>AT5G41790.1 |  CIP1 (COP1-INTERACTIVE PROTEIN 1) protein binding 
ATGAAAAAGCATAAGTTTAGAGAAACCTTGAAGTCTTTCTTTGAGCCTCATTTTGATCAT 
GAGAAAGGTGAAATGCTTAAAGGAACTAAAACTGGTAATTTTCCTACACTACTAAGTTTG 
ATTCACATGTAAAATGAGATTCTTAGCTCTTGGTTTAACTGCTTACATGAAAAGTACTAC 
CATCGTCTGATGCAGAAATAGATGAAAAGGTGAACAAAATCTTGGGAATGGTTGAGAGTG 
GAGACGTCAATGAAGATGAGTCCAATAGACAAGTGGTTGCAGACTTAGTGAAGGAATTCT 
ACAGCGAATACCAGTCCCTGTACCGCCAGTACGATGATCTAACTGGAGAGATTAGGAAAA 
AGGTCAACGGGAAAGGAGAAAGCTCCTCTTCATCAAGCTCAGACTCGGATTCTGACCATT 
CTTCTAAGAGGAAGGTCAAGAGAAATGGAAATGGAAAAGTAGAGAAAGATGTAGAGTTGG 
TAACAGGTGCCCTGAAGCAACAAATCGAAGCTGCAAATCTTGAAATTGCTGATCTGAAAG 
GGAAGTTGACAACGACTGTTGAAGAAAAAGAAGCAGTAGATTCTGAGCTTGAATTAGCTT 
TGATGAAGTTAAAAGAATCAGAAGAGATTAGCAGTAAGTTGAAACTTGAAACTGAGAAGT 
TAGAGGACGAAAAGTCAATAGCACTGAGTGATAACAGGGAACTGCATCAGAAACTGGAAG 
TTGCTGGCAAAACAGAAACTGATCTGAACCAGAAGTTAGAAGATATAAAAAAAGAGAGAG 
ATGAACTGCAAACTGAGAGGGACAATGGTATCAAAAGATTTCAAGAAGCTGAAAAAGTTG 
CAGAAGATTGGAAAACAACGAGTGATCAGCTCAAAGATGAAACTTCTAATCTCAAGCAGC 
AGCTTGAAGCATCAGAGCAGCGAGTTTCAGAGCTGACCAGCGGTATGAATAGTGCAGAGG 
AAGAGAACAAATCTCTATCCTTGAAAGTTTCGGAGATTTCAGATGTGATCCAACAGGGAC 
AGACCACCATACAAGAACTAATTTCCGAATTGGGAGAGATGAAGGAAAAGTACAAGGAAA 
AAGAGAGTGAGCATTCTAGTTTGGTGGAGTTACATAAGACCCATGAGAGAGAATCATCAA 
GTCAGGTGAAAGAATTAGAAGCACACATAGAATCATCAGAGAAGTTGGTTGCAGATTTCA 
CCCAAAGCCTGAACAATGCAGAGGAAGAGAAAAAACTGCTATCTCAGAAAATAGCAGAAC 
TCTCTAACGAGATTCAAGAGGCGCAGAACACCATGCAAGAACTCATGTCTGAGTCTGGGC 
AGTTGAAAGAGAGCCACAGTGTGAAAGAGCGAGAACTTTTCAGTTTGAGGGACATCCATG 
AGATTCATCAAAGAGACTCATCCACCAGAGCAAGTGAATTAGAAGCTCAACTGGAGTCCT 
CAAAACAGCAGGTCTCAGATTTGAGTGCGAGTCTGAAAGCTGCAGAGGAAGAAAACAAAG 
CTATATCCTCGAAAAACGTGGAAACTATGAACAAACTCGAACAAACGCAGAACACGATAC 
AGGAACTCATGGCTGAATTGGGAAAGTTGAAAGACAGCCACAGAGAGAAAGAGAGTGAGC 
TTTCTAGTTTGGTGGAAGTACACGAGACTCACCAGAGAGATTCATCAATTCATGTGAAAG 
AATTAGAAGAGCAAGTGGAATCATCAAAGAAATTGGTTGCGGAGTTGAACCAAACCCTGA 
ACAATGCAGAGGAAGAGAAAAAAGTGCTATCTCAGAAAATAGCAGAACTTTCTAACGAGA 
TTAAAGAGGCACAAAACACCATACAAGAACTCGTGTCTGAGTCTGGGCAGTTGAAAGAGA 
GCCACAGTGTAAAGGATAGAGATCTTTTCAGCTTGAGGGACATCCACGAGACTCATCAAA 
GAGAATCATCCACTCGCGTGAGTGAATTAGAAGCTCAACTGGAATCCTCAGAACAGCGGA 
TCTCAGATTTGACTGTGGATCTGAAGGATGCAGAGGAAGAAAACAAAGCTATCTCCTCGA 
AAAATTTGGAAATTATGGACAAGCTTGAACAGGCTCAGAACACGATAAAAGAACTCATGG 
ATGAATTGGGAGAGTTGAAAGACCGACACAAAGAGAAAGAGAGTGAGCTTTCTAGTTTGG 
TGAAGTCAGCAGATCAACAGGTTGCAGATATGAAGCAGAGTCTGGACAATGCAGAAGAAG 
AGAAAAAAATGTTATCTCAGAGAATCTTAGATATCTCTAATGAGATTCAAGAAGCACAAA 
AAACCATACAAGAACACATGTCTGAGTCTGAACAGTTGAAAGAGAGCCACGGTGTGAAAG 
AGAGGGAACTTACTGGTTTGAGGGACATTCACGAGACTCATCAAAGAGAATCATCCACTC 
GTTTGAGTGAATTAGAAACTCAACTGAAATTATTAGAACAACGGGTCGTAGATCTGAGTG 
CGAGTCTGAATGCTGCAGAGGAAGAAAAGAAGTCCCTGTCCTCAATGATCTTGGAAATTA 
CGGATGAGCTCAAACAGGCCCAAAGCAAGGTACAGGAACTTGTGACTGAATTGGCAGAGT 
CTAAAGATACACTCACACAAAAAGAGAATGAGCTTTCTAGTTTTGTGGAGGTACACGAGG 
CCCATAAGAGAGATTCCTCAAGTCAGGTGAAAGAATTAGAAGCACGGGTGGAATCAGCAG 
AGGAACAGGTTAAAGAATTGAACCAGAACCTGAACAGTTCAGAGGAAGAGAAGAAAATTT 
TATCTCAGCAAATTTCAGAAATGTCGATCAAGATCAAGCGGGCGGAAAGCACCATACAAG 
AACTCAGCTCTGAGTCTGAACGATTAAAAGGGAGCCACGCTGAGAAAGACAATGAACTTT 
TTAGCTTGAGGGATATCCATGAGACTCATCAGAGAGAATTATCCACTCAGTTAAGAGGTT 
TAGAAGCGCAACTGGAATCATCTGAACACAGGGTTTTGGAATTGAGCGAAAGTCTGAAGG 
CTGCAGAAGAAGAAAGCAGAACTATGTCCACGAAAATCTCAGAAACTTCAGATGAGCTTG 
AACGGACACAGATCATGGTACAGGAACTCACAGCTGATTCGAGCAAACTGAAAGAGCAGC 
TCGCTGAGAAAGAAAGCAAACTATTCCTTCTGACAGAGAAGGACAGCAAATCACAGGTGC 
AAATAAAAGAACTAGAAGCAACAGTAGCGACACTGGAGCTGGAACTAGAGTCAGTTCGTG 
CCCGTATAATAGATCTTGAGACAGAGATTGCAAGCAAGACCACCGTAGTTGAGCAGTTGG 
AAGCGCAAAACAGAGAAATGGTTGCTAGAATCTCAGAACTTGAGAAGACAATGGAGGAGA 
GAGGAACTGAACTCTCAGCTTTAACTCAAAAACTTGAGGATAACGATAAGCAATCATCGT 
CTTCAATTGAGACTTTGACAGCTGAGATCGATGGCCTACGAGCAGAATTAGATTCAATGT 
CTGTTCAAAAAGAAGAGGTGGAGAAACAAATGGTGTGCAAAAGCGAGGAAGCCTCAGTGA 
AGATTAAACGTTTGGATGATGAGGTCAATGGTCTGAGACAGCAAGTGGCCTCACTTGATA 
GCCAGAGAGCAGAACTCGAGATCCAACTTGAAAAGAAGTCCGAGGAGATATCTGAATATC 
TGAGTCAGATTACAAATCTAAAAGAGGAGATCATAAACAAGGTTAAAGTTCACGAGAGTA 
TTCTAGAAGAAATAAATGGTTTATCTGAGAAGATTAAGGGTCGTGAACTTGAGTTAGAGA 
CTCTAGGGAAACAGAGAAGTGAGCTTGATGAGGAGCTGAGAACTAAGAAAGAAGAGAATG 
TTCAAATGCACGATAAGATCAACGTAGCGTCTTCTGAAATAATGGCCTTAACAGAACTGA 
TCAACAATCTGAAGAATGAGCTTGATTCTCTACAGGTGCAGAAGAGCGAAACCGAAGCAG 
AGCTTGAGAGAGAGAAGCAAGAGAAATCAGAATTGTCGAATCAGATCACCGATGTCCAGA 
AAGCATTGGTAGAGCAAGAAGCTGCTTACAATACGCTGGAAGAGGAACACAAGCAGATAA 
ACGAACTATTTAAAGAAACTGAAGCAACACTAAATAAGGTAACTGTGGATTACAAAGAAG 
CTCAAAGATTGTTGGAGGAGAGGGGTAAGGAAGTGACATCCAGAGATTCTACAATTGGGG 
TTCATGAAGAGACGATGGAGAGTTTACGTAACGAGCTGGAAATGAAAGGAGACGAGATCG 
AAACTCTCATGGAGAAGATCAGTAACATCGAGGTTAAGCTACGCTTGTCGAACCAGAAAC 
TGAGAGTAACCGAACAGGTACTAACAGAGAAAGAAGAAGCTTTCAGGAAAGAAGAGGCTA 
AGCACTTAGAGGAGCAAGCATTGCTTGAGAAGAATCTCACCATGACACATGAGACTTATC 
GAGGTATGATCAAAGAGATAGCAGATAAAGTGAACATAACAGTAGATGGGTTTCAATCCA 
TGTCAGAAAAACTCACGGAGAAACAGGGGAGATACGAGAAAACTGTAATGGAGGCATCAA 
AAATACTGTGGACTGCGACGAATTGGGTGATAGAGAGAAATCACGAGAAGGAGAAGATGA 
ATAAAGAGATAGAGAAGAAAGATGAAGAAATAAAAAAGCTTGGAGGAAAAGTAAGAGAAG 
ATGAAAAAGAGAAGGAGATGATGAAAGAGACTTTGATGGGACTTGGAGAAGAGAAAAGAG 
AAGCGATAAGGCAATTATGTGTTTGGATCGATCACCATAGAAGTCGTTGTGAATATCTTG 
AGGAGGTTTTGTCTAAGACCGTTGTGGCTCGAGGCCAAAGAAGAGTGTCGCAGCGAACTT 
AAGGACTCAGTGCCATGGTACGTTGTTTATCTTTCCCAAGCCTAGTTTCCACCTCACATG 
AATGCAAACAATGAAACAACATATATGTGTTTATTAGGTTTTGGACTCTGGTCAATCAAG 
AAGCTGGTGGAGAGGTATTTTTGGTTGGGGACTTTTGGTGTACTTGTGTTCGATTTTGTT 
GCACTTTTATATGTTTGTTAACTTTTGTTGTATTTTGTAAGTCAAAATTTTTGGTTTATT 
GTGGGCAAAGTTGGTGGTGGTTTTTATGGGAGGTCAGGGAATAAAGGGGCTCACACAAAT 
GGAGTTGATATTTTTTTTTCTTTGGGCGTCGGATTGTATAGAACGATTAAATGCTACTGT 
TGGTATAGTGCTTTTGCTTGTTTGGAATTTGTTATAGTATCATCTTTGCTCTTTCATAAC 
AAAATTATACACATCGCTTTACAGAGTTTCGTTCTCTC
>AT1G67630.1 |  POLA2 (DNA POLYMERASE ALPHA 2) DNA binding / DNA-directed DNA polymerase 
ATCCCGCCCTAAACCAGACAATTTCCCGCCACTTGCCTTCGTCTTCACCAGTCGCCCACA 
ACAAAAAGCTTCTCTCTCTAGGAAACACAGAGAGAGCGAGAGAGTGAAGTTGAAAGAAAA 
TGGCTACAGATGAGGAAATAAAGAACGAGTTTAAAAGAAGCGGCTTTATTCTTGTGGAAG 
AAGACGAGATTCTTAAGAGATGTAAGCGAGACACTATCCCCTAATCTAATATCTCTCTGC 
CCAGATCTTTTAACTTTTGTTTATATCTGACTGTTTTTTTCTTACAGGTGTTACTCTCTG 
CATAAATTACAGTCTTAAGCCTTCTGATCTTGTTTCAAGTTGGGAACTTTATCATCTCAA 
TCGGTAAAAATCACATTTTTCTTATTTTCCATTGCCCAATAGTAAAATTCAAAGCTTTTG 
TTACCTCTTGAGATTGTATTGATGTTTAAATAGTGACCAATTTCATGATTAGAGTGGTTG 
TGTTAGTGATGGCGAAGAGAATTGAGTTTGTTTGTTTTTTCCATTGTGTTTGGTTTGATG 
CAACAGACAACTTCTTGATCAAACTGTTAAGAAAGATGACATGGATGGGTTTGTATTGCA 
TCTTCAGAATGAACAGAAAGAATCTATTATGAGAGTGGAAGAAGCTGGTCTGCATCTTTA 
CTCAAATAGAGATGTAGATATGTAAGTGCTTTTTGACCATGTTTCTTCTTACTTTGCATT 
AGCTTTAAACAGATTTTGTTTTTGAAGATATAGAGATTTGGTTTTTTGGTTCAGGCTTTT 
GGATGGGGTGCAAGAAGATACGGAAGAGATTGTTACTACTCCTACAAACAAGTCTCAACG 
GTTACATCCGGATCCGTTTGATTCGATAAGTAGATCAAGAGATTATGGCTATTCTACTGG 
GAAGTCAGTTGGACATGTGACACCTTTTGGGTCACGAATCGAGAAGTTTGTGGTGAAGTT 
CAATGTGGGTAATGTGGCGGCACATGCAGAGAATGGAAACAACAATGATGTAGAAAACAG 
TGAGGATGATATCATTAAGAGAGTTCAAACCAGCCAGCGGTGTTCTCTAAAAGTCAATGG 
