTGAATCA 
AAAAGAGACAGTAAGCGTCTTTATTATGGACGCTTTATTCTGTCTCCACTTATGAAAGGC 
CAAGCCGACACAATAGGCATTGCGATGCGAAGAGCTTTACTTGGCGAAATAGAAGGAACA 
TGTATTACACGTGCAAAATCTGAGAACATACCACATGACTATTCTAACATAGCAGGTATT 
CAAGAATCAGTACATGAAATTTTAATGAATTTGAACGAGATTGTATTAAGAAGTAATCTA 
TATGGAACGCGCAACGCGCTTATTTGTGTCCAAGGTCCTGGATATATAACTGCTCGAGAC 
ATTATTTTACCGCCCGCTGTGGAAATCATTGATAATACACAGCATATAGCTACCTTAACA 
GAACCAATAGATTTGTGTATTGAATTAAAAATTGAGAGGAATCGCGGATATAGTCTAAAA 
ATGTCAAATAACTTTGAAGACAGAAGTTATCCTATCGATGCTGTATTCATGCCTGTTGAA 
AATGCCAATCATAGTATTCATTCTTATGGGAATGGGAATGAAAAACAAGAGATTCTTTTT 
CTAGAAATATGGACAAATGGAAGTTTAACTCCTAAAGAAGCACTTCATCAAGCCTCCCGG 
AATTTGATTAATTTATTTATTCCTTTTCTACATGTAGAAGAAGAAACGTTCTATTTAGAG 
AACAATCAACATCAAGTTACTTTACCCTTTTTTCCTTTTCATAATCGATTAGTTAACCTA 
AGAAAAAAAAAAAAAACAAAAGAACTAGCCTTTCAATATATTTTTATTGACCAATTAGAA 
TTGCCTCCCAGAATCTACAATTGTCTCAAAAAATCCAATATACATACATTATTGGACCTT 
TTGAATAACAGTCAAGAAGACCTTATCAAAATTGAACATTTTCACGTAGAAGATGTAAAA 
AAGATATTAGACATTCTAGAAAAAAAATAG
>ATCG00160.1 |  Chloroplast ribosomal protein S2 
ATGACAAAAAGATATTGGAACATCGATTTGGAAGAGATGATGAGAGCAGGAGTTCATTTT 
GGACATGGTACGAGGAAATGGAATCCTAGAATGGCACCTTATATTTCTGCAAAGCGTAAA 
GGTATTCATATTATAAATCTGACTAGAACTGCTCGTTTTTTATCAGAAGCTTGTGATTTA 
GTTTTTGATGCGGCAAGTAGGGGAAAACAATTCTTAATTGTTGGGACAAAAAATAAAGCA 
GCTGATTTAGTGTCGCGGGCTGCAATACGGGCTCGGTGTCATTATGTTAATAAAAAATGG 
CTCGGCGGCATGTTAACAAATTGGTCCACTACCGAAAAAAGACTTCATAAGTTTAGGGAC 
TTGAGAACTGAACAAAAGACAGAGGGATTCAACCGTCTTCCGAAAAGGGATGCAGCTGTG 
TTGAAGAGACAATTATCTCGCTTGGAAACATATCTAGGCGGGATTAAATATATGACGGGA 
TTGCCTGATATTGTAATCATCCTCGATCAGCAAGAAGAATATACGGCTCTTAGAGAATGT 
ATCACTTTGGGAATTCCAACCATTTCTTTAATCGATACAAATTGTAATCCCGATCTCGCG 
GATATTTCTATTCCCGCAAATGATGACGCTATAGCTTCAATTCGATTCATTCTTAACAAA 
TTAGTATTCGCAATTTGTGAGGGCCGTTCTAGCTATATACAAAATTCTTGA
>ATCG00380.1 |  Chloroplast encoded ribosomal protein S4 
ATGTCACGTTACCGAGGGCCTCGTTTTAAAAAAATACGCCGTCTGGGGGCTTTACCGGGA 
CTAACTAGTAAAAGGCCTAAGGCAGGAAGCGATCTTAGAAACCAATCACGCTCCGTAAAA 
AAATCTCAATATCGTATTCGTTTAGAAGAAAAACAAAAATTGCGTTTTCATTATGGTCTT 
ACAGAACACCAATTACTTAAATATGTGCGTATAGCCGGAAAAGCCAAGGGGTCAACAGGT 
CAAGTTTTACTACAATTACTTGAAATGCGTTTGGATAACATCCTTTTTCGATTGGGTATG 
GCTTTGACTATTCCTCAAGCGCGCCAATTAGTTAATCATGGACATATTTTAGTTAATGGT 
CGTATAGTTGATATACCAAGTTATCGCTGCAAACCCCGAGATATTATTACAGTGAAGGAT 
GAACAAAACTCTAGAACTTTGGTTCAAAATCTTCTTGATTCATCTGCCCCTGAGGAATTG 
CCAAACCATCTGACTCTTCACACATTCCAATATGAAGGGTTAGTCAATCAAATAATAGAT 
AGGAAATGCGTCGGTTTGAAAATAAATGAATTGCTTGTCGTAGAATATTACTCTCGACAG 
ACTTAA
>ATCG00800.1 |  encodes a chloroplast ribosomal protein S3 a constituent of the small subunit of the ribosomal complex 
ATGGGACAAAAAATAAATCCACTTGGTTTCAGACTTGGTACAACCCAAAGTCATCATTCT 
CTTTGGTTTGCACAACCAAAAAAGTATTCTGAAGGTTTAGAAGAAGATAAAAAAATACGA 
GACTGTATTAAAAATTATGTCCAAAAAAATATAAGAATATCCTCTGGTATGGAGGGAATT 
GCACGTATTGAAATTCAAAAAAGAATCGATCTCATCCAGATCATAATCTATATGGGATTT 
CCTAAATTATTAATTGAAGATAAACCCCGAAGAGTCGAAGAATTACAGATGAATGTTCAA 
AAAGAACTAAATTGTGTCAATAGAAAACTCAACATTGCTATTACCAGAATTTCCAATCCG 
TATGGGGATCCTAATATTCTTGCAGAATTTATCGCTGGACAATTAAAAAATCGCGTTTCT 
TTTCGAAAAGCAATGAAAAAAGCTATTGAATTAACTGAACAGGCGAATACAAAAGGAATT 
CAAGTACAAATTGCAGGACGTATCGACGGAAAAGAAATTGCACGTGTTGAATGGATCAGA 
GAAGGCAGAGTTCCTTTACAAACAATTGAAGCTAAAATTGATTATTGTTCCTATACAGTT 
CGAACTATTTATGGGGTTTTAGGAATAAAAATTTGGATATTCGTAGACGAAGAATAA
>ATCG00830.1 |  encodes a chloroplast ribosomal protein L2 a constituent of the large subunit of the ribosomal complex 
ATGGCGATACATTTATACAAAACTTCTACCCCGAGCACACGCAATGGAGCCGTAGACAGT 
CAAGTGAAATCCAATCCACGAAATAATTTGATCTGTGGGCAGCATCATTGTGGTAAAGGT 
CGTAATGCCAGAGGAATAATTACCGCAAGGCATAGAGGGGGAGGTCATAAGCGTCTATAC 
CGTAAAATAGATTTTCGACGAAATGCAAAAGACATATATGGTAGAATCGTAACCATAGAA 
TACGACCCTAATCGAAATGCATACATTTGTCTCATACACTATGGGGATGGTGAGAAGAGA 
TATATTTTACATCCCAGAGGGGCTATAATTGGAGATACCATTGTTTCTGGTACAGAAGTT 
CCTATAAAAATGGGAAATGCCCTACCTTTGAGTGCGGTTTGAACTATTTGATTTACGTAA 
TTGGAAGTAACCAATTAGGTTTACGACGAAACCTAGAAATCGATCACTGATCCAATTTGA 