CTCAGGCCCTGAACCAGGTTGCAGGTTCATGTATGACAGAACTGAGGACAGGTTTAGTGC 
ACTCGAGTATCGGATCGTAAGGCATGCAGATGCATTTGCTGCCTCGGGATTATATGAGGA 
ACAGGTGGATCCGGCTGTTGCTTCACAGGTAGGTTTGTTCATACATACTACTTTGGTGTC 
AAATAAATTAACATTGGGGTATAGAATTTATTACATTGTGCTACTGATTGCTGCAGAGAA 
GTATATTTGCTGTGGGAATGATTTGCTGTGATGGAGAGGGGCATTTGAATGATAAGTCCA 
TTCTATTGCAGAGCAGGTTAGTCCATCATGACTTCACTTTTCTTTGTATATCATCGTGAA 
GGATTATGAATCCTGTGTTATAAAAAGTTGCATATTCAACAATTTGGATACTAGAATGAC 
TTACATTGTGGTCCTATAGGGTATAGCCATTTATAGTTAGTTATTGGCATAACTTTCTTT 
TAAACATGAAGCCTCAGTTCCAAATATCCAGAGTTTCCTTATCCTAATGCCAACAAATTC 
GATGATTGCAGTGCCGAGCGTACTTCAGGACAGCGTGTTCCAGTGGACTTAAAGAGACTA 
GATCAGTTCTCCATTTTTCCTGGCCAGGTGATAGCTTAAAGCTAACAACATTAGATATTG 
TGTTTTTTCCACAGAACACTCATAATATTCATGTGGAAGTTGTCTGAATTTGATGCAGGT 
AGTTGGCATTGAGGGGCAAAATCCTAGTGGACATTATCTCACTGCATCTAAGCTGCTAGA 
TTCAGTTCCTTTAACACTTACTGTTGACGTGGATCTACCTCCTGCTAAGAGGCAAATCTT 
GGATCAGGAAGTCTTAGTTCCTGCAGAAGAATCCTGTCAAAAATCAGAGGTTTCATTTGT 
AAGTATGCACTCCTTCATGTCAAGGGAGCTGTACTAGTATTTTTTTACCTATATCGTCAA 
GGAACCCATTGATTATTTTATATGATTCTGGCACACTTCTTTCTCGTACATTTATACACA 
CATAATCATAATGTTGAGATGAGATAACTGCAGAATGTTGAGAATTTAGAGATTACAAAG 
CTGTTTTACTTAGCTAGATTGGTAACTTGGAGTGGAGCTACTTTAGTTACTGACTTCGAT 
AATGCCAAACAAAATTTGTATGCTGTGTTCCCCTTTTCTTTTATGATGATATTTGAGATG 
AATGTATGGATATGTTCTGTTTTTATGCATAGCTATTAAGTTGTCATTACCAAGCACAAG 
GATGGTGTGTTTAGAATCAGTTAGCATCATAATTTTCTAGTTTGGGATTCAAAATGATGT 
TTAAAGGTCTTTCTGTTGACAGATAATTGCATCCGGACCATTCACCACATCAGACAACTT 
GCTGTTTGAGCCACTGAATGAGCTACTAGCCTATGCAAAAAGAAAGCCACCACAGTTACT 
CGTGCTGGTGAGTAACTAGAATGCATTCACACATTCTGTAGATATTTGTCTCTTGTGTGA 
TTGTGTCTCGGGATCACTTACGTTTTATTTCCAAACTCAGCTTGGACCATTTGTGGATTC 
TGAGCATCCAGAGATTAAGAAAGGCGCTGTTGATGCCACCTTTAATGAGATATTCCAAGT 
GGAAGTCCTCAGGAAGGTACTGAAAATAGGACAAATAGATATACTGAATACTGACTGACT 
TTGGAATAAACAAAGATGTTTATGGTTTTTGAGTTTCTCAGTTGCAAGATTACGTGGAAT 
TCATGGGTTCAGAAGTAAGAGTGGTTCTGGTGCCATCCATTCGTGATGCTAACCATGATT 
TCATATTCCCACAGGTGCTCTTTTCTATTTCCTCTTAATATCTCTCTTCTAGAGTTTCCG 
CATTCGTCTTCTCTGTTTGATTCGAAAAGTTTCTTGTTGTGTTTGCAGCCTCCTTTCGAC 
ATTCACATACCTGATCTCGAACATCAGGTATTTGATTCTTCTCATTAACAAGTCTCCCTT 
CCTTCACTCAACTCTCTCTGTGCACAGGTGGATATATATTTACTTTTTTCATGTCTCTGT 
CTCATCATACATTACAGATGACTAGTCTGTCAAACCCGGGGACCTTTGAGGCAAACCAGG 
TTAGAAAATCACTGTGACAGTTCTCTTCTGAGAAGCCATATTCTCTCAAGTCCTTGCAAC 
ATAAAATGTTAACTGGGTATTCTCAGGTGAAGGTAAGTTGCTGCACGGTGGATGTACTAA 
AACAGCTGAGTGGGGAGGAGATGTCAAAAAATCCAAGTGGAGTCCCCACTGATCGCATGT 
CCAGACTCGCTAGCCATCTCCTCCGTCAGCGAAGGTAACTTTTGCGTCTACTAGATCCAA 
CTAGATTCTCAGCTACCAAATACTCAGAAATTGGATTCTTATGAAACAGCTTCTATCCGC 
TGTATCCACCGCCCGAGAGCCTCCCTTATGATTCCTCACTCGCTCCTAAGGCGCTACAGA 
TTTCATCAATCCCGGATATTCTTCTACTTCCATCAGACATGAGGTACTTCGTGAAGGTGA 
GTCAGTATGTTAATAGTGCCATCAAATTCAGAAGTTAGACTCTAAAAGAAGAATTACTGA 
ATTTTTTCTTGAATTGTTATGAAGATTTTATCCCTTGGCGAAGAGGAGGATGCAGCCAAG 
TGCGTTTGTGTAAACCCGGGAAGACTTGCGAAAGGAGAAGGTGCAGGTACTTTCGTTGAG 
CTTACCTACAAAGGCGGTCCAGAATCGATGCACGCTTCCATCATCTCTATTTAAAAACAG 
AACCTGCAACGTTTGCCCAACTCTGCTAATTCCATATATAATAGAAGCCTTTGGTTCCTC 
TCACTTTTCATGCTACGGTTAGATGCAAATGTAATATTCAGATGTATAGTATATCTTAGG 
CCTGCGA
>AT1G64330.1 |  myosin heavy chain-related 
AATTTCTTTTGTCGGTTTTAAATTCATTTCATTTTATTATAAATTCGCTACCGTTTTTTT 
CTGTCACCGGAGCTCCTTCTTCCAGGTAACAAAAAAAATACTTAGATCACTTGATGATTG 
AGCTAAGTTTCGATATCTCTGTTTTGATTAGATCTTTGATTCCAAGTTCCTAGTTCTTGC 
TAACTCTTCGATCCGGTGCAGTAGCTCATCTTTTGTTTGTTTGTAGAGTTTTATAGGCTA 
AAAACTCGGGTTGTGTTCTTAAGTTTTTTTTTTTTCTACTATGTTCTTAAGTGGTTTCGG 
TGATTGTTTAGCTGTATTTATCAATGGTGTGTTTAATTTCTATAAGAATCTGCTCATGTT 
ACTTAATCATAGCTATTTTTGGCAGATTTGTAATTCATGTACTTGGATCTTTGTTACGCT 
TGGTTATAATCCTTTCATGCATAAATCCACTAAATCTCGATTCGGATCTTGTTAGAAAAA 
GAAACCTCAAAACTAGTTAGCATCTTTGTTTCAAAATGCTAATTTTTACTTGTTTTTACA 
TTTTTTTGGGGTTTCAAAAGAAGATTTGGAAGTGTATTATTGTCTTTGTATAATAGAGAC 
ATAAAAAGAAACAACTCATATGATGATGATAGCTGTCTTTTTTGTTATCATTCTCTGTGC 
TTTCTGGTTCCCATTCCCTTAAAAGTTTCTCTACTGGCTCCACTACATTCATTACTTGTT 
CATTTCTTAATTAGGATCAAATCATTTTCCCTTCAGATTAGACCCTTTGCTAAAACTGAT 
TAGCAATTTTGGATATTCAATTTTGTAATTAGTTTTTAAACTATCACATTGCTAGTTTGG 
ATTTTTTGCAAGTATAATGTTTCTTACCTCAAAACTGGATTTGTTTCTTTTATTACCAGT 
AGGGGGGTGGGGATGGATCCATCTGTCTTTTAACGAATATCACCTTTATGACATAAGATA 
TTTTACTCTTAGATTTAAATATTTGTAGCTCTGCTATCTATTTGTCAAGGCTCCAATTGA 
ATCATCTACTTTTTTATTTCATTTCTGTTACTATCCAATTGAAATTCAGCCCCTAATTAA 
CATTAGTTTACTAAACATTTGAAAATGATGGTATCTTTTTCAATAAAATATTGCCTAATT 
GTCTTGAACAAGTTAGAGCTTCTTCTCACATGTCTTCTCTGTGATATTGTGCAATCTACA 
GATCGTGCTTGATGTCCCGGATATGATTTTTTAGTTCCAAATCTTGAATCTTTTGATTGG 
ATAAGAAATGAGGAAGCTTAGTATTAGAGACTCCTTGAAATCTTTCTTTGAGCCTCATCT 
TCATCCTGATAATGGTGAATCACTCAAAGGAACAAAAACTGGTAATTCTCTTTGTGCACT 
TGTTAGTTTACTTTTTGTTTTCATTAAAATCATTCCAAATCCATAGGTCTTTTGGTTTTA 
GACTTGTTTTAATATGGAGAAATTCCTTCTTCTTTTTTTATCAACAATGCAGAAATTGAT 
GAGAAAGTGAAGAAAATCTTGGGAATTGTTGAGAGTGGAGATATTGAGGAAGATGAATCC 
AAAAGACTAGTGGTTGCTGAGTTAGTGAAAGACTTCTACAAAGAGTATGAGTCTTTGTAT 
CACCAATACGATGATCTAACGGGTGAGATCAGGAAAAAAGTACATGGAAAAGGAGAGAAC 
GATAGCTCTTCTTCTTCGAGCTCAGATTCGGATTCAGATAAGAAGAGCAAGAGAAACGGG 
CGGGGTGAGAATGAGATAGAGTTGTTAAAGAAACAGATGGAAGATGCAAATCTTGAAATT 
GCTGATCTCAAAATGAAGTTAGCAACAACTGATGAACACAAAGAAGCTGTTGAATCAGAG 
CACCAGGAGATTTTGAAGAAGTTAAAGGAATCAGATGAGATTTGTGGGAATTTGAGAGTT 
GAAACTGAGAAGTTAACAAGTGAGAACAAAGAACTGAATGAGAAACTTGAAGTTGCTGGT 
GAGACGGAATCTGATCTGAATCAGAAGCTAGAAGATGTGAAGAAAGAGAGAGATGGTTTG 
GAAGCAGAGCTTGCGAGTAAGGCTAAAGATCACGAGAGTACACTGGAAGAAGTTAACCGT 
CTGCAAGGGCAAAAGAACGAAACCGAAGCAGAACTCGAGAGAGAGAAGCAAGAGAAACCA 
GCGTTACTGAATCAGATAAACGATGTGCAGAAAGCATTGTTAGAGCAAGAAGCTGCTTAC 
AATACGCTGAGCCAAGAACACAAACAGATCAACGGTTTGTTCGAAGAACGAGAAGCAACA 
ATCAAGAAGCTAACAGATGATTACAAACAAGCCCGAGAGATGTTGGAGGAGTACATGTCA 
AAGATGGAGGAGACAGAGAGGAGAATGCAAGAGACCGGTAAAGATGTTGCATCCAGGGAA 
TCTGCGATTGTAGATCTTGAAGAGACGGTAGAGAGTCTACGTAATGAAGTGGAGAGGAAA 
GGAGATGAGATAGAGAGTTTGATGGAGAAGATGAGTAACATCGAGGTTAAACTCCGTTTG 
TCTAACCAGAAACTGAGAGTAACCGAACAAGTGTTGACAGAGAAAGAAGGAGAGTTAAAG 
AGAATAGAAGCTAAGCATTTAGAGGAACAAGCATTGCTCGAGGAGAAGATCGCAACAACC 
CACGAAACATATCGAGGTTTGATCAAAGAGATATCAGAGAGAGTGGATTCAACAATACTA 
AACCGGTTCCAATCCTTGTCTGAAAAACTTGAAGAGAAGCACAAAAGCTACGAGAAAACA 
GTGGTTGAAGCGACGAAGATGCTCTTGACGGCGAAGAAGTGTGTGGTAGAGATGAAGAAG 
GAGAAAGACGAGATGGCGAAGGAGAAGGAAGAGGTGGAGAAGAAGCTTGAAGGTCAAGTA 
AGAGAAGAGGAGAAAGAGAAGGAGAAGTTGAAGGAGACATTGTTGGGATTAGGAGAAGAG 
AAGAGAGAAGCGATAAGACAGTTATGTATATGGATCGAACACCATAGAGACCGTTGTGAG 
TATCTTGAAGAGGTTTTGTCGAAAATGGTCGTGGCAAGAGGACAAAGAAGGTCACAACGA 
GCTTAAAAGTGACTTAAACTCTTCTCAAAACTGTAAGTTAGAGCTTAGCTGTGTTTATTT 
TGTGATTGGTGTTTGTGTTTTGTTTTTCTAAGTCAGAAGAATTATTTTGTTGGGGTGAAG 
TGTGATGATTGTTTTGTAGTTGTAAGATCATAAAGATGGATTTGGACTCATCATTGTTGT 
TATAATGTTTTCTAAGATATATATTTATATAGAATGCAATTTTCATTTCAAAAA
>AT2G06510.2 |  RPA1A (REPLICATION PROTEIN A 1A) DNA binding / nucleic acid binding 
GGAATCTCCTAACAGTCACCACCACCACCACCGTCTAGGTCAAATCTCGTCTTCCTCACG 
CTCTATTTCTCCATAGAATATTTCCTAACTCCTCCTCCGGTTTATCGATTTTTTCAATTT 
TTCTAGGGTTTCGCGCCGGGATCTAAAAAATCACAATCATGCCGGTGAGTTTGACTCCGA 
ACGCAATCACGGCGATACATGACGGCGACGTGAATTTGAAGCCGTTGTTACAGGTTTTAG 
AAATCAAAATGATAGGAAGAAGTCAAGAGAGAAGCCAGGAGAGGTATCGTTTCCTCATTT 
CAGATGGTGTTTCTGCTCAACATGCTATGGTCGCGGTTCAGCTTAATGATCGAGTCAAGT 
CAGGACAATTTGAGAAAGGATCTATCGTTCAGCTGATTGATTACATTTGTAGCGACGTTA 
AAGGCCGCAAGTAATTTTTCCATTTTCTCTCTGGTTAGATCTAGTTTTCGTTGTGTTGAA 
TTGCTTAGTTTTCTAGTGATCTCTGATTTGTTGCTTAGTAATGTTTCTGAGTATTCGTGG 
CTATGTATTTGGTTTAGTATGTGTAAGGCATTTGTTACAATGAGTTTGCAGAAGCAATGA 
TAGCTTCGCTTTTGGTAGAGACCTTTCAATGAGGTTTCGTGTATTGATGAATGATTTTGG 
TTAACATGTACTAGTGGGAAAGATTTGTGTTGTTGTCTTTGTAGTTCATGGTATTTAATG 
GTTGGTAGGCAGATGTTAAGGACAACATTTAGGATGATAATGGAGATGATTTTGTTGATT 
GTGTGAGTTGGAAAATATAGTTACACAATTGTTTTGGTTGAACATGACATATTTGAAGGA 
GTTTTGCTCTCTTTGATTGTGATTTTCTTATGGATTTATTCATACTGTGTACAGGCTTAT 
TGTGGTGCTGAACATGGAGACGATAGTACAACAGTCTGAAACCATTGGGAACCCTACAAT 
ATTTGGAGAAACAGATACAGAAGCCCAGAAGACATTTTCAGGTACGGGCAATATACCGCC 
TCCGAACAGGGTTGTTTTTAATGAACCAATGGTTCAGCATTCTGTTAATAGAGCACCTCC 
CAGGGGTGTAAACATTCAAAATCAAGCCAACAATACTCCAAGCTTCAGGCCATCTGTTCA 
ACCTTCATATCAACCGCCTGCAAGTTACAGAAATCATGGACCCATCATGAAGAACGAGGC 
TCCAGCTCGAGTCATCCCTATTGCTGCTCTCAATCCATACCAAGGTCGATGGGCTATTAA 
GGCTAGAGTAACTGCGAAAGGAGATATCAGACGATATAACAATGCAAAAGGAGATGGAAA 
GGTTTTCTCGTTTGATCTGCTTGACTATGATGGAGGGGAGATTCGGGTTACGTGCTTTAA 
TGCTCTTGTTGACCGTTTCTATGATGTTACTGAGGTTGGTAAGGTATATTTGATTTCAAA 
GGGAAGTTTGAAGCCTGCACAGAAAAATTTCAACCACTTAAAGAATGAATGGGAAATTTT 
CTTGGAGTCAACATCGACTGTGGAGCTTTGCCCTGATGAAGATGGCTCCATACCAAAGCA 
GCAATTCTCCTTCCGCCCAATAAGTGACATTGAGAACGCTGAGAACAATACCATACTCGA 
TGTCATTGGTGTGGTGACTTCTGTGAACCCCTCGGTGCCAATCTTGAGAAAGAACGGGAT 
GGAAACCCATAGGAGGATCCTGAATCTAAAGGATGAATCAGGAAAGGCTGTAGAGGTAAC 
ACTTTGGGGAGAATTCTGTAACCGAGATGGTCGGCAACTGGAAGAGATGGTTGATTCAGC 
TTTTCACCCGGTTTTAGCAATAAAAGCTGGAAAAGTAAGCGACTTCAGTGGGAAATCAGT 
AGGGACAATATCTTCAACACAGCTCTTCATAAATCCAGATTTCCCTGAAGCTCATAAACT 
ACGGACCTGGTTCGATTACGGGGGAAAAGACACTGCTTCCTTCTCCATCTCCAGGGACAC 
TATGCCTGGAGGAGTTTCCAGGAACGAGATAAGGAAAAATGTTTCTCAGATCAAAGAGGA 
AGGTCTTGGAAGATCAGATAAGCCTGACTGGATCACTGTGAAAGCAACCATATCATTCAT 
CAAAACAGATAGCTTCTGTTATACAGCTTGTCCTTTGATGATCGGGGATAAACAATGCAA 
CAAGAAGGTTACACGGTCTGGAACAAACAGGTGGCTCTGTGACCGGTGCAACCAAGAGTC 
TGATGAATGCGACTATAGATACCTTCTTCAGGTACAGATTCAAGACCACACTGGGTTGAC 
TTGGATAACCGCGTTTCAAGAAACAGGAGAAGAAATAATGGGATGTCCGGCTAAGAAGCT 
TTACGCAATGAAATACGAATTGGAGAAGGAGGAAGAGTTCGCAGAGATTGTTAGAGACAG 
ACTGTTTCATCAGTACATGTTGAAGCTGAAGATCAAAGAGGAATCGTATGGGGATGAACA 
AAGAGTGAAGATGACTGTTGTGAAGGTTGATAAGGTGAATTATACATCCGAGAGTAAATA 
CATGCTTGATTTGCTCGTAAGGTAAGTTCGTTCTAGGTATTACAGTGAGGTATTTCAATT 
AACTCAGAATATGCAAGCTCGAGTTTAGTACACTATTATATTATGAATTG
>AT2G06510.2 |  RPA1A (REPLICATION PROTEIN A 1A) DNA binding / nucleic acid binding 
GGAATCTCCTAACAGTCACCACCACCACCACCGTCTAGGTCAAATCTCGTCTTCCTCACG 
CTCTATTTCTCCATAGAATATTTCCTAACTCCTCCTCCGGTTTATCGATTTTTTCAATTT 
TTCTAGGGTTTCGCGCCGGGATCTAAAAAATCACAATCATGCCGGTGAGTTTGACTCCGA 
ACGCAATCACGGCGATACATGACGGCGACGTGAATTTGAAGCCGTTGTTACAGGTTTTAG 
AAATCAAAATGATAGGAAGAAGTCAAGAGAGAAGCCAGGAGAGGTATCGTTTCCTCATTT 
CAGATGGTGTTTCTGCTCAACATGCTATGGTCGCGGTTCAGCTTAATGATCGAGTCAAGT 
CAGGACAATTTGAGAAAGGATCTATCGTTCAGCTGATTGATTACATTTGTAGCGACGTTA 
AAGGCCGCAAGTAATTTTTCCATTTTCTCTCTGGTTAGATCTAGTTTTCGTTGTGTTGAA 
TTGCTTAGTTTTCTAGTGATCTCTGATTTGTTGCTTAGTAATGTTTCTGAGTATTCGTGG 
CTATGTATTTGGTTTAGTATGTGTAAGGCATTTGTTACAATGAGTTTGCAGAAGCAATGA 
TAGCTTCGCTTTTGGTAGAGACCTTTCAATGAGGTTTCGTGTATTGATGAATGATTTTGG 
TTAACATGTACTAGTGGGAAAGATTTGTGTTGTTGTCTTTGTAGTTCATGGTATTTAATG 
GTTGGTAGGCAGATGTTAAGGACAACATTTAGGATGATAATGGAGATGATTTTGTTGATT 
GTGTGAGTTGGAAAATATAGTTACACAATTGTTTTGGTTGAACATGACATATTTGAAGGA 
GTTTTGCTCTCTTTGATTGTGATTTTCTTATGGATTTATTCATACTGTGTACAGGCTTAT 
TGTGGTGCTGAACATGGAGACGATAGTACAACAGTCTGAAACCATTGGGAACCCTACAAT 
ATTTGGAGAAACAGATACAGAAGCCCAGAAGACATTTTCAGGTACGGGCAATATACCGCC 
TCCGAACAGGGTTGTTTTTAATGAACCAATGGTTCAGCATTCTGTTAATAGAGCACCTCC 
CAGGGGTGTAAACATTCAAAATCAAGCCAACAATACTCCAAGCTTCAGGCCATCTGTTCA 
ACCTTCATATCAACCGCCTGCAAGTTACAGAAATCATGGACCCATCATGAAGAACGAGGC 
TCCAGCTCGAGTCATCCCTATTGCTGCTCTCAATCCATACCAAGGTCGATGGGCTATTAA 
GGCTAGAGTAACTGCGAAAGGAGATATCAGACGATATAACAATGCAAAAGGAGATGGAAA 
GGTTTTCTCGTTTGATCTGCTTGACTATGATGGAGGGGAGATTCGGGTTACGTGCTTTAA 
TGCTCTTGTTGACCGTTTCTATGATGTTACTGAGGTTGGTAAGGTATATTTGATTTCAAA 
GGGAAGTTTGAAGCCTGCACAGAAAAATTTCAACCACTTAAAGAATGAATGGGAAATTTT 
CTTGGAGTCAACATCGACTGTGGAGCTTTGCCCTGATGAAGATGGCTCCATACCAAAGCA 
GCAATTCTCCTTCCGCCCAATAAGTGACATTGAGAACGCTGAGAACAATACCATACTCGA 
TGTCATTGGTGTGGTGACTTCTGTGAACCCCTCGGTGCCAATCTTGAGAAAGAACGGGAT 
GGAAACCCATAGGAGGATCCTGAATCTAAAGGATGAATCAGGAAAGGCTGTAGAGGTAAC 
ACTTTGGGGAGAATTCTGTAACCGAGATGGTCGGCAACTGGAAGAGATGGTTGATTCAGC 
TTTTCACCCGGTTTTAGCAATAAAAGCTGGAAAAGTAAGCGACTTCAGTGGGAAATCAGT 
AGGGACAATATCTTCAACACAGCTCTTCATAAATCCAGATTTCCCTGAAGCTCATAAACT 
ACGGACCTGGTTCGATTACGGGGGAAAAGACACTGCTTCCTTCTCCATCTCCAGGGACAC 
TATGCCTGGAGGAGTTTCCAGGAACGAGATAAGGAAAAATGTTTCTCAGATCAAAGAGGA 
AGGTCTTGGAAGATCAGATAAGCCTGACTGGATCACTGTGAAAGCAACCATATCATTCAT 
CAAAACAGATAGCTTCTGTTATACAGCTTGTCCTTTGATGATCGGGGATAAACAATGCAA 
CAAGAAGGTTACACGGTCTGGAACAAACAGGTGGCTCTGTGACCGGTGCAACCAAGAGTC 
TGATGAATGCGACTATAGATACCTTCTTCAGGTACAGATTCAAGACCACACTGGGTTGAC 
TTGGATAACCGCGTTTCAAGAAACAGGAGAAGAAATAATGGGATGTCCGGCTAAGAAGCT 
TTACGCAATGAAATACGAATTGGAGAAGGAGGAAGAGTTCGCAGAGATTGTTAGAGACAG 
ACTGTTTCATCAGTACATGTTGAAGCTGAAGATCAAAGAGGAATCGTATGGGGATGAACA 
AAGAGTGAAGATGACTGTTGTGAAGGTTGATAAGGTGAATTATACATCCGAGAGTAAATA 
CATGCTTGATTTGCTCGTAAGGTAAGTTCGTTCTAGGTATTACAGTGAGGTATTTCAATT 
AACTCAGAATATGCAAGCTCGAGTTTAGTACACTATTATATTATGAATTG
>AT2G06510.1 |  RPA1A (REPLICATION PROTEIN A 1A) DNA binding / nucleic acid binding 
TTTTAAGCTTCTCCCGCAAAATTCAGCAAAGCTTTCGGAGGAATCTCCTAACAGTCACCA 
CCACCACCACCGTCTAGGTCAAATCTCGTCTTCCTCACGCTCTATTTCTCCATAGAATAT 
TTCCTAACTCCTCCTCCGGTTTATCGATTTTTTCAATTTTTCTAGGGTTTCGCGCCGGGA 
TCTAAAAAATCACAATCATGCCGGTGAGTTTGACTCCGAACGCAATCACGGCGATACATG 
ACGGCGACGTGAATTTGAAGCCGTTGTTACAGGTTTTAGAAATCAAAATGATAGGAAGAA 
GTCAAGAGAGAAGCCAGGAGAGGTATCGTTTCCTCATTTCAGATGGTGTTTCTGCTCAAC 
ATGCTATGGTCGCGGTTCAGCTTAATGATCGAGTCAAGTCAGGACAATTTGAGAAAGGAT 
CTATCGTTCAGCTGATTGATTACATTTGTAGCGACGTTAAAGGCCGCAAGTAATTTTTCC 
ATTTTCTCTCTGGTTAGATCTAGTTTTCGTTGTGTTGAATTGCTTAGTTTTCTAGTGATC 
TCTGATTTGTTGCTTAGTAATGTTTCTGAGTATTCGTGGCTATGTATTTGGTTTAGTATG 
TGTAAGGCATTTGTTACAATGAGTTTGCAGAAGCAATGATAGCTTCGCTTTTGGTAGAGA 
CCTTTCAATGAGGTTTCGTGTATTGATGAATGATTTTGGTTAACATGTACTAGTGGGAAA 
GATTTGTGTTGTTGTCTTTGTAGTTCATGGTATTTAATGGTTGGTAGGCAGATGTTAAGG 
ACAACATTTAGGATGATAATGGAGATGATTTTGTTGATTGTGTGAGTTGGAAAATATAGT 
TACACAATTGTTTTGGTTGAACATGACATATTTGAAGGAGTTTTGCTCTCTTTGATTGTG 
ATTTTCTTATGGATTTATTCATACTGTGTACAGGCTTATTGTGGTGCTGAACATGGAGAC 
GATAGTACAACAGTCTGAAACCATTGGGAACCCTACAATATTTGGAGAAACAGATACAGA 
AGCCCAGAAGACATTTTCAGGTACGGGCAATATACCGCCTCCGAACAGGGTTGTTTTTAA 
TGAACCAATGGTTCAGCATTCTGTTAATAGAGCACCTCCCAGGGGTGTAAACATTCAAAA 
TCAAGCCAACAATACTCCAAGCTTCAGGCCATCTGTTCAACCTTCATATCAACCGCCTGC 
AAGTTACAGAAATCATGGACCCATCATGAAGAACGAGGCTCCAGCTCGAGTCATCCCTAT 
TGCTGCTCTCAATCCATACCAAGGTCGATGGGCTATTAAGGCTAGAGTAACTGCGAAAGG 
AGATATCAGACGATATAACAATGCAAAAGGAGATGGAAAGGTTTTCTCGTTTGATCTGCT 
TGACTATGATGGAGGGGAGATTCGGGTTACGTGCTTTAATGCTCTTGTTGACCGTTTCTA 