GTACCTCTACAGGATAGACCTCAACAGAAAACTGAAGAGTAACGGCAGCAAGTGATTGAG 
TTCAGTAGTTCCTCATATAAAATTATTGACTCTAGAGATATAGTAATATGGAGAAGACAA 
AATTGTTTCAAGCACCGACAGAACCATAAGCGCCCCTTGTTTCAAAGAGAGGAGGACGGG 
TTATTCACATTTCATTTGATGGTCAGAGGCGAATTGAAAGCTAAGCAGTGGTAATTCTAA 
AGATTCCCCCGGGGAAAAATAGAGATGTCTCCTACGTTACCCATAATATGTGGAAGTATC 
GACGTAATTTCATAGAGTCATTCGGTCTGAATGCTACATGAAGAACATAAGCCAGATGAC 
GGAACGGGAAGACCTAGGATGTAGAAGATCATAACATAAGTTATTCGGCAGATTTTGATT 
CCTATATATCCACTCGTGTGGTACTTCTACCATATATAGAAGAATTCTACGATATATATA 
AGATCCATCCGTATAGATATCATCATCTACATCCAGAAAGCCGTATGCTTTGGAAGAAGC 
TTGTACAGTTTGGGAAGGGGTTTTGATTGATCAAAAAGAAGAATCTACTTCAACCGATAT 
GCCCTTAGGCACGGCCATACATAATATAGAAATCACACTTGGAAGGGGTGGACAATTAGC 
TAGAGCAGCGGGTGCTGTAGCGAAACTGATTGCAAAAGAGGGGAAATCGGCCACATTAAA 
ATTACCTTCTGGAGAGGTCCGTTTGATATCCAAAAACTGCTCAGCAACAGTCGGACAAGT 
GGGAAATGTTGGGGTAAACCAGAAAAGTTTGGGTAGAGCCGGATCGAAATGTTGGCTAGG 
TAAACGTCCTGTAGTAAGAGGAGTAGTTATGAACCCTGTCGACCATCCCCATGGAGGTGG 
TGAAGGGAGGGCTCCAATTGGTAGAAAAAAACCCGTAACCCCCTGGGGTTATCCTGCACT 
TGGAAGAAGAACTAGAAAAAGGAAAAAATATAGTGAGACTTTGATTCTTCGTCGCCGTAG 
TAAATAG
>ATCG01240.1 |  30S chloroplast ribosomal protein S7 
ATGTCACGCCGAGGTACTGCAGAAGAAAAAACTGCAAAATCCGATCCAATTTATCGTAAT 
CGATTAGTTAACATGTTGGTTAACCGTATTCTGAAACACGGAAAAAAATCATTGGCTTAT 
CAAATTATCTATCGAGCCTTGAAAAAGATTCAACAAAAGACAGAAACAAATCCACTATCT 
GTTTTACGTCAAGCAATACGTGGAGTAACTCCCGATATAGCAGTAAAAGCAAGACGTGTA 
GGCGGGTCAACTCATCAAGTTCCCATTGAAATAGGATCCACGCAAGGAAAAGCACTTGCC 
ATTCGTTGGTTATTAGGGGCATCCCGAAAACGTCCGGGTCGAAATATGGCTTTCAAATTA 
AGTTCCGAATTAGTGGATGCTGCCAAAGGGAGTGGCGATGCCATACGCAAAAAGGAAGAG 
ACTCATAGAATGGCAGAGGCAAATAGAGCTTTTGCACATTTTCGTTAA
>AT1G07440.1 |  tropinone reductase putative / tropine dehydrogenase putative 
GATCAATCAACTTTGTGTTTGCTCCACTTATCTCTTCACATCGTACACTTCAAGATAAGA 
GAGAAATGGCTGGAGCAGAGCAAAGCCAGAGATGGAGCCTTAAGGCCAAGACCGTACTTG 
TAACCGGTGGAACAAAAGGCATCGGGTAAGCTCCAAATCTTTCCATATTTCCTGAAAGAG 
TTAAACTTTATTGTGATCTCTAGTTCTTAAATCAAATATATAGGCATGCTATAGTAGAGG 
AATTTGCAGGATTTGGAGCAGTAATACATACTTGTGCTAGAAACGAATATGAGCTTAACG 
AGTGTTTAAGCAAATGGCAAAAGAAGGGTTTTCAAGTCACTGGTTCGGTCTGTGACGCAT 
CTTTGAGACCAGAGAGAGAAAAGCTAATGCAGACTGTGTCTTCAATGTTTGGTGGAAAGC 
TCGATATCCTCGTAAGTTAATCTTTTTTAATACTCTTTATCATTTAGCCTAAATCTTGAT 
TCATGTAATCTTTTGATTATTAGATAAACAATTTGGGAGCGATTCGGTCAAAACCAACGC 
TGGATTACACAGCAGAAGATTTCTCGTTTCATATTTCGACAAACTTAGAATCTGCTTATC 
ATCTGAGCCAGCTTGCGCATCCTCTGCTTAAGGCTTCAGGATGTGGGAACATAATTTTCA 
TGTCCTCTATTGCTGGAGTTGTATCTGCTAGTGTCGGCTCCATCTACTCTGCAACGAAAG 
GTTTATATACTAATTATTAGATACTGTCACTGACCAAGAAAACAAAAACACATCTCTGTT 
TGAGACTTTCAATAGAAGTTTTTGTTTTTACTTACAATAGTTTTCACATGTAAATGCAAA 
GTCATAAACTGGTTTTTGAAACAATGAATCATAGGCCATGTGTGTGTGTGTGTGTGTGTG 
TGTGTGTCATAGGGGCATTGAATCAGCTAGCAAGGAACTTGGCATGTGAGTGGGCTAGTG 
ATGGCATTAGGGCTAATGCTGTGGCTCCTGCAGTCATCGCAACTCCTTTGGCTGAAGCTG 
TGAGATACTAATAAGCTAAATTTTCTCCAAGATACATCTCTCTTTCTAGCTTTTGCTGAC 
CTCTTGACCTTGACGATAATCTTTAGGTGTATGATGATGAGTTCAAGAAAGTGGTGATAT 
CAAGAAAGCCGTTGGGGCGTTTCGGGGAGCCTGAAGAAGTGTCCTCGCTTGTGGCTTTTC 
TATGTATGCCTGCAGCTTCTTATATAACTGGTCAAACCATTTGTGTCGATGGAGGTCTCA 
CTGTCAATGGCTTCTCCTATCAGCCACAAGGTTAAAATCCAATATCCAAAAACAAACACA 
TTTTCAACTTCATTACTTTGAACATTGTCATCTTGGGCTAAGCCCGGTTTGGAAGTATGG 
ATTCTGGCCGTAACACTTTAGAAAATAAAAGGAAACTTCAAATATTCTGATTTA
>AT1G07440.1 |  tropinone reductase putative / tropine dehydrogenase putative 
GATCAATCAACTTTGTGTTTGCTCCACTTATCTCTTCACATCGTACACTTCAAGATAAGA 
GAGAAATGGCTGGAGCAGAGCAAAGCCAGAGATGGAGCCTTAAGGCCAAGACCGTACTTG 
TAACCGGTGGAACAAAAGGCATCGGGTAAGCTCCAAATCTTTCCATATTTCCTGAAAGAG 
TTAAACTTTATTGTGATCTCTAGTTCTTAAATCAAATATATAGGCATGCTATAGTAGAGG 
AATTTGCAGGATTTGGAGCAGTAATACATACTTGTGCTAGAAACGAATATGAGCTTAACG 
AGTGTTTAAGCAAATGGCAAAAGAAGGGTTTTCAAGTCACTGGTTCGGTCTGTGACGCAT 
CTTTGAGACCAGAGAGAGAAAAGCTAATGCAGACTGTGTCTTCAATGTTTGGTGGAAAGC 
TCGATATCCTCGTAAGTTAATCTTTTTTAATACTCTTTATCATTTAGCCTAAATCTTGAT 
TCATGTAATCTTTTGATTATTAGATAAACAATTTGGGAGCGATTCGGTCAAAACCAACGC 
TGGATTACACAGCAGAAGATTTCTCGTTTCATATTTCGACAAACTTAGAATCTGCTTATC 