TGATGTTACTGAGGTTGGTAAGGTATATTTGATTTCAAAGGGAAGTTTGAAGCCTGCACA 
GAAAAATTTCAACCACTTAAAGAATGAATGGGAAATTTTCTTGGAGTCAACATCGACTGT 
GGAGCTTTGCCCTGATGAAGATGGCTCCATACCAAAGCAGCAATTCTCCTTCCGCCCAAT 
AAGTGACATTGAGAACGCTGAGAACAATACCATACTCGATGTCATTGGTGTGGTGACTTC 
TGTGAACCCCTCGGTGCCAATCTTGAGAAAGAACGGGATGGAAACCCATAGGAGGATCCT 
GAATCTAAAGGATGAATCAGGAAAGGCTGTAGAGGTAACACTTTGGGGAGAATTCTGTAA 
CCGAGATGGTCGGCAACTGGAAGAGATGGTTGATTCAGCTTTTCACCCGGTTTTAGCAAT 
AAAAGCTGGAAAAGTAAGCGACTTCAGTGGGAAATCAGTAGGGACAATATCTTCAACACA 
GCTCTTCATAAATCCAGATTTCCCTGAAGCTCATAAACTACGGACCTGGTTCGATTACGG 
GGGAAAAGACACTGCTTCCTTCTCCATCTCCAGGGACACTATGCCTGGAGGAGTTTCCAG 
GAACGAGATAAGGAAAAATGTTTCTCAGATCAAAGAGGAAGGTCTTGGAAGATCAGATAA 
GCCTGACTGGATCACTGTGAAAGCAACCATATCATTCATCAAAACAGATAGCTTCTGTTA 
TACAGCTTGTCCTTTGATGATCGGGGATAAACAATGCAACAAGAAGGTTACACGGTCTGG 
AACAAACAGGTGGCTCTGTGACCGGTGCAACCAAGAGTCTGATGAATGCGACTATAGATA 
CCTTCTTCAGGTACAGATTCAAGACCACACTGGGTTGACTTGGATAACCGCGTTTCAAGA 
AACAGGAGAAGAAATAATGGGATGTCCGGCTAAGAAGCTTTACGCAATGAAATACGAATT 
GGAGAAGGAGGAAGAGTTCGCAGAGATTGTTAGAGACAGACTGTTTCATCAGTACATGTT 
GAAGCTGAAGATCAAAGAGGAATCGTATGGGGATGAACAAAGAGTGAAGATGACTGTTGT 
GAAGGTTGATAAGGTGAATTATACATCCGAGAGTAAATACATGCTTGATTTGCTCGTAAG 
GTAAGTTCGTTCTAGGTATTACAGTGAGGTATTTCAATTAACTCAGAATATGCAAGCTCG 
AGTTTAGTACACTATTATATTATGAATTG
>AT2G06510.1 |  RPA1A (REPLICATION PROTEIN A 1A) DNA binding / nucleic acid binding 
TTTTAAGCTTCTCCCGCAAAATTCAGCAAAGCTTTCGGAGGAATCTCCTAACAGTCACCA 
CCACCACCACCGTCTAGGTCAAATCTCGTCTTCCTCACGCTCTATTTCTCCATAGAATAT 
TTCCTAACTCCTCCTCCGGTTTATCGATTTTTTCAATTTTTCTAGGGTTTCGCGCCGGGA 
TCTAAAAAATCACAATCATGCCGGTGAGTTTGACTCCGAACGCAATCACGGCGATACATG 
ACGGCGACGTGAATTTGAAGCCGTTGTTACAGGTTTTAGAAATCAAAATGATAGGAAGAA 
GTCAAGAGAGAAGCCAGGAGAGGTATCGTTTCCTCATTTCAGATGGTGTTTCTGCTCAAC 
ATGCTATGGTCGCGGTTCAGCTTAATGATCGAGTCAAGTCAGGACAATTTGAGAAAGGAT 
CTATCGTTCAGCTGATTGATTACATTTGTAGCGACGTTAAAGGCCGCAAGTAATTTTTCC 
ATTTTCTCTCTGGTTAGATCTAGTTTTCGTTGTGTTGAATTGCTTAGTTTTCTAGTGATC 
TCTGATTTGTTGCTTAGTAATGTTTCTGAGTATTCGTGGCTATGTATTTGGTTTAGTATG 
TGTAAGGCATTTGTTACAATGAGTTTGCAGAAGCAATGATAGCTTCGCTTTTGGTAGAGA 
CCTTTCAATGAGGTTTCGTGTATTGATGAATGATTTTGGTTAACATGTACTAGTGGGAAA 
GATTTGTGTTGTTGTCTTTGTAGTTCATGGTATTTAATGGTTGGTAGGCAGATGTTAAGG 
ACAACATTTAGGATGATAATGGAGATGATTTTGTTGATTGTGTGAGTTGGAAAATATAGT 
TACACAATTGTTTTGGTTGAACATGACATATTTGAAGGAGTTTTGCTCTCTTTGATTGTG 
ATTTTCTTATGGATTTATTCATACTGTGTACAGGCTTATTGTGGTGCTGAACATGGAGAC 
GATAGTACAACAGTCTGAAACCATTGGGAACCCTACAATATTTGGAGAAACAGATACAGA 
AGCCCAGAAGACATTTTCAGGTACGGGCAATATACCGCCTCCGAACAGGGTTGTTTTTAA 
TGAACCAATGGTTCAGCATTCTGTTAATAGAGCACCTCCCAGGGGTGTAAACATTCAAAA 
TCAAGCCAACAATACTCCAAGCTTCAGGCCATCTGTTCAACCTTCATATCAACCGCCTGC 
AAGTTACAGAAATCATGGACCCATCATGAAGAACGAGGCTCCAGCTCGAGTCATCCCTAT 
TGCTGCTCTCAATCCATACCAAGGTCGATGGGCTATTAAGGCTAGAGTAACTGCGAAAGG 
AGATATCAGACGATATAACAATGCAAAAGGAGATGGAAAGGTTTTCTCGTTTGATCTGCT 
TGACTATGATGGAGGGGAGATTCGGGTTACGTGCTTTAATGCTCTTGTTGACCGTTTCTA 
TGATGTTACTGAGGTTGGTAAGGTATATTTGATTTCAAAGGGAAGTTTGAAGCCTGCACA 
GAAAAATTTCAACCACTTAAAGAATGAATGGGAAATTTTCTTGGAGTCAACATCGACTGT 
GGAGCTTTGCCCTGATGAAGATGGCTCCATACCAAAGCAGCAATTCTCCTTCCGCCCAAT 
AAGTGACATTGAGAACGCTGAGAACAATACCATACTCGATGTCATTGGTGTGGTGACTTC 
TGTGAACCCCTCGGTGCCAATCTTGAGAAAGAACGGGATGGAAACCCATAGGAGGATCCT 
GAATCTAAAGGATGAATCAGGAAAGGCTGTAGAGGTAACACTTTGGGGAGAATTCTGTAA 
CCGAGATGGTCGGCAACTGGAAGAGATGGTTGATTCAGCTTTTCACCCGGTTTTAGCAAT 
AAAAGCTGGAAAAGTAAGCGACTTCAGTGGGAAATCAGTAGGGACAATATCTTCAACACA 
GCTCTTCATAAATCCAGATTTCCCTGAAGCTCATAAACTACGGACCTGGTTCGATTACGG 
GGGAAAAGACACTGCTTCCTTCTCCATCTCCAGGGACACTATGCCTGGAGGAGTTTCCAG 
GAACGAGATAAGGAAAAATGTTTCTCAGATCAAAGAGGAAGGTCTTGGAAGATCAGATAA 
GCCTGACTGGATCACTGTGAAAGCAACCATATCATTCATCAAAACAGATAGCTTCTGTTA 
TACAGCTTGTCCTTTGATGATCGGGGATAAACAATGCAACAAGAAGGTTACACGGTCTGG 
AACAAACAGGTGGCTCTGTGACCGGTGCAACCAAGAGTCTGATGAATGCGACTATAGATA 
CCTTCTTCAGGTACAGATTCAAGACCACACTGGGTTGACTTGGATAACCGCGTTTCAAGA 
AACAGGAGAAGAAATAATGGGATGTCCGGCTAAGAAGCTTTACGCAATGAAATACGAATT 
GGAGAAGGAGGAAGAGTTCGCAGAGATTGTTAGAGACAGACTGTTTCATCAGTACATGTT 
GAAGCTGAAGATCAAAGAGGAATCGTATGGGGATGAACAAAGAGTGAAGATGACTGTTGT 
GAAGGTTGATAAGGTGAATTATACATCCGAGAGTAAATACATGCTTGATTTGCTCGTAAG 
GTAAGTTCGTTCTAGGTATTACAGTGAGGTATTTCAATTAACTCAGAATATGCAAGCTCG 
AGTTTAGTACACTATTATATTATGAATTG
>AT2G30110.1 |  ATUBA1 ubiquitin activating enzyme/ ubiquitin-protein ligase 
AATCTTAGAGATTTCTGCAAAATTCGTCACTTCAATTTCAATTTTCAGATCTCAAAAACT 
TTTTCTCTTTTCCGATTCCAATCTTCTCTCGTCTGCTTTCCTCAAAGGTACGTTTTATCT 
TCCTTCTCATAGCTTCCGAAGAATCAATCTAGGGTTAGGTATTTCAATTCTGATCGGATT 
TTCTCTCTTCAGTGTTCTCTAATCTAATGGGAATTTCACATGTTTTCTCCAGGTTTTTTC 
ATCACTTTATGCTTCACAAGCGAGCTAGTGAAGCTAACGATAAGAACGATAATACCATCA 
TCGGTTCCGATTTAGCATCATCTAAGAAACGCCGTATCGATTTCACTGAATCTTCGTCTG 
ATAAGTCTTCTTCGATTTTAGCTTCTGGTAGTAGCAGGGGTTTTCACGGCGATAGCGTCG 
TTCAGCAAATCGACATGGCTTTTGGTAATTCGAACCGTCAGGAGATTGATGAAGATCTGC 
ACAGTCGCCAGCTCGCCGTCTATGGTCGTGAGACTATGAGGCGTCTCTTTGCTTCCAATG 
TTCTCATCTCGGGGATGCACGGTCTTGGTGCCGAGATTGGTATGTACTTCATTGGTTTTA 
TGTTGAGATTGTGGTCTCCCTCGTCTCTTTGGTTTTTGAAACTTGTAGAAACACTGTTTT 
CGTATGCGTCGTTATTAGAAGCTGTGAATAATTGTGTCATCTTCAAAGATTTTACTCTTT 
AGTTGTTTTGTTTTGGTTCTCCTGATCTGTGATTGCTGGTATTCTTCAACATCCAAATCT 
TAGTAGCTTCCTGATGTTCCTTAGTTGTTCGATATCTTTGTTATTGGGGTTTCGTTATAT 
GCCAGTTTTCTAAGATGCATGGTAAATGTGAACTGTTAATGATACTTTTTAGTCGATTGC 
TTTCTCATTCAGTTTTTGTTTTATTTGTTGATTTTCTTCAGCCAAGAATCTTATACTTGC 
TGGTGTGAAGTCTGTGACCTTGCATGATGAAAGAGTTGTAGAGCTATGGGACTTATCAAG 
CAACTTTGTTTTCTCGGAGGATGATGTTGGCAAGAATAGAGCAGATGCTTCTGTTCAGAA 
GTTACAGGATCTTAACAATGCTGTGGTTGTCTCTAGCTTGACCAAAAGCTTAAACAAAGA 
GGATCTTTCTGGCTTCCAGGTTTGTAGACAACTCATTTGTCTTGTTATTGGTTCTATATG 
GTCTGAGTCTTTTGTGTACTGTATCGTTCTGTAGATTACTTGTGAGTTTATGATAACACT 
GTAACTGAATGAGTAACATAAGAGTGGGTTGTTCTATTTTCGTTGCATATAAGAGATGGG 
TTTTGTCTCATTTAGTGTTAGGCTATTTCTAGTGTTTATTGATATTGATATGGAAGATTG 
GTGTACACTTTTCTCATTGGTGTGTGTTTCTTGTTGGCGGGTTTTACGCTGATACATCTA 
CTTTTGTGCCAAACAGGTTGTTGTATTCTCTGACATAAGCATGGAAAGAGCAATCGAATT 
TGATGACTATTGTCACAGCCATCAGCCTCCTATCGCTTTTGTCAAGGCTGATGTCAGGGG 
TCTTTTCGGCTCTGTCTTTTGTGATTTTGGGCCTGAATTTGCGGTTCTTGATGTTGATGG 
AGAGGAACCCCATACAGGCATCATTGCGTCTATCTCTAATGAGAACCAGGCATTTATTTC 
CTGTGTCGACGATGAGAGGCTTGAGTTTGAAGATGGTGACCTAGTTGTTTTCTCAGAAGT 
TGAGGGTATGACAGAATTGAATGATGGGAAACCAAGGAAGATAAAAAGTACACGGCCATA 
TTCATTCACCCTTGATGAGGACACTACTAACTATGGAACATATGTGAAGGGTGGTATTGT 
CACTCAAGTGAAACAGCCAAAGTTACTGAATTTCAAGCCATTGAGGGAAGCGCTTAAGGA 
TCCAGGGGATTTTCTATTTAGTGATTTCTCTAAGTTTGATCGGCCTCCACTCCTTCACTT 
AGCATTCCAGGCACTTGATCATTTTAAAGCTGAAGCTGGCAGATTTCCTGTTGCTGGCTC 
AGAAGAGGACGCTCAGAAGCTTATATCGATTGCCACAGCCATCAATACCGGGCAGGGTGA 
TTTAAAGGTGGAGAATGTTGATCAGAAGCTTCTAAGACACTTTTCCTTTGGAGCCAAGGC 
TGTCCTGAATCCTATGGCTGCAATGTTTGGCGGTATTGTTGGACAGGAGGTTGTTAAAGC 
TTGCTCTGGAAAATTTCATCCTCTCTTCCAGGTAAAATTTCTTTTCTATAGACTTGTGAG 
AACACATATTTAGTCTTTGCATGCCAAGTTCTCTGTTCGAGTTAAGAATTTTAAACACTA 
GAATTTAAACTCAAAGCTCTCTTTTGTTAAAACCGAATCAAAGTAACAAGACAGAAGTTG 
AAATACACCCAAGAGTAATTAATTCCTAAGCTCTCTTCATCCCTATGTAATATATTAGAA 
GCTAAATGAAAGCTGTTTAGATAAAGTAAATAAAGAAATAGAAATTCTAATGAAAATAAG 
GAACATTATCTAATACGCATCTCTCCTTTTTCCTAATGTTTTATGTTGTGGGAAGTTACA 
GCTGTTTCCTCTTTTTTTGATACATTTATATTGTTTAAAGTTTCGTATTGGGATCTGATG 
TTGTGACTCTTTTTGTTTATCAGTTTTTCTACTTTGATTCAGTGGAGTCACTCCCCTCTG 
AACCTGTGGACTCGAGTGACTTTGCACCAAGAAACAGCCGGTATGATGCCCAAATATCTG 
TATTTGGGGCCAAGTTCCAGAAGAAACTTGAAGATGCTAAAGTTTTCACAGTAGGGTCTG 
GTGCTCTTGGCTGTGAGTTCTTGAAAAATTTGGCTCTGATGGGGGTTTCTTGTGGAAGCC 
AAGGGAAGCTGACAGTGACAGATGATGATATCATTGAGAAGAGTAACCTCAGTCGTCAAT 
TTCTGTTCCGTGACTGGAACATTGGACAGGCTAAATCCACAGTTGCTGCTTCGGCTGCTG 
CTGTTATAAATCCTCGCTTCAACATTGAGGCCCTGCAAAACCGTGTTGGCGCGGAGACTG 
AGAATGTATTTGACGATGCCTTCTGGGAGAACTTAACTGTTGTCGTCAATGCACTGGATA 
ATGTTAATGCGAGGCTCTATGTTGATTCGAGGTGCTTGTATTTCCAGAAGCCTCTCCTTG 
AGTCTGGAACTCTTGGTACAAAGTGCAACACACAGTCGGTTATCCCACATCTAACTGAAA 
ATTACGGTGCCTCAAGGGACCCACCAGAGAAACAGGCCCCCATGTGTACAGTGCATTCCT 
TCCCGCATAACATTGATCACTGTTTAACTTGGGCTCGCTCTGAGTTTGAGGGTCTGCTGG 
AGAAGACTCCCGCTGAAGTGAATGCATATCTTTCTAGCCCAGTTGAGTACACTAACTCAA 
TGATGAGTGCTGGTGATGCTCAGGCGAGGGACACATTGGAGAGGATTGTTGAGTGCCTTG 
AAAAGGAGAAGTGTGAGACCTTCCAAGACTGCTTAACCTGGGCACGACTGAGGTAATATC 
ACTCTTAATAGTTAGTTAGATAGTCTAGTCGTAATATGGAATGAAATATAGTCCGGTGTC 
TTACTCATGTCCTGCTACAGTCTCCTATTTTATGCTTTTGTCATGTGCTTCATCCCAGGA 
TTGCTTAATTATTCGTTGAAAACATCATTACGAAACTAAAAAATAAAATAAAAAACTAGG 
AACAGTGTTATAAGGTAACTTCATTTCACAACAGGTAGCTACAACCAATATGTAGAAGTG 
GGAATAAATCGTTTCCTTCCTCTGTGGAGTCTGTGATTTTTGCAATAATTTATGTGTTTG 
TTATGTTATGTGACTAGGTTTGAGGATTACTTTGTGAACCGTGTCAAGCAATTGATATAC 
ACATTTCCTGAAGATGCTGCGACTAGTACCGGAGCTCCATTCTGGTCTGCTCCAAAAAGA 
TTCCCTCGTCCACTCCAGTACTCGTCGTCCGACCCAAGTCTCCTTAACTTTATCACAGCG 
ACTGCTATTTTACGAGCAGAGACATTTGGGATCCCGATACCTGAGTGGACTAAGAACCCA 
AAGGAAGCAGCAGAAGCTGTTGACAGAGTGATAGTCCCAGACTTTGAGCCAAGGCAAGAT 
GCAAAGATTGTGACTGATGAGAAAGCTACCACTTTAACCACTGCTTCGGTGGACGACGCT 
GCAGTCATCGACGATCTCATTGCTAAGATCGACCAGTGTAGGCATAACTTGTCGCCAGAC 
TTCAGGATGAAACCTATTCAGTTCGAAAAGGTATATTACCCTCCAATGTTATCGTCTTCA 
CTGATATTGACTTGTCTTGTTTACAATTTTTAACTGAGTGTTGTCATTTTGAATTTGATG 
TGTTTGTAGGATGATGATACAAACTATCACATGGATGTGATAGCAGGACTAGCCAACATG 
AGGGCGAGAAATTACAGCATCCCTGAAGTGGACAAGCTGAAAGCAAAGTTCATAGCAGGG 
AGAATCATCCCAGCCATTGCGACTTCAACAGCCATGGCTACTGGGCTGGTCTGCCTCGAG 
CTGTACAAGGTCCTTGATGGAGGACATAAAGTGGAAGCTTACAGAAACACATTTGCCAAC 
CTGGCACTTCCACTATTCTCCATGGCTGAACCACTTCCACCAAAGGTGGTGAAGCACCGT 
GACATGGCTTGGACAGTTTGGGACAGATGGGTTCTCAAGGGAAACCCAACTCTTCGTGAG 
GTGTTGCAGTGGCTGGAGGACAAAGGGCTTAGCGCATACAGCATCTCTTGTGGAAGCTGT 
CTTCTGTTCAACAGTATGTTCACAAGGCACAAGGAGAGGATGGACAAGAAGGTTGTGGAT 
CTCGCTCGGGATGTTGCGAAAGTCGAGTTACCGCCTTATCGCAACCATCTTGATGTAGTG 
GTGGCTTGTGAGGATGAAGATGACAATGACGTCGATATTCCTCTCGTCTCTATCTACTTC 
AGGTGAAAAGTTTCGAGAGAATGAAGAAAGATGAAACTCTTGAGAGCAAATTTGTGTGTT 
TTGTCTCTGCATCTGCCCTACGTTATTATCTTTTGGATGCTTGTGGGTGAGATAACTGAT 
TTTTACTTGAGGGGGATAGAGACTCATTTTATCTCTCTCGTTCTATTTTAGTCTTTCTTT 
CTATGTACAATTGCTGAATGTGTGGTTTACACACCCGTTACCTTCTAAACATGTTCTATC 
AAACAAATCTTCGAGTTTTTCGGTTT
>AT3G58680.1 |  MBF1B (MULTIPROTEIN BRIDGING FACTOR 1B) DNA binding / transcription coactivator 
ATCTTCTTGTCTCTCTCTCATTTCTTGTTATTATCCACGAACGAAGAAAAACCTAGAAAA 
CAGTTGAAGAAAGAAAATCACAAGAGAAGCCATGGCCGGAATTGGACCGATTACTCAGGA 
TTGGGAACCAGTTGTGATCCGCAAGAGAGCTCCTAACGCTGCAGCTAAGCGCGACGAGAA 
GACTGTCAACGCCGCTCGTCGAAGCGGCGCCGATATTGAGACCGTTCGAAAATGTTTGTT 
TTCTTTCTTTCTCTATCTCCGTCTCTCTGATCTACCTTTGTAGCTTAAGTTGTGGGAGAA 
TATTTCTCTGGTTTAGGTTAAATTTGGCGATTGAATCTAGATGAGTTTTATTACGCTGTG 
TTTTAGTTTCCATGATTAGGGTTATTTGCCTTCGTCGCCGTCACTGGATTATTGTGGTTG 
TCTTAGAAGAGATCTGTGTTAGGTTTTCGCCTGTTGTGATTCGAATTTCGTTTGCTGCAG 
TAACAGTTCGTCCGATTTTACTTATGGATTCTTGTTCGTATCAGATTGATGTTTCTGTTT 
TGACATTTGAATATGCCTTTATCATTTTTTCTTTTTCGTGAAATCTCCTTTGTTCTATAT 
GAGTATTTCTAGTTGTTGCAAGTAATCATCTAACGAGATTTGTTGTTTTTGTTATTGCTG 
GGTTTAGTCAATGCTGGATCGAACAAGGCTGCATCAAGCGGCACCTCCTTGAACACAAAG 
AAGCTAGATGATGATACTGAGAACTTATCTCGTGAGTTATTCAATCTCTTTCTCAAGGTG 
TATTGATCTGATTTCTATATTGATATAGTAATGTTAGTATCTATCTCTATATCCCTTGGA 
CACAGTGGGTGAACTAGATTCTTAGGGTCTGTTTTCTTGCAATGTTTGAATTGTACTAGT 
GAGTGGAAGTCTTTTTTTGTTGATGGGTTATTGGGATGCCACGAGCTGATGCTTTATGTA 
CTATTTATCCGCAAATCACTGTGTTTTCCATATGTGTCTTAGATTGATTAGTAGTGTTGG 
TTATCTTTAACACCTTGGTTGTGTATGGTTTTGAAATCAGATGATCGTGTGCCCACTGAA 
TTGAAGAAAGCCATCATGCAAGCTAGAGGGGAGAAGAAGCTGACTCAGTCCCAACTTGCC 
CATGTACTTTCATTTTTCTCTGTATCTTTCTCTTTCTTTTACTGTCTTTCGTCAGTAATT 
GAATTCATTGTATGGGTTTTGATTCTGTAGCTGATCAATGAGAAGCCACAAGTGATCCAA 
GAATACGAGTCTGGGAAAGCAATTCCGAATCAACAGATCCTTTCAAAGCTGGAGAGGGCA 
CTTGGTGCTAAACTCCGTGGAAAGAAGTAGAAGTGTAGAACAAAGCTCTTAAAGGTAACA 
ACAAAAGCTGATCGCAGTTTCTCTCCAGTCCACATGCTTTACCATATCCTAAAAACTATA 
TCTATGTATGGTTTGGTTTAATGGCGTAGTAGTTTGTTGCGAGGAATCTTTCATGATGTA 
AGAAAAACAAAGCTGTTTGGAACCTTTTGTCATTATAAATAATCTCTTCTCTTTCTTTTT 
CGTCATGTCTCGTAAACTTTATCTGCCACGGATGTATGTTCTTAAAGAAATTGAAGATTG 
AAATTGATCAATTGCC
>AT3G47690.1 |  ATEB1A microtubule binding 
ATCTTTCCAGTTGCCGTTGCCAGCCGTTTCCTACTTGTGCTTTTTCACTTTTCCGTTCTC 
TCAAACCTTTTTTCTCTGCTTCCGTTTCGTTTCTCCGTTCAAAACAAGATCGAATCATAA 
AAAGTTTCCTCCTTTTTTTCTTCTCGAAACAAAAGAGAATTCTTGACGTCTTCTACTCCA 
TTTTCCATCAATACCCATTTCTTCTATCGCTCTCGTTTCCAAGAAAAAAGAGGGTTTTAG 
AGAGAAGCAAAACTCAAATGGCGACGAACATCGGAATGATGGATAGTGCATACTTCGTCG 
GAAGAAACGAGATTCTGACTTGGATTAATGATCGTCTTCACCTCAATCTCTCTCGCGTCG 
AAGAGGTACTTCTTGCTTGTTGGGGTTTTGTGTTCTATATCTTGCATGAGTGCTTTCTCT 
AATTCTTCTATGGTAATGTTTGATTTGGGAATTAGGGTTTTGAACTTCCAAGGAATTGTA 
GATTTGGGTTTGATTTGTTTCAATTGGCTAATGAGATTTGTAAGTTAATGTTGAGTTGAG 
TCTAATGAGAGTAGACAAAGGGCTTTAGGCTTTGGCATTGTATGATTGCTTACTTGTTTT 
GATTGTTATAATGTCATAGATTCACTGTTGTAGGGATCTAAAGAGTTCTACTAGTTTTGT 
ATTGAACTACTGTTCTTGAATGAAAATTTTGTGTCACTCTTGTCTTTGTTCTAAGTAAAC 
AATTATGGATTTTGCTAGGCTGCATCTGGTGCTGTGCAATGTCAGATGCTTGATATGACA 
TTTCCAGGAGTTGTGCCAATGCACAAGGTGATTTTGTCACTTTTATATTTATCTAATCTT 
ACGATCATTACTTTGCTTCTTGGTGACTGAATATCTGAAATTATCCTCTGCAAGGTTAAC 
TTTGATGCAAAGAACGAGTACGATATGATACAAAACTACAAGGTCTTGCAAGATGTGTTC 
AACAAGCTGAAAATTACAAAGGTAAATCAATCATCTCTCGATGTATCGTGTTCTTGTGAT 
ACCTGTGTGCTGTGTATATAGAGATTTCTGACCTTGTTTGTCTTACTGAGAAAACACCTC 
AGCCATTGGAAATTAACAGGCTTGTCAAAGGCCGGCCACTGGATAACTTGGAGTTTCTGC 
AATGGCTGAAACGTTTCTGTGATTCCATTAATGGTGGCATTATGAATGAGTATGTCAGAT 
TTTTTGTATTTGCTAATCGACCTCTATTGTTTTCCAAACAATTAAGTTTGTAAAATGTAT 
GGTCTCTTATAGGAACTATAATCCAGTGGAGCGAAGATCAAGAAATGGTAAAGAGAGGAG 
TGTGAAGGGATCTAATAAGATTCCAAAGTCACTGCAAACAAACAATAACCATCCTCCACC 
CAATTCCAGTTCAGTTGGTCTTAGCAAAGCATCAGGTCTGCCATTTGATAAACAGATTTT 
TCTATGCAAACAATAATAATTCTTGATTGCATTTTTCTTAACATGTTGGTATCATCATAA 
TTCTCAGGGCCCAAGTCAGCAAAAGCAGCTGAAGTGCAGGCTTTGTCGAAGGAGGTACAT 
TGACATAGAGACCATCGCTCTTAGTTTTCACCTATCCTCTAATGAACGAAACATCCATCA 
TATGTCATATATAATCCTTTTTCATCTTCTGTGATACAGCTCGTGGATCTCAAGATCTCT 
ACTGATCTCTTGGAAAAAGAAAGAGACTTTTACTTCTCCAAGCTCCGGGATGTAGAGATA 
CTCTGCCAAACTCCTGAGCTAGATGATCTTCCGGTAAACGTTTCCGTAGAGCCTGTTCTT 
TTTTTTTTTTTTAATCTTGTTTAAGTGTACCTTGCATGGTATAGCCACCAACTTCACTAT 
TTAGCTCCAAGACAAGTTTTCCAATAGTCTAGAACCAGAATTTAGTTTACCGGCTGTTAT 
AAGTACACATACCGTTCTTAGAATTAAGAGGAAGATAAAGAGCTCTTACCAATGAACTCC 
TCATAGCACCACCAGATTTCATCAGCGACCGCATTTTATGTTTTTCATCATATGAACTCA 