ATCTGAGCCAGCTTGCGCATCCTCTGCTTAAGGCTTCAGGATGTGGGAACATAATTTTCA 
TGTCCTCTATTGCTGGAGTTGTATCTGCTAGTGTCGGCTCCATCTACTCTGCAACGAAAG 
GTTTATATACTAATTATTAGATACTGTCACTGACCAAGAAAACAAAAACACATCTCTGTT 
TGAGACTTTCAATAGAAGTTTTTGTTTTTACTTACAATAGTTTTCACATGTAAATGCAAA 
GTCATAAACTGGTTTTTGAAACAATGAATCATAGGCCATGTGTGTGTGTGTGTGTGTGTG 
TGTGTGTCATAGGGGCATTGAATCAGCTAGCAAGGAACTTGGCATGTGAGTGGGCTAGTG 
ATGGCATTAGGGCTAATGCTGTGGCTCCTGCAGTCATCGCAACTCCTTTGGCTGAAGCTG 
TGAGATACTAATAAGCTAAATTTTCTCCAAGATACATCTCTCTTTCTAGCTTTTGCTGAC 
CTCTTGACCTTGACGATAATCTTTAGGTGTATGATGATGAGTTCAAGAAAGTGGTGATAT 
CAAGAAAGCCGTTGGGGCGTTTCGGGGAGCCTGAAGAAGTGTCCTCGCTTGTGGCTTTTC 
TATGTATGCCTGCAGCTTCTTATATAACTGGTCAAACCATTTGTGTCGATGGAGGTCTCA 
CTGTCAATGGCTTCTCCTATCAGCCACAAGGTTAAAATCCAATATCCAAAAACAAACACA 
TTTTCAACTTCATTACTTTGAACATTGTCATCTTGGGCTAAGCCCGGTTTGGAAGTATGG 
ATTCTGGCCGTAACACTTTAGAAAATAAAAGGAAACTTCAAATATTCTGATTTA
>AT1G07440.2 |  tropinone reductase putative / tropine dehydrogenase putative 
GATCAATCAACTTTGTGTTTGCTCCACTTATCTCTTCACATCGTACACTTCAAGATAAGA 
GAGAAATGGCTGGAGCAGAGCAAAGCCAGAGATGGAGCCTTAAGGCCAAGACCGTACTTG 
TAACCGGTGGAACAAAAGGCATCGGGTAAGCTCCAAATCTTTCCATATTTCCTGAAAGAG 
TTAAACTTTATTGTGATCTCTAGTTCTTAAATCAAATATATAGGCATGCTATAGTAGAGG 
AATTTGCAGGATTTGGAGCAGTAATACATACTTGTGCTAGAAACGAATATGAGCTTAACG 
AGTGTTTAAGCAAATGGCAAAAGAAGGGTTTTCAAGTCACTGGTTCGGTCTGTGACGCAT 
CTTTGAGACCAGAGAGAGAAAAGCTAATGCAGACTGTGTCTTCAATGTTTGGTGGAAAGC 
TCGATATCCTCGTAAGTTAATCTTTTTTAATACTCTTTATCATTTAGCCTAAATCTTGAT 
TCATGTAATCTTTTGATTATTAGATAAACAATTTGGGAGCGATTCGGTCAAAACCAACGC 
TGGATTACACAGCAGAAGATTTCTCGTTTCATATTTCGACAAACTTAGAATCTGCTTATC 
ATCTGAGCCAGCTTGCGCATCCTCTGCTTAAGGCTTCAGGATGTGGGAACATAATTTTCA 
TGTCCTCTATTGCTGGAGTTGTATCTGCTAGTGTCGGCTCCATCTACTCTGCAACGAAAG 
GTTTATATACTAATTATTAGATACTGTCACTGACCAAGAAAACAAAAACACATCTCTGTT 
TGAGACTTTCAATAGAAGTTTTTGTTTTTACTTACAATAGTTTTCACATGTAAATGCAAA 
GTCATAAACTGGTTTTTGAAACAATGAATCATAGGCCATGTGTGTGTGTGTGTGTGTGTG 
TGTGTGTCATAGGGGCATTGAATCAGCTAGCAAGGAACTTGGCATGTGAGTGGGCTAGTG 
ATGGCATTAGGGCTAATGCTGTGGCTCCTGCAGTCATCGCAACTCCTTTGGCTGAAGCTG 
TGAGATACTAATAAGCTAAATTTTCTCCAAGATACATCTCTCTTTCTAGCTTTTGCTGAC 
CTCTTGACCTTGACGATAATCTTTAGGTGTATGATGATGAGTTCAAGAAAGTGGTGATAT 
CAAGAAAGCCGTTGGGGCGTTTCGGGGAGCCTGAAGAAGTGTCCTCGCTTGTGGCTTTTC 
TATGTATGCCTGCAGCTTCTTATATAACTGGTCAAACCATTTGTGTCGATGGAGGTCTCA 
CTGTCAATGGCTTCTCCTATCAGCCACAAGGTTAAAATCCAATATCCAAAAACAAACACA 
TTTTCAACTTCATTACTTTGAACATTGTCATCTTGGGCTAAGCCCGGTTTGGAAGTATGG 
ATTCTGGCCGTAACACTTTAGAAAATAAAAGGAAACTTCAAATATTCTGATTTAAATTTT 
GCTTGGATTTTTCAGTTCCGTTGCTCTCAAACTTCAAAGTATGTGTGTCATCCTAATTAT 
AATAATAGTGATTAAATAAGTGTAAAATAAAAAGTAGTATTTTGTCCTCCCATCCAAAAT 
AATTAGGGCTTTATCCTGATCC
>AT1G07440.2 |  tropinone reductase putative / tropine dehydrogenase putative 
GATCAATCAACTTTGTGTTTGCTCCACTTATCTCTTCACATCGTACACTTCAAGATAAGA 
GAGAAATGGCTGGAGCAGAGCAAAGCCAGAGATGGAGCCTTAAGGCCAAGACCGTACTTG 
TAACCGGTGGAACAAAAGGCATCGGGTAAGCTCCAAATCTTTCCATATTTCCTGAAAGAG 
TTAAACTTTATTGTGATCTCTAGTTCTTAAATCAAATATATAGGCATGCTATAGTAGAGG 
AATTTGCAGGATTTGGAGCAGTAATACATACTTGTGCTAGAAACGAATATGAGCTTAACG 
AGTGTTTAAGCAAATGGCAAAAGAAGGGTTTTCAAGTCACTGGTTCGGTCTGTGACGCAT 
CTTTGAGACCAGAGAGAGAAAAGCTAATGCAGACTGTGTCTTCAATGTTTGGTGGAAAGC 
TCGATATCCTCGTAAGTTAATCTTTTTTAATACTCTTTATCATTTAGCCTAAATCTTGAT 
TCATGTAATCTTTTGATTATTAGATAAACAATTTGGGAGCGATTCGGTCAAAACCAACGC 
TGGATTACACAGCAGAAGATTTCTCGTTTCATATTTCGACAAACTTAGAATCTGCTTATC 
ATCTGAGCCAGCTTGCGCATCCTCTGCTTAAGGCTTCAGGATGTGGGAACATAATTTTCA 
TGTCCTCTATTGCTGGAGTTGTATCTGCTAGTGTCGGCTCCATCTACTCTGCAACGAAAG 
GTTTATATACTAATTATTAGATACTGTCACTGACCAAGAAAACAAAAACACATCTCTGTT 
TGAGACTTTCAATAGAAGTTTTTGTTTTTACTTACAATAGTTTTCACATGTAAATGCAAA 
GTCATAAACTGGTTTTTGAAACAATGAATCATAGGCCATGTGTGTGTGTGTGTGTGTGTG 
TGTGTGTCATAGGGGCATTGAATCAGCTAGCAAGGAACTTGGCATGTGAGTGGGCTAGTG 
ATGGCATTAGGGCTAATGCTGTGGCTCCTGCAGTCATCGCAACTCCTTTGGCTGAAGCTG 
TGAGATACTAATAAGCTAAATTTTCTCCAAGATACATCTCTCTTTCTAGCTTTTGCTGAC 
CTCTTGACCTTGACGATAATCTTTAGGTGTATGATGATGAGTTCAAGAAAGTGGTGATAT 