ACTTTATGAACATAATTTTGTTTGAATCTGATATATATGCTTCCCTGGAATGCAGATAGT 
GGTAGCAGTGAAGAAGATACTGTATGCAACCGATGCAAATGAATCTGCATTAGAAGACGC 
TCAAGAGTACCTAAACCAGTCCCTAGGAGTTGAAGATGATGAAGCTGAAGGAAACGGAGA 
ACAACTGGAAGAAGAAAAGACTCAAGCCTAAGCTCTGACTATTAACAATCCTAAGTAGAA 
GGGTGACGAACAATGGCTGGCCATGGCCTTCTCTTCCAAGTTTCTTTTGTGAAAGGAAAC 
TAACTGAAACTTGAAGATGAATGAGCTTCTTCTATTAGAAAGATTAGTTTGAAAACAAAG 
AGACTTATTTTTGTTACTATTCAAGAGGCTTTTTTCTTGTTTTAAAACAATACTTTGACC 
CAAAGTGAGAATTTAAGTGTCGGTGCTTCCT
>AT2G37560.1 |  ORC2 (ORIGIN RECOGNITION COMPLEX SECOND LARGEST SUBUNIT 2) DNA replication origin binding / protein binding 
GGAATCTGATTCATATGTTTGGGGTTTAATAGTCTCAGCTCAAATAAATCTAGGTTAAAC 
TGTGTGGATCGATTCATATATTCTCCGTCAAAACCAAAACCAAACCGATTTGTCATAATT 
TTTTCTTATCATCCACTTTCATTGGCTAGAGGGACATTGTAACGGTGTCGTCGTCGCCAA 
ACGATTTGCCTCTTCCTAAAGGTATGTTCTTTCATTTCTCTCAGTGCCCCTTTGCGTATT 
TCAGCTTCTTCTTTACGATCTAATTCATTTCTATGTTTCGTTTGATTCTTTGTTCAATTC 
TGAATTGAGAAAATGGCGATTCGAGATCTATCTTTTCGGTTTTTCATGTAAGAATATAAT 
CTAGCTTTGGTGTTTGTATTGGTTTACTTGTGGGAAGAAAAGTCTTTCTCTTTGGGACTT 
TAAACTTTAATTACTTAACTCCAACATCATCATAGTTGGGTTCTGTTTGCGAGATTCATT 
CTGTTTAGTTCAGTTCTCTTATAGCAGCAATAACATATTGATTGATGGCATCAATCTTGT 
GATGGAACCATGGGAATTCAGAGTTCAGGGAGGATTGATTAATTAGAATCTCATATTTAT 
GAGAGAATAAGAGAACTGATGTGTGTTTCTTTTCCTATGTATGTTGTGCACTTTCCTATT 
TCTATAAGCTCTTCAGGATAACAACAGTTGATTGGGTCTGAATTACCGTGTGTTAAAGTG 
TGTTTTCGGAATTACCGTAATTCCCCTTCTGTGTAGCTTTTGGCGATTGGGTCTGATCCA 
ATTCTTACCAGCTTCATACCATTGTTCAAAGTGAAAACAGAAATAGTGTTGATTCTCTTA 
TTACTGTTGTCTCAGGAGATTCTTTCCTACATAGGAATTGAGTTTAAGGTGGAATTCTTC 
TGTTATTTTGTTGTTGCACGAAAATGGAGGACATTGAGAACATAGAAGAAGATGAGTATG 
GGTTTTCAAGAAACTACTTCTTGGCAAAAGAATTGGGTGGGGCGAGTAAGCGTTCTGCCC 
ACAAGCTCTCTGATATACATATTGTTGATGAGCAGGTGAGTTTTGTTGGGTATGCTCTTT 
TAAATTATGCTTTTGGTAATAGATACTTTCCTTGACAAGTTGATGGAGAAGCATTGTGTG 
TTTACAGGAGCTTAGAGAAACGGCTTCTACAATTGAAATGAAGCACTCGAAAGAGATATC 
TGAGCTTATGAGTGATTACAAGACTATGTACTCAAAGTGGGTCTTTGAGCTCAGGTGAGA 
AAAGCTCTTACTTTTGAAGCTAGAACCTGAATATTTTAGTTTGTCTATATACTTCTGGTG 
TTCTCAATTCTTGTTGCTGCTTCCAGGTGTGGCTTTGGCCTTCTAATGTATGGCTTTGGA 
TCTAAGAAAGCTTTAGTTGAAGATTTTGCTTCTGCTTCTTTGACTGACTATTCTGTTGTG 
GTCATCAATGGCTACCTCCCTTCCGTAAATCTAAAGCAGGTACTCTTTTGTCAGTTTGGA 
TGCAGCAATTTTTTCTCTTGCGCAGCTCTATGTTCTTCAGGTTGGAAAAGAAGTAGTTTT 
AAATGATGACTAATTGTTCTTTTCTGTGTTGCAAATTTAGGTTCTTTTGGCATTAGCTGA 
ACTTCTATCCGAGCTTTTGAAATGTAAAAGAAAGAGTTCCGGGAGTTTGTCTAAAGGTCA 
AGAAACATTTCCTTCACGCTCCATGGATGATATTCTTTCCTTTCTACATGGTCCACAGTC 
TGGAGATAAAGACTGCTTCATATGCGTTGTTGTTCATAACATTGACGGCCCTGCTCTAAG 
AGATCCCGAATCACAACAAACTCTTGCCCGGCTTTCTTCTTGTTCACACATACGCTTGGT 
TGCCTCTATTGACCATGTCAACGCTCCATTATGTAAGCACTATTCTCTATCTCTCCTGCT 
AATTGCTTATCATGGCTGAGGTCTATTGCAAAAAAATTCTGTTCACTGCTATCTGTCAAA 
GACTTCTAAGACCTTATGTACTGCTTATTTGACCTGAGGCTATGTTTCTTGTGTCCATTG 
GCAGTGTGGGACAAGAAAATGGTGCACAAACAGTTTAACTGGCTATGGCACCATGTTCCA 
ACATTTGCACCATACAATGTCGAAGGTGTATTCTTCCCGTTGGTTCTTGCACAGGGAAGC 
ACAGCCCAAACCGCCAAAACAGCAGCCATTGTTTTACAGAGTTTAACACCAAACGGTCAG 
AATGTCTTCAAGATTCTTGCTGAGTACCAACTTTCACACCCAGATGAAGATGGGATGCCC 
ACTGATGATCTGTATTCAGCGTCTCGGGAACGCTTCTTTGTGAGCAGTCAAGTGACTTTA 
AACTCTCATCTCACGGAATTTAAAGACCACGAACTGGTTAAGACCAAGAGAAACTCCGAT 
GGTCAAGAGTGTTTGAATATACCGCTCACTTCGGATGCAATTCGACAGCTTTTGCTTGAT 
CTCAATCAGTAGCCTGAAATTGTATTTCTGATATGATTCATTTTTATTGCTTGAACGAGT 
TATTATAGTTCACACAGTTTACATGTTTAATTGAATGTTATAGTCAGCACTCACAGCTCT 
TATTATATAATCATGGTGTGGTAGTACTATCAGAGATC
>AT2G37560.1 |  ORC2 (ORIGIN RECOGNITION COMPLEX SECOND LARGEST SUBUNIT 2) DNA replication origin binding / protein binding 
GGAATCTGATTCATATGTTTGGGGTTTAATAGTCTCAGCTCAAATAAATCTAGGTTAAAC 
TGTGTGGATCGATTCATATATTCTCCGTCAAAACCAAAACCAAACCGATTTGTCATAATT 
TTTTCTTATCATCCACTTTCATTGGCTAGAGGGACATTGTAACGGTGTCGTCGTCGCCAA 
ACGATTTGCCTCTTCCTAAAGGTATGTTCTTTCATTTCTCTCAGTGCCCCTTTGCGTATT 
TCAGCTTCTTCTTTACGATCTAATTCATTTCTATGTTTCGTTTGATTCTTTGTTCAATTC 
TGAATTGAGAAAATGGCGATTCGAGATCTATCTTTTCGGTTTTTCATGTAAGAATATAAT 
CTAGCTTTGGTGTTTGTATTGGTTTACTTGTGGGAAGAAAAGTCTTTCTCTTTGGGACTT 
TAAACTTTAATTACTTAACTCCAACATCATCATAGTTGGGTTCTGTTTGCGAGATTCATT 
CTGTTTAGTTCAGTTCTCTTATAGCAGCAATAACATATTGATTGATGGCATCAATCTTGT 
GATGGAACCATGGGAATTCAGAGTTCAGGGAGGATTGATTAATTAGAATCTCATATTTAT 
GAGAGAATAAGAGAACTGATGTGTGTTTCTTTTCCTATGTATGTTGTGCACTTTCCTATT 
TCTATAAGCTCTTCAGGATAACAACAGTTGATTGGGTCTGAATTACCGTGTGTTAAAGTG 
TGTTTTCGGAATTACCGTAATTCCCCTTCTGTGTAGCTTTTGGCGATTGGGTCTGATCCA 
ATTCTTACCAGCTTCATACCATTGTTCAAAGTGAAAACAGAAATAGTGTTGATTCTCTTA 
TTACTGTTGTCTCAGGAGATTCTTTCCTACATAGGAATTGAGTTTAAGGTGGAATTCTTC 
TGTTATTTTGTTGTTGCACGAAAATGGAGGACATTGAGAACATAGAAGAAGATGAGTATG 
GGTTTTCAAGAAACTACTTCTTGGCAAAAGAATTGGGTGGGGCGAGTAAGCGTTCTGCCC 
ACAAGCTCTCTGATATACATATTGTTGATGAGCAGGTGAGTTTTGTTGGGTATGCTCTTT 
TAAATTATGCTTTTGGTAATAGATACTTTCCTTGACAAGTTGATGGAGAAGCATTGTGTG 
TTTACAGGAGCTTAGAGAAACGGCTTCTACAATTGAAATGAAGCACTCGAAAGAGATATC 
TGAGCTTATGAGTGATTACAAGACTATGTACTCAAAGTGGGTCTTTGAGCTCAGGTGAGA 
AAAGCTCTTACTTTTGAAGCTAGAACCTGAATATTTTAGTTTGTCTATATACTTCTGGTG 
TTCTCAATTCTTGTTGCTGCTTCCAGGTGTGGCTTTGGCCTTCTAATGTATGGCTTTGGA 
TCTAAGAAAGCTTTAGTTGAAGATTTTGCTTCTGCTTCTTTGACTGACTATTCTGTTGTG 
GTCATCAATGGCTACCTCCCTTCCGTAAATCTAAAGCAGGTACTCTTTTGTCAGTTTGGA 
TGCAGCAATTTTTTCTCTTGCGCAGCTCTATGTTCTTCAGGTTGGAAAAGAAGTAGTTTT 
AAATGATGACTAATTGTTCTTTTCTGTGTTGCAAATTTAGGTTCTTTTGGCATTAGCTGA 
ACTTCTATCCGAGCTTTTGAAATGTAAAAGAAAGAGTTCCGGGAGTTTGTCTAAAGGTCA 
AGAAACATTTCCTTCACGCTCCATGGATGATATTCTTTCCTTTCTACATGGTCCACAGTC 
TGGAGATAAAGACTGCTTCATATGCGTTGTTGTTCATAACATTGACGGCCCTGCTCTAAG 
AGATCCCGAATCACAACAAACTCTTGCCCGGCTTTCTTCTTGTTCACACATACGCTTGGT 
TGCCTCTATTGACCATGTCAACGCTCCATTATGTAAGCACTATTCTCTATCTCTCCTGCT 
AATTGCTTATCATGGCTGAGGTCTATTGCAAAAAAATTCTGTTCACTGCTATCTGTCAAA 
GACTTCTAAGACCTTATGTACTGCTTATTTGACCTGAGGCTATGTTTCTTGTGTCCATTG 
GCAGTGTGGGACAAGAAAATGGTGCACAAACAGTTTAACTGGCTATGGCACCATGTTCCA 
ACATTTGCACCATACAATGTCGAAGGTGTATTCTTCCCGTTGGTTCTTGCACAGGGAAGC 
ACAGCCCAAACCGCCAAAACAGCAGCCATTGTTTTACAGAGTTTAACACCAAACGGTCAG 
AATGTCTTCAAGATTCTTGCTGAGTACCAACTTTCACACCCAGATGAAGATGGGATGCCC 
ACTGATGATCTGTATTCAGCGTCTCGGGAACGCTTCTTTGTGAGCAGTCAAGTGACTTTA 
AACTCTCATCTCACGGAATTTAAAGACCACGAACTGGTTAAGACCAAGAGAAACTCCGAT 
GGTCAAGAGTGTTTGAATATACCGCTCACTTCGGATGCAATTCGACAGCTTTTGCTTGAT 
CTCAATCAGTAGCCTGAAATTGTATTTCTGATATGATTCATTTTTATTGCTTGAACGAGT 
TATTATAGTTCACACAGTTTACATGTTTAATTGAATGTTATAGTCAGCACTCACAGCTCT 
TATTATATAATCATGGTGTGGTAGTACTATCAGAGATC
>AT2G37560.2 |  ORC2 (ORIGIN RECOGNITION COMPLEX SECOND LARGEST SUBUNIT 2) DNA replication origin binding / protein binding 
ATCTGATTCATATGTTTGGGGTTTAATAGTCTCAGCTCAAATAAATCTAGGTTAAACTGT 
GTGGATCGATTCATATATTCTCCGTCAAAACCAAAACCAAACCGATTTGTCATAATTTTT 
TCTTATCATCCACTTTCATTGGCTAGAGGGACATTGTAACGGTGTCGTCGTCGCCAAACG 
ATTTGCCTCTTCCTAAAGGTATGTTCTTTCATTTCTCTCAGTGCCCCTTTGCGTATTTCA 
GCTTCTTCTTTACGATCTAATTCATTTCTATGTTTCGTTTGATTCTTTGTTCAATTCTGA 
ATTGAGAAAATGGCGATTCGAGATCTATCTTTTCGGTTTTTCATGTAAGAATATAATCTA 
GCTTTGGTGTTTGTATTGGTTTACTTGTGGGAAGAAAAGTCTTTCTCTTTGGGACTTTAA 
ACTTTAATTACTTAACTCCAACATCATCATAGTTGGGTTCTGTTTGCGAGATTCATTCTG 
TTTAGTTCAGTTCTCTTATAGCAGCAATAACATATTGATTGATGGCATCAATCTTGTGAT 
GGAACCATGGGAATTCAGAGTTCAGGGAGGATTGATTAATTAGAATCTCATATTTATGAG 
AGAATAAGAGAACTGATGTGTGTTTCTTTTCCTATGTATGTTGTGCACTTTCCTATTTCT 
ATAAGCTCTTCAGGATAACAACAGTTGATTGGGTCTGAATTACCGTGTGTTAAAGTGTGT 
TTTCGGAATTACCGTAATTCCCCTTCTGTGTAGCTTTTGGCGATTGGGTCTGATCCAATT 
CTTACCAGCTTCATACCATTGTTCAAAGTGAAAACAGAAATAGTGTTGATTCTCTTATTA 
CTGTTGTCTCAGGAGATTCTTTCCTACATAGGAATTGAGTTTAAGGTGGAATTCTTCTGT 
TATTTTGTTGTTGCACGAAAATGGAGGACATTGAGAACATAGAAGAAGATGAGTATGGGT 
TTTCAAGAAACTACTTCTTGGCAAAAGAATTGGGTGGGGCGAGTAAGCGTTCTGCCCACA 
AGCTCTCTGATATACATATTGTTGATGAGCAGGTGAGTTTTGTTGGGTATGCTCTTTTAA 
ATTATGCTTTTGGTAATAGATACTTTCCTTGACAAGTTGATGGAGAAGCATTGTGTGTTT 
ACAGGAGCTTAGAGAAACGGCTTCTACAATTGAAATGAAGCACTCGAAAGAGATATCTGA 
GCTTATGAGTGATTACAAGACTATGTACTCAAAGTGGGTCTTTGAGCTCAGGTGAGAAAA 
GCTCTTACTTTTGAAGCTAGAACCTGAATATTTTAGTTTGTCTATATACTTCTGGTGTTC 
TCAATTCTTGTTGCTGCTTCCAGGTGTGGCTTTGGCCTTCTAATGTATGGCTTTGGATCT 
AAGAAAGCTTTAGTTGAAGATTTTGCTTCTGCTTCTTTGACTGACTATTCTGTTGTGGTC 
ATCAATGGCTACCTCCCTTCCGTAAATCTAAAGCAGGTACTCTTTTGTCAGTTTGGATGC 
AGCAATTTTTTCTCTTGCGCAGCTCTATGTTCTTCAGGTTGGAAAAGAAGTAGTTTTAAA 
TGATGACTAATTGTTCTTTTCTGTGTTGCAAATTTAGGTTCTTTTGGCATTAGCTGAACT 
TCTATCCGAGCTTTTGAAATGTAAAAGAAAGAGTTCCGGGAGTTTGTCTAAAGGTCAAGA 
AACATTTCCTTCACGCTCCATGGATGATATTCTTTCCTTTCTACATGGTCCACAGTCTGG 
AGATAAAGACTGCTTCATATGCGTTGTTGTTCATAACATTGACGGCCCTGCTCTAAGAGA 
TCCCGAATCACAACAAACTCTTGCCCGGCTTTCTTCTTGTTCACACATACGCTTGGTTGC 
CTCTATTGACCATGTCAACGCTCCATTATGTAAGCACTATTCTCTATCTCTCCTGCTAAT 
TGCTTATCATGGCTGAGGTCTATTGCAAAAAAATTCTGTTCACTGCTATCTGTCAAAGAC 
TTCTAAGACCTTATGTACTGCTTATTTGACCTGAGGCTATGTTTCTTGTGTCCATTGGCA 
GTGTGGGACAAGAAAATGGTGCACAAACAGTTTAACTGGCTATGGCACCATGTTCCAACA 
TTTGCACCATACAATGTCGAAGGTGTATTCTTCCCGTTGGTTCTTGCACAGGGAAGCACA 
GCCCAAACCGCCAAAACAGCAGCCATTGTTTTACAGAGTTTAACACCAAACGGTCAGAAT 
GTCTTCAAGATTCTTGCTGAGTACCAACTTTCACACCCAGATGAAGATGGGATGCCCACT 
GATGATCTGTATTCAGCGTCTCGGGAACGCTTCTTTGTGAGCAGTCAAGTGACTTTAAAC 
TCTCATCTCACGGAATTTAAAGACCACGAACTGGTTAAGACCAAGAGAAACTCCGATGGT 
CAAGAGTGTTTGAATATACCGCTCACTTCGGATGCAATTCGACAGCTTTTGCTTGATCTC 
AATCAGTAGCCTGAAATTGTATTTCTGATATGATTCATTTTTATTGCTTGAACGAGTTAT 
TATAGTTCACACAGTTTACATGTTTAATTGAATGTTATAGTCAGCACTCACAGCTCTTAT 
TATATAATCATGGTGTGGTAGTACTATCAGAGATC
>AT2G37560.2 |  ORC2 (ORIGIN RECOGNITION COMPLEX SECOND LARGEST SUBUNIT 2) DNA replication origin binding / protein binding 
ATCTGATTCATATGTTTGGGGTTTAATAGTCTCAGCTCAAATAAATCTAGGTTAAACTGT 
GTGGATCGATTCATATATTCTCCGTCAAAACCAAAACCAAACCGATTTGTCATAATTTTT 
TCTTATCATCCACTTTCATTGGCTAGAGGGACATTGTAACGGTGTCGTCGTCGCCAAACG 
ATTTGCCTCTTCCTAAAGGTATGTTCTTTCATTTCTCTCAGTGCCCCTTTGCGTATTTCA 
GCTTCTTCTTTACGATCTAATTCATTTCTATGTTTCGTTTGATTCTTTGTTCAATTCTGA 
ATTGAGAAAATGGCGATTCGAGATCTATCTTTTCGGTTTTTCATGTAAGAATATAATCTA 
GCTTTGGTGTTTGTATTGGTTTACTTGTGGGAAGAAAAGTCTTTCTCTTTGGGACTTTAA 
ACTTTAATTACTTAACTCCAACATCATCATAGTTGGGTTCTGTTTGCGAGATTCATTCTG 
TTTAGTTCAGTTCTCTTATAGCAGCAATAACATATTGATTGATGGCATCAATCTTGTGAT 
GGAACCATGGGAATTCAGAGTTCAGGGAGGATTGATTAATTAGAATCTCATATTTATGAG 
AGAATAAGAGAACTGATGTGTGTTTCTTTTCCTATGTATGTTGTGCACTTTCCTATTTCT 
ATAAGCTCTTCAGGATAACAACAGTTGATTGGGTCTGAATTACCGTGTGTTAAAGTGTGT 
TTTCGGAATTACCGTAATTCCCCTTCTGTGTAGCTTTTGGCGATTGGGTCTGATCCAATT 
CTTACCAGCTTCATACCATTGTTCAAAGTGAAAACAGAAATAGTGTTGATTCTCTTATTA 
CTGTTGTCTCAGGAGATTCTTTCCTACATAGGAATTGAGTTTAAGGTGGAATTCTTCTGT 
TATTTTGTTGTTGCACGAAAATGGAGGACATTGAGAACATAGAAGAAGATGAGTATGGGT 
TTTCAAGAAACTACTTCTTGGCAAAAGAATTGGGTGGGGCGAGTAAGCGTTCTGCCCACA 
AGCTCTCTGATATACATATTGTTGATGAGCAGGTGAGTTTTGTTGGGTATGCTCTTTTAA 
ATTATGCTTTTGGTAATAGATACTTTCCTTGACAAGTTGATGGAGAAGCATTGTGTGTTT 
ACAGGAGCTTAGAGAAACGGCTTCTACAATTGAAATGAAGCACTCGAAAGAGATATCTGA 
GCTTATGAGTGATTACAAGACTATGTACTCAAAGTGGGTCTTTGAGCTCAGGTGAGAAAA 
GCTCTTACTTTTGAAGCTAGAACCTGAATATTTTAGTTTGTCTATATACTTCTGGTGTTC 
TCAATTCTTGTTGCTGCTTCCAGGTGTGGCTTTGGCCTTCTAATGTATGGCTTTGGATCT 
AAGAAAGCTTTAGTTGAAGATTTTGCTTCTGCTTCTTTGACTGACTATTCTGTTGTGGTC 
ATCAATGGCTACCTCCCTTCCGTAAATCTAAAGCAGGTACTCTTTTGTCAGTTTGGATGC 
AGCAATTTTTTCTCTTGCGCAGCTCTATGTTCTTCAGGTTGGAAAAGAAGTAGTTTTAAA 
TGATGACTAATTGTTCTTTTCTGTGTTGCAAATTTAGGTTCTTTTGGCATTAGCTGAACT 
TCTATCCGAGCTTTTGAAATGTAAAAGAAAGAGTTCCGGGAGTTTGTCTAAAGGTCAAGA 
AACATTTCCTTCACGCTCCATGGATGATATTCTTTCCTTTCTACATGGTCCACAGTCTGG 
AGATAAAGACTGCTTCATATGCGTTGTTGTTCATAACATTGACGGCCCTGCTCTAAGAGA 
TCCCGAATCACAACAAACTCTTGCCCGGCTTTCTTCTTGTTCACACATACGCTTGGTTGC 
CTCTATTGACCATGTCAACGCTCCATTATGTAAGCACTATTCTCTATCTCTCCTGCTAAT 
TGCTTATCATGGCTGAGGTCTATTGCAAAAAAATTCTGTTCACTGCTATCTGTCAAAGAC 
TTCTAAGACCTTATGTACTGCTTATTTGACCTGAGGCTATGTTTCTTGTGTCCATTGGCA 
GTGTGGGACAAGAAAATGGTGCACAAACAGTTTAACTGGCTATGGCACCATGTTCCAACA 
TTTGCACCATACAATGTCGAAGGTGTATTCTTCCCGTTGGTTCTTGCACAGGGAAGCACA 
GCCCAAACCGCCAAAACAGCAGCCATTGTTTTACAGAGTTTAACACCAAACGGTCAGAAT 
GTCTTCAAGATTCTTGCTGAGTACCAACTTTCACACCCAGATGAAGATGGGATGCCCACT 
GATGATCTGTATTCAGCGTCTCGGGAACGCTTCTTTGTGAGCAGTCAAGTGACTTTAAAC 
TCTCATCTCACGGAATTTAAAGACCACGAACTGGTTAAGACCAAGAGAAACTCCGATGGT 
CAAGAGTGTTTGAATATACCGCTCACTTCGGATGCAATTCGACAGCTTTTGCTTGATCTC 
AATCAGTAGCCTGAAATTGTATTTCTGATATGATTCATTTTTATTGCTTGAACGAGTTAT 
TATAGTTCACACAGTTTACATGTTTAATTGAATGTTATAGTCAGCACTCACAGCTCTTAT 
TATATAATCATGGTGTGGTAGTACTATCAGAGATC
>AT3G12280.1 |  RBR1 (RETINOBLASTOMA-RELATED 1) transcription factor binding 
TATCCTTTTTTAGGGTTTGCCGCATAATCAGACCCCATTCTAGAGAGAGAAGAGGGAAGT 
CAGGTGAAGATAGAGAGAGACACTGAGAGGAGGGAAAATTTGTAGGGTTTTCGGAGATCT 
CTGTGATTCCTCTGAATTTGTCGAATTTTTTGGAGGAGGCGTTAGAAGTCGGGCTTCTTA 
AAAATCAGATCTTCTGCTCAGGCTTTAATCGGCGACGTCTGGTATTGGGATCTGTGACAC 
AAAAAGGTAAGATCTTTCTCTATTGCCTATCCTTTGATTTGAAATCTTATCCTCTAGGTG 
GTTTATCTGAAATTTTCTATTGATATTTCGCTATTCGATTGTAAGTTGGTGAGAGAATTC 
TCCAAAAACAAAAAAGAGAAAAACTTTGAATGAATATTTAAGATAACATCTGGGTAAAAT 
TTTTCCGGAGTGGTGGGTTTTAGATTATGCCCCAATTTCTCTTCTTTTTTTCCCCCAAAT 
TTTGTCTTTCTGCCATGTTTTGGGAAATTGGGAGTTTGTTTTCTCATGTCTGTTAGTGTG 
TTCTTCCGAATGGGTTGGGCATGGTTCCTATTGAATTTCAGTGTGATTAAATTAACAAAT 
CTCTTTGCTTGAAAAGTCCCTTTTTCTTCGTCTTCAGTTAGCAGTTTAATTGGAAGTAAA 
ATTAGCTTGATTTTGCATGTTTTCAGCTGCGTTGGAGACTATGGAAGAAGTTCAGCCTCC 
AGTGACCCCGCCCATTGAACCAAATGGGAAAAGAAGCGAAGCCTCTCTCTTGGACATATG 
CGAGGTTTACTCTTCTCTTTGCTGATCTAGTTGCATTTGTTTAGTTGAAGATACCATTTG 
AGTTCTCTCGGAAATTTTGAGGACTAGCTCTAATCCCTGTAGTTGATTTCTTATTGCAGA 
AAGTTCTGTCTCTTGATGGGAGCACTTGCGATGAAGCTTTGAAGTTGTTTACAGAAACCA 
AACGAATTTTGTCAGCAAGCATGTCTAACATTGGAAGTGGAACGGTGAAATACATTTTTC 
CTCTAACTTCTCTTTTATCAGTTAACTGTGGTTTCATTATGACTAAATCCTTTTTTCTTC 
TTCTTATTAGCGGGAAGAAGTAGAGAGGTTCTGGTTTGCGTTTATTCTCTATTCAGTGAA 
GAGGCTTAGTGTGAGAAAAGAAGCGGATGGTCTGTCAGTGTCTGGTGATAATGAGTTTAA 
TCTATGTCAGATACTGAGGGCTCTGAAGCTAAAGTAAGTAGTGTTCAATTCTTCCTTCCT 
TGTCATTCTTAAATTCATTTGTAGTGACGATTTTCCTCTTTTCTGTTTATAGTATTGTGG 
ATTTTTTTAAAGAGTTACCTCAGTTTGTGGTCAAGGCTGGATCTGTACTGGGTGAACTTT 
ACGGCGCAGACTGGGAGAACAGACTTCAGGTTTTGACTAACATCTTTTAAATATACTTCT 
ACTTCTATTATATCATTGTTAAATATGCTTCTATTAACTAATTTTTACTTACTAGGCAAA 
GGAGGTGCAGGCTAACTTTGTGCATCTTAGCCTTCTAAGCAAGTGAGTTTAGCTCCCTTC 
CTATTTTACATTTATCTTTGTTTTGTGTAAGAATAGTTATTGACATAGATTTCATATTTT 