CAAGAAAGCCGTTGGGGCGTTTCGGGGAGCCTGAAGAAGTGTCCTCGCTTGTGGCTTTTC 
TATGTATGCCTGCAGCTTCTTATATAACTGGTCAAACCATTTGTGTCGATGGAGGTCTCA 
CTGTCAATGGCTTCTCCTATCAGCCACAAGGTTAAAATCCAATATCCAAAAACAAACACA 
TTTTCAACTTCATTACTTTGAACATTGTCATCTTGGGCTAAGCCCGGTTTGGAAGTATGG 
ATTCTGGCCGTAACACTTTAGAAAATAAAAGGAAACTTCAAATATTCTGATTTAAATTTT 
GCTTGGATTTTTCAGTTCCGTTGCTCTCAAACTTCAAAGTATGTGTGTCATCCTAATTAT 
AATAATAGTGATTAAATAAGTGTAAAATAAAAAGTAGTATTTTGTCCTCCCATCCAAAAT 
AATTAGGGCTTTATCCTGATCC
>AT2G17510.1 |  EMB2763 (EMBRYO DEFECTIVE 2763) RNA binding / ribonuclease 
AGTTGGCTGGCTTAGGTTTAAATTTAAAGGCTTTAAAAAGCTTCTTCCTCTCTTCCGTTC 
TGACGACTGAAATCTTCTTCACCGGCGAAATCGAAAAGTTTTCCAGCAAGAAATTGAAGA 
TGTTGCAGAGCAAAGTTTTCAATAAGAAAACCAGAGGAGGAAGAATCCAAAAGGTTTCTC 
TTCAATCTCTCTATGCTTCTTCTTCTTCTTCCTTCCGAGTTTTTTTGTTCGTTATTGTAA 
CTTTTAACTCTTTGTCTGCGACAGCAAGTAAGAGAGGTTTATCTACGAGATGACATATAC 
TGTGGAGCTTTCTCTTGCAAGTCTTGTGATTCTTCAGCTGCTCGTTTGTCTTCCTCTAAG 
ATAATCGTTGTTGATACCAACGTCGTTCTTCACCAAGTAATTTTTCTTTAATTTGATTAC 
ATAAGCTAAAAGTTTTGAGCTTGTGGGTATTACTAATGTAATATTTTGTTTGTTTCTGGT 
AGATTGATTTGTTGGAAAATAAGGCTATAGACACTGTTGTTGTTCTGTCTGTGGTGTTGG 
ACGAAGTTAAGAACAGGAATAGATCGGTTTACAATAGAATCAGACTTCTCTGCAGCAATC 
CAGCGAGACAATTCTATGTTTTCTCCAATCATGTCCACAAGTAAGAAGACCTTGTTCGAA 
CTTTTAGCTTTTAGATTAACCAGATTTTAGGTGGACAAAAGAACATAAAGAATTCAATGA 
TTTTGGAATTTCTGTTCGGTTATATTGATTAGATGCTCTCCTTACTGGAACCTACTAAGC 
TATAGAAACGCTTTTCTCCGTGTCCTTATCGTTGTTTTCTCGCGTTTACTAAACTCTTCA 
CAGGGATACTTATGTGCAAGCCATGGAGAAAGAGAGTGCAAATGACCACAACGATAGAGG 
TTTTATTTACTATTCAATCACCTTCTTTGTTTGTTAACATCATGTTACTTTCTTGATGAT 
GAACTTACATACTTCTCTTGGTAAGCATCTGTTATTAAAATTTTAAATTTATCTGGAATT 
CAGCTATTCGCGTCGCTACTCTATGGTACCAGAAGCATCTAGGGGATACATCTCAGGTGT 
TGCTTGTAACTAATGATAGGGAAAATAAACGGAAGGCCACTGAAGAGGGAATATCTGCGG 
AGACAAGTATGTGAATCATCTATATTTTTCATAGAAGTTGTCGAAGCTTGGTTTTGCATG 
ACTGTTTGTGTGTCTTGCTACATGATGTTGAAGTTTATCAATGAATGTTTCTGTATCAGT 
TGAGGCTTATGTTAAATCACTTGGACAACCTGAATTGCTGGATCTGCTTGCCCAACCAAC 
CAATGAAGACATAACTATGGAAGATGCAGATGATTCTAGACCTTCGAAGAGGAAACTTAT 
ATACCAAGAGGTAATGGAGATAAACACATTTGTTTTTCAGTCTCAGCTTTGGGTAACTTG 
ATACTGCCATCAAACAACTTTTATCTCCAATTTTGTTTTTTTTCCTGCCTGCAGCATAAG 
CCCATGTCTGAGATTACTGCTGGCTTACACCGTGGAATATATCATCAAGGAAAACTCCGG 
GTCAATCGTTTCAATCCTTACGAAGCTTATGTTGGAAGCGAGAGCATTGGTGAAGAGATA 
ATTATCTATGGGCGCAGCAACATGAACAGGGCTTTTGATGGTGATATTGTTGCAGTCGAA 
CTCTTGCCTCGGGATCAATGGCAAGATGAGAAGGCATTATCTATAGCTGAAGAAGGTCTC 
TTTCAATATCTACATATATTTTACAGCAGTTATTTCCTTGCATGACGTTGTGTTAAACTT 
ATCTTTCTTCCAAATATCAAATTCAAATGCAGATGATGAAGAGGATGATACTGTTCATTT 
GGCTCCCGACAATGTTGATGATGCTCCTAGAACCTCAAATTTATCCCATGAAACTTCTGG 
GGATAAAAATGCAGCCCCTGTTCGTCCATCAGGCCGTGTAGTCGGTGTTATCCGTAGAAA 
TTGGCACTCGTGAGTTCATTACTTGATTACCCTTACCTTCTTGCTTGTTTTTTTTTCTAA 
TTGAGACATTGATATATCATATGAGATCATGTTAACAGACTTGTTAATACATTCTCATTA 
GAGGTACCTGTTTCTGGTGACTACATATGTGACTGGACGATTATCTTTAGTACTCTTGAT 
TCAGTGTCCTTTGTCTGTGCAATTATGCTTTACTTTTCCTTAAGTTTGTCTTCTGTTTCA 
AGCCATGGTTTCTGGATGACGGTTCCTAATTTGTATGTTTTCATGCAGCTATTGTGGATC 
TCTTGAACCGATGTCACTACCTGCTGGTAGTGGTGGAACGGCACATGCTTTATTTGTCTC 
TAAAGATCGCAGAATTCCCAAGATCCGCATTAATACTCGACAGCTGCAGAACCTTTTGGA 
TATGAGGATAGTAGTGGCAGTTGATTCCTGGGACCGTCAATCTCGATATCCTTCTGGTCA 
TTACGTACGACCAATCGGCAAAATAGGTGACAAGGAAACTGAAACAGAGGTAAGGGATCA 
TATTAATTTATTCGATTCTATTCTAGTAGGAGTTAGGTGGGCAAGAGTAGGAAAAGTATA 
TTGGTTTCCTTTCTTCAGAGAAGTAACTGATTTAGATAATTGAATATAACATCAATACTC 
TTTCTTGTGAATGCTGCAGGTTGTGTTGATAGAGAATGATGTTGACTACTCGCCGTTCTC 
TTCTCAAGTTCTGGCATGCTTGCCACCCTTACCTTGGTCTGTATCCTCTGAAGACGTATC 
CAATCCTGTTAGGCAAGACTTACGACATTTGCTTGTCTTTAGTGTGGACCCTCCGGGTAT 
GTATCTAGAGCTTTACATTTTATAAAGTATATATGATTCAAGCCAAATTTAAATGTCTCC 
CAGAGTCTGCAGTTAGTTGTGCACAAGCAGATTAACTTTATTTGGTGCTAACAGGTTGCA 
AGGATATTGATGATGCATTGCACTGTACATCGCTTCCAAACGGGAACTTTGAACTTGGAG 
TCCGTATCCTAGAGTCCTCAGATTCTCATAAATATGACTGTGCTTTCAATTTAGGACATG 
TCAATAGTCAATGAGTTAAAAATCAGTTTGTGGGATATATTTAACCAAAGCATTGAAATG 
GCTCATATTACCTTTTAGCTTCATAGTTCGCTTTTATCATAATTATCTAGTACGAGAAGT 
GCTTTTGAGGTGATCTGCTTTATGCCTTTTAGTGAATCGGTATCTTCCAGAATTTGTAGC 
TAGTTCCGTTGTATTCTCTTCTTGTCTTGGGAGTGAATATATATGATGCTTATCCTTGAC 
CATGTTTGATTAGACATTGCTGATGTAACGAATTTTGTTCACCCTGGTACTCCTTTGGAT 
GATGAGGCATCAAAAAGAGGCACATCTGTCTACCTTGTTGAGCGCCGTATTGACATGCTT 
CCCAAACCTTTAACTGAAGGTAATATCTTCTTACAGAAATACATTCCCTTTGTGTTGGAA 
TTTCTATGCACTCATGAAACATGATATTGCTTGTAGATATTTGCTCTCTTAGAGCTGATG 
TGGAAAGGCTTGCATTCTCGGTTATTTGGGTATGCTTTATCCATTTTCAATTGTCATTGC 
GAGGCATATTAGCAAATTGGTAAACGGTTAGCTTAAGCATAATTCATATATTTAGGAAAT 
GAGCCCTGACGCTGAGATTATCTCAACGAGATTCACAAAGAGTATTATCAAGTCTTCTGC 
AGCATTGTCCTATATTGAAGCTCAGGCTCGGATGGATGACAGGTACATTCTATTTTACCA 
TAGAGTTAGAGGGTCATTGGCTTGTTTGCTTACCTTTGCTACTACAATAAATTATTTGAT 
TTTATGCTCTCTAGTCATTTGACAGTGAGAAAAATGGTAGCAAGGATTGTCAAAAAATTA 
TTGTAGAAAATTTAATCTTTCTAATTTCATGAATTTTTATCCCATTATTTTGTATTGTAG 
AGTTGTTTAAGATTCCCTCTTTTACTTTATGCCGAAGATTGACAAATGTAATTAATTTCT 
TGTAGCCGATTGACAGACTCCCTGACTACAGATCTGAGGAATATGAATACCTTGGCAAAG 
GTTTGAGACACCTCCTCTCACAAGTTGCCATATGTTCCAGAAATCATAGAAAGAACACAA 
CATTTTGACCTGTTTTTTGCTCTTGAAACCTGTAGATAATGAGGCAAAGGCGTATCGATA 
GGGGAGCCTTAACTCTTGCTTCTGCGGAAGTCAAATTTGATATTGATCCGGAGAATCATG 
ATCCTCTTAACATTGGTATGTTATCTGAGCAAAATTTGTTTCTTCTTGATGAATACGAAC 
GATGTTTTCTTAGTCTTTTTCACCCAAACACCCATGAAATACAACCACCTCTATCCTTCT 
GAAAGATGTATTCAATTTATTCATCTGTTTTTCATTTGTCATCATGACTCTGTTTTGCGC 
AGGTATGTATCAGATTCTCGAAGCAAACCAAATGGTTGAGGAATTCATGCTTGCTGCAAA 
TGTTTCCGTCGCTGGACAGATCCTGAAACTATTCCCTTCTTGTTCACTATTAAGGTAAAG 
TTTGTGATAGTTCTTTTCTTCTTGAAGGTAGCTTTTTCTTACATCGGTGGTCTGTTTCTC 
AAAGATTGCAATCATTCTGTATTTGTTGATGGGTTCCTCTGCGTAAAACGGATTTTATTT 
TTTCTGAGATGTGACAAATTAGCTTTCAACTGTTGCTAAAGATGCATATATACACTGGTT 
CATGAATTGTTTAGTCTTCTCGTGAAATTTGGCCATAGGTGGTTAGATTATATAATTTTG 
TGCATATTTAGCATAATGAATATTATGGGATCCCAAGTAGCTGTTGAGGATGTGTTTAGT 
TTTTACAGGCAATTATTGAATTTCTGTTCACTTTTATTATCAATAGTAGTTCATCATATC 
TCTGGTTTCGTTCTTCATGCAGGCGTCATCCTACTCCAACAAGAGAAATGCTTGAACCAC 
TACTGCGTACTGCTGCAGCTATTGGGCTTACCTTAGATGTCTCTTCATCTAAAGCTTTGG 
CTGATTCACTGGACCGAGCTGTGGTGAGTATTTCTTTTTGTCTGCACTGTCTATATGGCA 
GCCACTGAGTACCTCCCTGGTTTCTTTCTATTCATAATCAAATGCAATTGTCACTTTCTT 
TGATGCTATATAAGTAACTTACTTCCTTGTTTCAAATTACGTTCTTTTTATTCGCTCAAT 
ATTAACAAATTCGTAATTCATCAGGGTGAGGATCCATATTTCAACAAGTTGATCAGGATA 
TTGGCAACTAGGTGCATGACGCAGGTGATGCTTCCGTGATGACTGAGTAGTAATATTGCT 
GGTGATTTTGACAGGATATCGCCATATTTAACATTTTAAATTTATTACTACGCAGGCTGT 
GTACTTCTGTAGTGGGGATCTCAGTCCTCCCGAATATCATCATTATGGGCTTGCAGCACC 
CCTGTATACTCATTTTACATCCCCTATCCGTAGATATGCCGGTAAGTGATAACTGCTCTG 
TCTTCCCTCTTTTCACCTGTTAGCTGCTCTAATCTTACTTCTTTCCCTGGTTCTAGATGT 
CTTTGTGCACAGGTTACTTGCTGCGTCATTAGGAATATACAAGCTTCCAACGGTGTTCCA 
AGACAGACCTCAACTTACTAGTGTTGCTGATAGTAAGAGTTCGCTTACCTCCTGTGGATT 
ATTTAAGAGTTTTATTATTTCCAGAATTTTGAGTGTTCAGACAAAATTTGCAAACTGAGG 
AGTCTTTTGGTCACTTCCTGATTTGTTTTGGAAATTAAGGTCTTGTTTGGTCATATCTTT 
GTCAAGGAAAAGATGTCTAAAATTCGAACGAATTTTTCTTAAAGATTAGGGATAATGATT 
TTCCTTTTACTAATGCACCTGAGTCTTAGAGTTGTAGGTTCTAATTCATTGACTTGTTTC 
AGATTTGAACTATCGACATAGGAATGCCCAGATGGCAGGTCGAGCTTCAGTAGAGCTGTA 
CGTTCTCATTTACTTCAGAACCCGGTATGGATTGTATATTCTTCATGAATCTTACTTGAT 
TTTAAGGCATGGACTGGTAAAGACTAAGAGAAAATTATGTGTGTTTCTGTTGCAGACCCA 
CAGATGAAGAGGCGAGAGTTGTGAAGATAAGATCCAATGGTTTTATAGTATTTGTCCCCA 
AGTATGTTCTCCATTCTTTGCTTATAATATAAATTCATTAGCAAGTGTAGCCGATCCTCC 
TTATCCTTGTTTATTATCTCCATTCCCAGAGCCACCATATCTCACTGTTTTGCAATTGGC 
AATTTTAGGGGAAAAGTGTACTTACCAAAGGATTGGCTATTCTTGTTCTTTTTCCTATTA 
TTAGCACATTATATTTTCTTACACTGGAAACGTTATGGATTATGCAGGTATGGAATCGAA 
GGCCCTGTTTATTTAACAGGAAAGGGAGAGAAAGGAGCTGGTGATTGGTATGTTGATGAG 
GAGAAGCAAAAGATTGTTAAGATGGATGGAAGTTTATCTTACAGTGTCTTGCAAACAGTG 
AAGATCCACATGGAGGTAGTAGAGCCTCAGCCTAACCGACCGAAACTCCAACTCACTCTC 
TTGTAAAACTCTTAAACCTTGTAGTTTCACTTTCCCTTGTGTGGCACGGACCGATTGTCA 
ACAGCTTTCCTCTGTGTTCATTATCGAAGTCAAAGACATTGTGTCGTCAATTCATTATCT 
ATAGATGGATGCCAATTTTGGGAGGTGCATCACTTTTAATCCTCT
>AT3G22310.1 |  PMH1 (PUTATIVE MITOCHONDRIAL RNA HELICASE 1) ATP-dependent helicase/ DNA binding / RNA binding 
AAACCCTTTTGCCGTCTCCCTAAAACCCTAATTCTCATTTCTGGGGTTTCACATTTCATC 
TTCACCAGAATCCATCACACTCTCTGAAATCTGAAAATGATTAGCACAGTACTTCGCCGA 
TCTATCCTTGGTACGTCAAGGCGTACTCTCGCCGCTTCGGTGACCTCCATTAACGCAGCT 
CTATTTCATAACCTTGCTCCAGCCGCCGCCACAGTCTCCGATCTAGCAAATGGAGCTACT 
AATGTCAAGTCTCTCCCTTCGAATTCGAGCCCTTTTGGTGTTAAAGTGAGAGACTTTCAT 
GTTAAATCTGTACCGTCGGAGTTTAGATCGTCGATTGTTTCTTCTGCGGGATTCGCGGCT 
CAAGAGTATGCTCCTTCTTATGAGAACGATGGAGGGATTGGAGATTCGGAGAGTGTTGGT 
AGCAGCGGTGGTGGTGATGGGCTTGCGATAGCTGATCTTGGTATATCTCCGGAGATTGTT 
AAAGCTTTGAAGGGTAGGGGTATTGAGAAACTCTTTCCTATTCAGGTATATATGATCTTC 
TTCTCTGTTCCATTTGGTTATAGAGATCAATTAAAAGTTTAGATTTTTTTAACTGAGTTT 
TTGATGTTTGTGTTTGGTTGAATAGAAAGCTGTGTTGGAGCCAGCGATGGAGGGTCGTGA 
TATGATTGGCCGTGCAAGGACTGGAACGGGAAAGACACTTGCTTTTGGGATTCCTATTAT 
TGACAAAATCATCAAATTCAACGCTAAACATGGGTTTGTGTTTACTGTTATATATAACGA 
TCATTTGTGATTGAGAGATTTGCACTTCCTTTGGTTCTTATGTTGTCTTTTGATGTGACA 
GTCGTGGGAAGAATCCTCAGTGCTTGGTTTTGGCACCGACGAGGGAGCTTGCTCGTCAGG 
TTGAGAAAGAGTTCAGGGAATCTGCTCCAAGTTTGGATACTATTTGTCTCTATGGAGGTA 
CACCAATCGGGCAACAAATGAGGGAGCTGAACTATGGTATTGATGTGGCGGTTGGAACTC 
CTGGTCGTATCATTGATCTGATGAAAAGGGGAGCTTTGAATCTATCAGAGGTTCAGTTTG 
TGGTTCTTGATGAAGCTGATCAGATGCTTCAAGTTGGATTTGCGGAAGATGTTGAAATAA 
TATTGCAGAAGTTGCCAGCGAAGCGTCAGAGTATGATGTTTTCTGCAACAATGCCAAGTT 
GGATCAGATCTCTCACCAAGAAGTACCTGAACAATCCTTTGACAATTGATCTTGTGAGTA 
GTCTTATACCTGCTTGTGTTTATATCTTAGAATTGCTGTACAAATTGCAAATATTGATCT 
TGGCTGTAGCAGTGTAGTTAATGAAGTGACATTTTTTAATGACACATGTACTCTTATGTA 
ATTTAGGTTGGAGATTCAGATCAGAAACTTGCAGATGGGATTACTATGTATTCTATCGCT 
GCAGATTCTTATGGAAGAGCATCCATCATTGGTCCTCTTGTAAAGGTATGTTTTCTTTAC 
TTTGCTTTTAAGCCAATTATCTGTATCTTGTTTTGATTCTTCATTTTTGTTTCCAGTCGT 
GATTTTATAACATCTTCTCCTTTACAGGAACATGGCAAAGGAGGAAAATGCATTGTCTTT 
ACCCAAACAAAACGTGATGCAGATCGCCTTGCATTTGGATTGGCAAAAAGCTATAAATGT 
GAAGCTTTACACGGTGACATATCTCAAGCTCAGAGAGAAAGAACACTTGCTGGTTTCAGG 
GATGGGAATTTCAGTATTCTTGTTGCAACTGATGTTGCTGCCCGTGGACTTGATGTACCT 
AATGTCGATTTAGTGAGTGAAAACAATACCTTTTCTTGCGCTTAACTAGTTCTGTTTCTC 
ATTTTATTAACCTGTATTGTGCTTTGTGTACAGGTAATTCATTATGAGCTTCCTAATAAC 
ACGGAGACGTTTGTTCACCGAACGGGGCGAACTGGTCGTGCTGGAAAGAAAGGAAGCGCG 
ATTCTCATCCACGGTCAAGATCAAACCAGGGCTGTTAAAATGATTGAGAAAGAAGTCGGA 
AGCAGATTCAATGAGGTTAATATCTTTCTTTACCACCTTTGTATCTTTTGTATGAATAGC 
TTGGGTAACAAACAGTTCTGAATCTATTTGGTTTTGAATTCAGCTGCCTAGCATTGCTGT 
GGAAAGAGGAAGCGCAAGCATGTTTGAAGGAGTAGGTGCTAGATCTGGTGGGTCGTTCGG 
AGGAGGTCGATCAGGCGGTGGTGGGTATGGTAGTTACGGTAGCAGCAGTGGCCGTTCAGG 
TGGTGGTAGTTATGGAGGTTATGGTGGCAGCAGTGGCCGTTCAGGTGGTGGTGGTGGTAG 
TTATGGAGGTTCAGGGGGATCAAGCAGCCGTTACTCTGGTGGTTCAGACCGCTCATCTGG 
TTTCGGAAGCTTTGGTTCAGGCGGTTCTTCAGGAGGATTTGGTTCAGACCGTTCTTCTCA 
GTCAAGTGGAAGGAGCAGCTTTGGTGGGTTTGGATCAAACGATGGTAAAAGATCTTACTG 
AGAGAAGTGTTGTGTTGGTTTTGACCCGACTCAGCAATAATGGAGTTGACTTAGGAGAGA 
ACTCGGTATCTCGAGTTGAGTAGTTTACAAGGAGTCGAGCTATATATAAATTCTGTAGCT 
ACTTCTTGTCTCATAAACCAACATAAGTTATATCATTATTTCATATCCTCTAATTCATTT 
TTATTTCTCAATTTGAGTGAAATGTGTTTCCCTT
>AT4G31150.1 |  endonuclease V family protein 
GTTCCGATTAGGAACTTCCTCTCCGGCGACTGAACTTTTTCTGGAAATGGATAGTGAAGG 
AGCTTCAAGCGAGTCTTCTTCTTCTGGAGATCAGCTCGAGAAGTGGACAGAGTAGTTTCA 
CATTTGATTTCAGTTTCATTCCGCACAATCAAATCGGTTGATGATTTGTTTGACTTCTTT 
CAGAGAGCAGGATGAGCTGAAGAAGAAACTGATCGCGTACGATGACTTCACATGGAAGTT 
ATCTTCATCAACGGAACTGTCTCAGGGATCGGAGATACTTAAGTATGTTGGAGGTGTAGA 
CATGAGCTTTTGCAAAGAAGATTCTTCCGTCGCATGCGCTTGTCTCGTCGTTCTTGAGCT 
TCCTTCTCTCCGTGTAGTCCACCATGACTTCTCTCTTCTCCGCCTCCATGTTCCTTATGT 
CCCTGGATTTCTTGCCTTTCGTGAGGTTTCCTTCTCCTACTACTTCGTGTCCCCGAGCAA 
TGCTCTGCTAAATTCATTTGCTTCACTAAAGTATCTCAGATCCCAAAATTGGATTTTTCA 
TGTTACAGGCTCCGGTTCTTTTGCAGATTCTGCAGAAGATGAGAGATGAGAAGCATCCAT 
TCTATCCTCAGGTTTCAGTTTTATCTATAAGTTGCTTTAGTTTGCAATTGGCTACTCTTA 
AACCATTGCTTTTGCGTTGATTTTTTTTCTTCTAAAAGTCTCTTGCTTTGCTCTTGCAAA 
GGTACTGATGGTGGATGGAAATGGAATACTTCATCCACGAGGTATAAACACACAACTTTA 
CCTTTGTTTTGTAGTTGCATTTCAAGCTCTGTAATTATGGTGTTAGATGTAATTGTCTTC 
TATAGGATTTGGCTTGGCGTGTCATTTAGGTGTTCTTGCTCACCTACCAACCATTGGGGT 
CGGAAAGAATGTACGGTCTTCAGAATCTCAAGCTCTGAAATTTGTGATGTTATTTTTGTT 
TTGCCTTGCATTTTCCATCTGATCGTTAATGTGGAATTTATGATGTTGTAACATTTTCAG 
CTGCATCATGTGGATGGTCTGAATCAATCTGAGGTTAAACAGTCGCTTCAGCTCCAAATA 
AACGAGCATGAGCAAACTATCACTTTGGTAGGAAACTCTGGAATTACATGGGGAGTAGTA 
AGTGACTTTGACTGAACATCTACTGTAGTTGTTGTGTCTCTTTGGTAATACCGCGTTATA 
TTAGTAGTGACTTATCAGTTTTAGCAACGAAACTTCTCCATAGTTGTGGTTTTGATAATC 
TTGTGTAAGATAGTGAATTTAATGATCAAGTTTTACATATTACGTTCAACAGGGATTTAG 
GCCAACTCTGAGTTCTCTAAAGCCCATATATGTATCGGTTGGCCATCGCATATCACTGGA 
CTCTGCCGTTGAAGTTGTCAAGATAACCTGCAAGTACCGTGTTCCAGAACCTATTAGACA 
GGTAAGTGATGCATTTACCAACAAACAGAAAGTTATCCTGTAGATATGTGAAAAGTGAAA 
AGTAAGAGTCGTTAAGTATACAGTTTACTATATGCAGGCAGATATTAGATCAAGAGCATA 
TCTCCAGAAGCATCAAACTGAGTCTTTTAAAGAACTGGCAGTGCGACCACCGGATCAGGT 
AACTTCTGATGTTTTCTCCGCCATTTCTAACCATTGTCATATTTTTTCGTACTGGCTCAC 
ATGTCTCTTTGCTTCCTTTTTTGTCTACCAGACTGAACCTTAATCCCTCAAGCAACCAAG 
AACACTATTCCACATTACATAGAAACTCTCCAAAGTCTTTACCAAAGATTGTTAAATGGA 
CAGATTCAGGCACTGAAGATCCGCCCCAATTATCTCCTTCATTTATCTCACTGACTTGAA 
GATTGCAAGCTAACCAAGGTAATCATGTTATATCCGATACATTGGAATTTCCTTTCCATA 
CATACCTTAAACAAGTGTAAATAGAAAGGCTAGGCAACTGGTAATTTGGTTGTTTGGGCA 
CTGTATATTGGGAGATTTTGGGGTTCTCGACAAACAATTCTATAGCTTTGGGTTTGGTAT 
TTCTTTTGGTTCAGCTGTAACTCGTTTCTCATGCTCTAAGACAGCACAATCGTTTCTCAA 
TCTTAAGAGACTGTTAATGGTGGAC
>AT4G31150.1 |  endonuclease V family protein 
GTTCCGATTAGGAACTTCCTCTCCGGCGACTGAACTTTTTCTGGAAATGGATAGTGAAGG 
AGCTTCAAGCGAGTCTTCTTCTTCTGGAGATCAGCTCGAGAAGTGGACAGAGTAGTTTCA 
CATTTGATTTCAGTTTCATTCCGCACAATCAAATCGGTTGATGATTTGTTTGACTTCTTT 
CAGAGAGCAGGATGAGCTGAAGAAGAAACTGATCGCGTACGATGACTTCACATGGAAGTT 
ATCTTCATCAACGGAACTGTCTCAGGGATCGGAGATACTTAAGTATGTTGGAGGTGTAGA 
CATGAGCTTTTGCAAAGAAGATTCTTCCGTCGCATGCGCTTGTCTCGTCGTTCTTGAGCT 
TCCTTCTCTCCGTGTAGTCCACCATGACTTCTCTCTTCTCCGCCTCCATGTTCCTTATGT 
CCCTGGATTTCTTGCCTTTCGTGAGGTTTCCTTCTCCTACTACTTCGTGTCCCCGAGCAA 
TGCTCTGCTAAATTCATTTGCTTCACTAAAGTATCTCAGATCCCAAAATTGGATTTTTCA 
TGTTACAGGCTCCGGTTCTTTTGCAGATTCTGCAGAAGATGAGAGATGAGAAGCATCCAT 
TCTATCCTCAGGTTTCAGTTTTATCTATAAGTTGCTTTAGTTTGCAATTGGCTACTCTTA 
AACCATTGCTTTTGCGTTGATTTTTTTTCTTCTAAAAGTCTCTTGCTTTGCTCTTGCAAA 
GGTACTGATGGTGGATGGAAATGGAATACTTCATCCACGAGGTATAAACACACAACTTTA 
CCTTTGTTTTGTAGTTGCATTTCAAGCTCTGTAATTATGGTGTTAGATGTAATTGTCTTC 
TATAGGATTTGGCTTGGCGTGTCATTTAGGTGTTCTTGCTCACCTACCAACCATTGGGGT 
CGGAAAGAATGTACGGTCTTCAGAATCTCAAGCTCTGAAATTTGTGATGTTATTTTTGTT 
TTGCCTTGCATTTTCCATCTGATCGTTAATGTGGAATTTATGATGTTGTAACATTTTCAG 
CTGCATCATGTGGATGGTCTGAATCAATCTGAGGTTAAACAGTCGCTTCAGCTCCAAATA 
AACGAGCATGAGCAAACTATCACTTTGGTAGGAAACTCTGGAATTACATGGGGAGTAGTA 
AGTGACTTTGACTGAACATCTACTGTAGTTGTTGTGTCTCTTTGGTAATACCGCGTTATA 
TTAGTAGTGACTTATCAGTTTTAGCAACGAAACTTCTCCATAGTTGTGGTTTTGATAATC 
TTGTGTAAGATAGTGAATTTAATGATCAAGTTTTACATATTACGTTCAACAGGGATTTAG 
GCCAACTCTGAGTTCTCTAAAGCCCATATATGTATCGGTTGGCCATCGCATATCACTGGA 
CTCTGCCGTTGAAGTTGTCAAGATAACCTGCAAGTACCGTGTTCCAGAACCTATTAGACA 
GGTAAGTGATGCATTTACCAACAAACAGAAAGTTATCCTGTAGATATGTGAAAAGTGAAA 
AGTAAGAGTCGTTAAGTATACAGTTTACTATATGCAGGCAGATATTAGATCAAGAGCATA 
TCTCCAGAAGCATCAAACTGAGTCTTTTAAAGAACTGGCAGTGCGACCACCGGATCAGGT 
AACTTCTGATGTTTTCTCCGCCATTTCTAACCATTGTCATATTTTTTCGTACTGGCTCAC 
ATGTCTCTTTGCTTCCTTTTTTGTCTACCAGACTGAACCTTAATCCCTCAAGCAACCAAG 
AACACTATTCCACATTACATAGAAACTCTCCAAAGTCTTTACCAAAGATTGTTAAATGGA 
CAGATTCAGGCACTGAAGATCCGCCCCAATTATCTCCTTCATTTATCTCACTGACTTGAA 
GATTGCAAGCTAACCAAGGTAATCATGTTATATCCGATACATTGGAATTTCCTTTCCATA 
CATACCTTAAACAAGTGTAAATAGAAAGGCTAGGCAACTGGTAATTTGGTTGTTTGGGCA 
CTGTATATTGGGAGATTTTGGGGTTCTCGACAAACAATTCTATAGCTTTGGGTTTGGTAT 
TTCTTTTGGTTCAGCTGTAACTCGTTTCTCATGCTCTAAGACAGCACAATCGTTTCTCAA 
TCTTAAGAGACTGTTAATGGTGGAC
>AT4G31150.2 |  endonuclease V family protein 
TGAACTTTTTCTGGAAATGGATAGTGAAGGAGCTTCAAGCGAGTCTTCTTCTTCTGGAGA 
TCAGCTCGAGAAGTGGACAGAGTAGTTTCACATTTGATTTCAGTTTCATTCCGCACAATC 
AAATCGGTTGATGATTTGTTTGACTTCTTTCAGAGAGCAGGATGAGCTGAAGAAGAAACT 
GATCGCGTACGATGACTTCACATGGAAGTTATCTTCATCAACGGAACTGTCTCAGGGATC 
GGAGATACTTAAGTATGTTGGAGGTGTAGACATGAGCTTTTGCAAAGAAGATTCTTCCGT 
CGCATGCGCTTGTCTCGTCGTTCTTGAGCTTCCTTCTCTCCGTGTAGTCCACCATGACTT 
CTCTCTTCTCCGCCTCCATGTTCCTTATGTCCCTGGATTTCTTGCCTTTCGTGAGGTTTC 
CTTCTCCTACTACTTCGTGTCCCCGAGCAATGCTCTGCTAAATTCATTTGCTTCACTAAA 
GTATCTCAGATCCCAAAATTGGATTTTTCATGTTACAGGCTCCGGTTCTTTTGCAGATTC 
TGCAGAAGATGAGAGATGAGAAGCATCCATTCTATCCTCAGGTTTCAGTTTTATCTATAA 
GTTGCTTTAGTTTGCAATTGGCTACTCTTAAACCATTGCTTTTGCGTTGATTTTTTTTCT 
TCTAAAAGTCTCTTGCTTTGCTCTTGCAAAGGTACTGATGGTGGATGGAAATGGAATACT 
TCATCCACGAGGTATAAACACACAACTTTACCTTTGTTTTGTAGTTGCATTTCAAGCTCT 
GTAATTATGGTGTTAGATGTAATTGTCTTCTATAGGATTTGGCTTGGCGTGTCATTTAGG 
TGTTCTTGCTCACCTACCAACCATTGGGGTCGGAAAGAATGTACGGTCTTCAGAATCTCA 
AGCTCTGAAATTTGTGATGTTATTTTTGTTTTGCCTTGCATTTTCCATCTGATCGTTAAT 
GTGGAATTTATGATGTTGTAACATTTTCAGCTGCATCATGTGGATGGTCTGAATCAATCT 
GAGGTTAAACAGTCGCTTCAGCTCCAAATAAACGAGCATGAGCAAACTATCACTTTGGTA 
GGAAACTCTGGAATTACATGGGGAGTAGTAAGTGACTTTGACTGAACATCTACTGTAGTT 
GTTGTGTCTCTTTGGTAATACCGCGTTATATTAGTAGTGACTTATCAGTTTTAGCAACGA 
AACTTCTCCATAGTTGTGGTTTTGATAATCTTGTGTAAGATAGTGAATTTAATGATCAAG 
TTTTACATATTACGTTCAACAGGGATTTAGGCCAACTCTGAGTTCTCTAAAGCCCATATA 
TGTATCGGTTGGCCATCGCATATCACTGGACTCTGCCGTTGAAGTTGTCAAGATAACCTG 
CAAGTACCGTGTTCCAGAACCTATTAGACAGGTAAGTGATGCATTTACCAACAAACAGAA 
AGTTATCCTGTAGATATGTGAAAAGTGAAAAGTAAGAGTCGTTAAGTATACAGTTTACTA 
TATGCAGGCAGATATTAGATCAAGAGCATATCTCCAGAAGCATCAAACTGAGTCTTTTAA 
AGAACTGGCAGTGCGACCACCGGATCAGGTAACTTCTGATGTTTTCTCCGCCATTTCTAA 
CCATTGTCATATTTTTTCGTACTGGCTCACATGTCTCTTTGCTTCCTTTTTTGTCTACCA 
GACTGAACCTTAATCCCTCAAGCAACCAAGAACACTATTCCACATTACATAGAAACTCTC 
CAAAGTCTTTACCAAAGATTGTTAAATGGACAGATTCAGGCACTGAAGATCCGCCCCAAT 
TATCTCCTTCATTTATCTCACTGACTTGAAGATTGCAAGCTAACCAAGGTAATCATGTTA 
TATCCGATACATTGGAATTTCCTTTCCATACATACCTTAAACAAGTGTAAATAGAAAGGC 
TAGGCAACTGGTAATTTGGTTGTTTGGGCACTGTATATTGGGAGATTTTGGGGTTCTCGA 
CAAACAATTCTATAGCTTTGGGTTTGGTATTTCTTTTGGTTCAGCTGTAACTCGTTTCTC 
ATGCTCTAAGACAGCACA
>AT4G31150.2 |  endonuclease V family protein 
TGAACTTTTTCTGGAAATGGATAGTGAAGGAGCTTCAAGCGAGTCTTCTTCTTCTGGAGA 
TCAGCTCGAGAAGTGGACAGAGTAGTTTCACATTTGATTTCAGTTTCATTCCGCACAATC 
AAATCGGTTGATGATTTGTTTGACTTCTTTCAGAGAGCAGGATGAGCTGAAGAAGAAACT 
GATCGCGTACGATGACTTCACATGGAAGTTATCTTCATCAACGGAACTGTCTCAGGGATC 
GGAGATACTTAAGTATGTTGGAGGTGTAGACATGAGCTTTTGCAAAGAAGATTCTTCCGT 
CGCATGCGCTTGTCTCGTCGTTCTTGAGCTTCCTTCTCTCCGTGTAGTCCACCATGACTT 
CTCTCTTCTCCGCCTCCATGTTCCTTATGTCCCTGGATTTCTTGCCTTTCGTGAGGTTTC 
CTTCTCCTACTACTTCGTGTCCCCGAGCAATGCTCTGCTAAATTCATTTGCTTCACTAAA 
GTATCTCAGATCCCAAAATTGGATTTTTCATGTTACAGGCTCCGGTTCTTTTGCAGATTC 
TGCAGAAGATGAGAGATGAGAAGCATCCATTCTATCCTCAGGTTTCAGTTTTATCTATAA 
GTTGCTTTAGTTTGCAATTGGCTACTCTTAAACCATTGCTTTTGCGTTGATTTTTTTTCT 
TCTAAAAGTCTCTTGCTTTGCTCTTGCAAAGGTACTGATGGTGGATGGAAATGGAATACT 
TCATCCACGAGGTATAAACACACAACTTTACCTTTGTTTTGTAGTTGCATTTCAAGCTCT 
GTAATTATGGTGTTAGATGTAATTGTCTTCTATAGGATTTGGCTTGGCGTGTCATTTAGG 
TGTTCTTGCTCACCTACCAACCATTGGGGTCGGAAAGAATGTACGGTCTTCAGAATCTCA 
AGCTCTGAAATTTGTGATGTTATTTTTGTTTTGCCTTGCATTTTCCATCTGATCGTTAAT 
GTGGAATTTATGATGTTGTAACATTTTCAGCTGCATCATGTGGATGGTCTGAATCAATCT 
GAGGTTAAACAGTCGCTTCAGCTCCAAATAAACGAGCATGAGCAAACTATCACTTTGGTA 
GGAAACTCTGGAATTACATGGGGAGTAGTAAGTGACTTTGACTGAACATCTACTGTAGTT 
GTTGTGTCTCTTTGGTAATACCGCGTTATATTAGTAGTGACTTATCAGTTTTAGCAACGA 
AACTTCTCCATAGTTGTGGTTTTGATAATCTTGTGTAAGATAGTGAATTTAATGATCAAG 
TTTTACATATTACGTTCAACAGGGATTTAGGCCAACTCTGAGTTCTCTAAAGCCCATATA 
TGTATCGGTTGGCCATCGCATATCACTGGACTCTGCCGTTGAAGTTGTCAAGATAACCTG 
CAAGTACCGTGTTCCAGAACCTATTAGACAGGTAAGTGATGCATTTACCAACAAACAGAA 
AGTTATCCTGTAGATATGTGAAAAGTGAAAAGTAAGAGTCGTTAAGTATACAGTTTACTA 
TATGCAGGCAGATATTAGATCAAGAGCATATCTCCAGAAGCATCAAACTGAGTCTTTTAA 
AGAACTGGCAGTGCGACCACCGGATCAGGTAACTTCTGATGTTTTCTCCGCCATTTCTAA 
CCATTGTCATATTTTTTCGTACTGGCTCACATGTCTCTTTGCTTCCTTTTTTGTCTACCA 
GACTGAACCTTAATCCCTCAAGCAACCAAGAACACTATTCCACATTACATAGAAACTCTC 
CAAAGTCTTTACCAAAGATTGTTAAATGGACAGATTCAGGCACTGAAGATCCGCCCCAAT 
TATCTCCTTCATTTATCTCACTGACTTGAAGATTGCAAGCTAACCAAGGTAATCATGTTA 
TATCCGATACATTGGAATTTCCTTTCCATACATACCTTAAACAAGTGTAAATAGAAAGGC 
TAGGCAACTGGTAATTTGGTTGTTTGGGCACTGTATATTGGGAGATTTTGGGGTTCTCGA 
CAAACAATTCTATAGCTTTGGGTTTGGTATTTCTTTTGGTTCAGCTGTAACTCGTTTCTC 
ATGCTCTAAGACAGCACA