GGACCTGCAACTTAGAAGCAAATTTTCTTCCTATGCAATAATCAGAATATGGGCTTGCAA 
TATTCCTTCAATTTTAAATTAATTAAGATTTAGAGTTACAGATTTCTGGTTTTCATGTGA 
TTATATTCTGTGAATTGTTTTAAGGACATGTTAAAGTATGATGTTTTTGGTACCTTTCCT 
TGGTAACAGATACTACAAACGTGGGTTCCGGGAATTCTTTTTGACATATGATGCAAACGC 
AGAAAAGAACTCAGCAAACTCTTCTACCTATTTGCTGGATAGTTATCGTTTTGGATGGCT 
ACTCTTTTTGGCACTCCGAAACCATGCGTTTAGTCGATTTAAGGACCTCGTGACATGCTC 
AAATGGCGTAGTTTCTATATTGGTTAGTGACTACCTGTGGAGCTCTCCCTAATCTTTCAT 
TCATTTTAGTCTTGCTGTACATTATTACTTGAAAGATGCTTCGTTTAATATAACGCAATT 
GAAGTATAGGCTAACTCCTTTTCATGTTATCAGGCTATTTTGATCATACATGTTCCTTGT 
CGGTTTAGAAATTTCAGCATCCAAGATTCTTCTCGCTTTGGTGAGTGTTTATCTTTTCTT 
CTATCCCGATAACCATGGCACCATAGAATGTTTATCATCTATTTTCATTTATGTGATGAA 
TCTCAGTTAAGAAAGGTGACAAAGGTGTAGACTTGGTTGCATCACTTTGCAAGATATATG 
ACGCCTCAGAAGATGAGTTGAGGATAGTAATTGACAAGGCAAATAATTTGGTAGAAACCA 
TACTGAAGAAAAAGCCATCTCCAGCATCTGAGTGCCAAACTGACAAGCTAGATAATATTG 
ACCCAGGTTGGTCTAAAATCATTTTCCTTCTTCAATTAAAGAATCATGTGAGTTCATTGA 
ACAGTTGCCTGATTGTTCTTCGAATCTATATGGTGTTTTACTGCAGATGGCTTGACCTAC 
TTTGAGGATTTACTGGAAGAGACGTCCATCTCAACTAGCTTAATTACACTTGAAAAGGAT 
TACTATGATGGTAAAGGCGAACTTGATGAGAGGGTATTCATCAATGAAGAGGATAGCTTA 
CTTGGATCTGGAAGCTTATCTGCAGGAGCTGTTAATATTACTGGTGTTAAGAGGAAAATT 
GATGCTTTGAGCTCACCTGCAAGGACATTTATAAGCCCACTTTCTCCTCATAAGTCGCCT 
GCTGCTAAGACAAATGGTATTAGCGGTGCTACCAAGTTGGCAGCAACACCAGTGAGCACA 
GCAATGACAACTGCCAAGTGGCTCAGGACTGTCATATCCCCGCTTCTGCCAAAACCTTCT 
CCTGGGTTGGAACATTTCCTTAAATCATGTGATAGGGATATAACAAATGACGTCACACGA 
AGAGCACACATAATATTGGAAGCTATTTTCCCAAATAGTTCCCTTGGTGCCCAATGTGGA 
GGTGGAAGTTTGCAAGCTGTTGACCTGATGGATGACATATGGGCAGAGCAGCGCAGATTA 
GAAGCTTGTAAGTTATACTACAGAGTTCTTGAGGCAATGTGTAAAGCAGAAGCTCAGATT 
TTGCATGCAAATAATCTGAACTCTTTATTGACAAATGAGAGGTTCCATAGATGCATGCTT 
GCTTGCTCAGCTGAATTGGTACTGGCTACCCACAAAACAATTACAATGTTGTTCCCAGCT 
GTTCTGGAGAGGACTGGGATCACAGCCTTTGATCTCAGCAAGGTAATTGAGAGTTTCATA 
CGACATGAAGATTCTCTGCCTAGAGAGTTGAGACGACATCTGAATTCACTGGAGGAACGG 
CTTCTAGAGAGTATGGTATGGGAGAAAGGCTCTTCAATGTACAATTCTCTGATTGTTGCC 
AGGCCATCGCTTGCATTGGAGATAAATCAGCTCGGTTTACTAGCTGAACCAATGCCATCT 
CTGGATGCAATCGCAGCACTTATTAATTTCTCTGACGGAGCAAATCATGCATCATCTGTA 
CAAAAGCATGAAACTTGTCCAGGTAGTTTTATTTGTTTCTGAATTAAAGCAGTTTTCCAA 
CCTGTTGTTAATGGTATGATTTTCTTACCAAAAATTGTCAAATTTGCTGCCATATAGGAC 
AAAATGGGGGGATTAGATCGCCCAAAAGATTATGTACTGATTACCGCAGCATTCTAGTTG 
AACGCAATTCCTTTACATCACCAGTAAAGGATCGTCTGTTGGCCTTAGGCAACGTTAAAT 
CCAAGATGCTGCCACCTCCGTTGCAGTCTGCATTTGCCAGGTACATTTTGAGTAACTATG 
AGTAGAAATGGAGAGTTAGTTTACCTATCTAGTTGTCCCTGTACTTGTTAAGTAACCTCT 
TCGGATTTATGTCTACAGCCCAACACGGCCCAACCCAGGAGGTGGAGGAGAAACTTGTGC 
AGAAACTGGAATCAATATTTTCTTCACAAAGGTAGGTCTGTGAGATCTTTGGATCTACTA 
CTAATCGTTTGGTTAGATGATGTACTACAAAACACGGTATTGATTCTTCATTTTCGGCTG 
GGAATTGTGTTAAATGTGGTGGCTCTTCCCAGATTAATAAATTGGCTGCTGTAAGAATCA 
ATGGAATGGTGGAAAGACTACAACTTTCACAGCAAATAAGGGAGAGTGTGTATTGTTTCT 
TCCAACATGTACTTGCTCAGCGGACTTCTCTTTTATTCAGTCGACACATTGACCAGATCA 
TTCTCTGTTGCTTCTACGGAGTGGCCAAGGTGAGTAGTGTGATTCAAAGGGTTTAACTAT 
ATGTCATCTGGTTTACAATGGCTTCTCTTACACTTACACTTTTTCCATGAATCACCTTGT 
AGATATCCCAAATGAGCCTGACTTTCAGGGAAATCATATACAACTACCGGAAGCAACCAC 
AGTGTAAACCATTAGTTTTCCGCAGCGTTTATGTGGATGCGTTACAATGTCGCCGTCAAG 
GGGTATATATACACTCTTAACCTTATGCTGAAAAGTTTCTTTACTCGGTGGAGAAGACTA 
AATTTGTGACAATGACTTGAACAGAGAATAGGGCCAGATCATGTTGACATCATCACATTC 
TACAATGAAATATTTATTCCTGCCGTAAAGCCGCTGCTGGTGGAGCTAGGTCCTGTAAGA 
AACGACCGGGCTGTGGAAGCCAATAATAAGCCTGAAGGTAGTTAAGAAAGGCCAGATACT 
TGTTAGATGTAAGCTTTGTCTATCAATTTAGTCCCTAAGTTAAATGATCGTCTTATTTTG 
GATTCACAGGTCAATGTCCCGGATCGCCAAAGGTGTCTGTGTTTCCAAGTGTTCCAGACA 
TGTCCCCTAAAAAAGTATCTGCAGTGCACAATGTTTATGTTTCTCCTCTTCGGGGATCAA 
AGGTAAAGAAGATCATAGTGCTTAACTCTTTATCATGATATGACTAAGTCTTGAGGAGGA 
GGTAGGTGACAAGATTGTTTGGTTACCTTCCATGTGTTGTGTGTTTGCAGATGGATGCTC 
TTATTTCACACAGTACAAAGAGTTACTATGCTTGTGTTGGAGAGAGTACACATGCTTACC 
AGAGCCCTTCAAAGGACCTATCTGCCATCAACAACCGCTTGAACAAGTAAGTAGAAAAAT 
CACGTCTCTCATCAGCTTCTTCCATAAAACCAATCACTGACCCAATCCAATTTCATCTGG 
TGTCACAGCAGCAGCAGCAACCGCAAGAGGACGCTAAACTTTGACGCAGAAGCAGGGATG 
GTCAGCGATTCCATGGTAGCAAATAGCCTTAACCTCCAAAACCAAAATCAAAACCAAAAT 
GGAAGCGATGCATCGTCCTCAGGTGGTGCCGCACCCCTTAAAACCGAGCCAACAGATTCA 
TAGATATCTCTCTCTACTTGCTACACCAACTTCTCTTCAGTTATAGCATCTGTAAATCCT 
TATGTTGCAGAGTTTGCTTTTATGTTTAGCTTTCTAGTTTATAGTGATCACCTCAGGCTA 
TGAGCGGATGGATCCCTTTATTGTTTCTTTTTTCTTTTTTTATCTTAGTTAAGTCAGTCT 
TAATAAGCATTAATAAATGTCTTTTTCTTGTTCACTCTTTCTAACTGTGTTCGGTGTCCC 
ATCTACTAAATTTATTTTCCAC
>AT2G39740.1 |  unknown protein 
AAACCTTCCAAAGACTTTTCATTGTCTTCGCCTGCGAGCGCTAAAATTATCTCCGAGCAT 
TCTCAAGTTGGGTGATTCGGTACGGATTACTGATTTGGGAGAGAAAAACCCTAGATTGGA 
ATTAGATTCTGGGTTCTTGGGCTAAAGGTTTCTTCATCTCCTTCGAATCATCCTTTTGTA 
AGTCCAGTGGATGTGAAAACCCAGTACTCACTGATTCTTTTTATTAGGAATTTTGTAAGG 
TTTTGGGTAGAGTTTTCACAGTTTTGATGATACTAAAATGTGGGCCACTGGGTCTAGAGA 
ATGAAGAATCTTGCTTTTAGTGACAAAGGTTGTTCCTTTGGAGTAGTAAGTGAGCAAGAT 
ATCAGAAAAACTGAACCTTTAATCTCAAGAATTTACTTTGATTGGAGCTTGTGAAGTCCT 
TGTGTTATTGTTGCATGATGTTTTCTTTGAGATAACTTGGCAATGTGTGTTTGGTGTTAT 
TGTAGAGGGAGCAAGACGATGAGTAGAAACCCTTTCCTGGATCCTACTCTTCAAGAAATT 
CTTCAAGTGATTAAACCCACACGAGCAGATAGGGATACGAGGATCACAGTCATTGATCAG 
TTGCGTGACGTCTTACAATCCGTAGAATGTTTAAGAGGTGATGACTCTTGATGCACTTTT 
GTGCTTCTCCCATTTTTCTTACTGTCTAGTACTGCCTTGAACCATACCAGCCATGGATGT 
GATTATGATATTGGATATGAAAGTGAGATACTTCGAGCTTTCAGTAAGGTAATATCTGCT 
GGAATTGTAGCTGCAGAATAGTAGAAGTGGTTCATGTTACTCTTTCGCACTATTCTCGTT 
CTGGAAACAAATTATTTCATGTGATGCTTATAGCCGCTCGTTGTCTGGTTCTGTGATTGT 
TAGGTGCTACTGTTCAACCATTTGGATCCTTTGTGTCAAATCTCTTCACACGATGGGGAG 
ACTTAGATATCTCTGTTGACTTATTCAGCGGTTCTTCCATCTTGTTCACTGGAAAGAAGC 
AGAAACAAACTTTACTCGGACATTTACTACGAGCACTGAGAGCGAGTGGTGATTCATTTA 
GCTTCTATTTTTTTCTTCTTTTTTTGGTTTTCTCTTTGCTTCACTGTTGTTTACCTTATA 
TACTACTTAAGTAGTTTAAGTATTATTTCATGTGCCGATTTGTCTCACATCCATTATCAT 
TCAAAAAACAGGTCTATGGTACAAACTGCAATTTGTTATTCATGCGCGAGTTCCTATTCT 
GAAAGTAGTGAGCGGCCACCAGAGAATTTCTTGTGACATTTCTATTGATAACCTGGATGG 
GCTTTTGAAGAGCAGGTTCTTGTTCTGGATCAGTGAAATAGATGGGAGATTCCGCGACCT 
GGTTTTGCTAGTAAGTTAACATGCAAATAAAACCATATTGTGTGTTTCCAAAGGTTTAAT 
TGATTCTAAACGTATCTACCTCGTGTATTCTACATTTGTAGGTGAAGGAATGGGCGAAAG 
CTCATAATATCAACGACTCAAAGACCGGGACTTTCAACTCTTACTCTCTCAGTTTGTTAG 
TCATCTTCCATTTTCAGGTAAGATAGCTGTTCTGTATTCATAGATTTTGCTGCCTTCAGC 
CTTCTGCAGTTACTGCATCATTAGAAACCATAGTAAGATGTTCTATGTTGTTTGTTGCAG 
ACTTGTGTGCCTGCAATCTTGCCGCCTCTAAGAGTGATATATCCGAAGAGTGCGGTTGAT 
GATCTGACAGGTACGCTCAATGAAAAGGTTTTGAAGCCAAACCACACAAAATATATGTGT 
TTTTGGGGTAAAGGGACAAAAGTTTTAGCGGTATGGTGTCTTGTAGGTGTACGGAAAACT 
GCAGAGGAAAGCATAGCGCAAGTTACTGCTGCTAATATTGCGAGATTTAAATCAGAGAGA 
GCAAAATCAGTCAATCGAAGCTCGCTCTCGGAGCTGTTGGTCTCTTTTTTTGCAAAGGTG 
ATTGATTTCTCATACATTCTAGCTTTAATTTTTTTCCCTTAATAATATCCACTAAAGTGC 
TCTTGATAGAAATTAGTATCTTGATTTTGCTGTGTGGCTGTATCTATCAGTTTTCAGACA 
TAAACGTGAAGGCCCAAGAGTTCGGTGTTTGCCCGTTTACTGGAAGATGGGAAACTATAA 
GCAGCAACACTACATGGCTGCCAAAGACATACTCACTCTTTGTTAGTCTCTTTCTCTTTC 
TTTCTCTTAACCTCTTGTTGAGTTATATTCATCTCTATGGCACCATGTGAGTCTCCCGGC 
TAACATGTGGGAATGGTGTGTGTTTCAGGTTGAAGATCCTTTTGAGCAGCCGGTGAACGC 
TGCAAGGAGTGTGAGCCGTAGAAATTTGGACAGAATAGCTCAAGTATTTCAGATTACATC 
GCGCCGTCTTGTCTCAGAGTGTAACAGAAACTCCATCATAGGGATTCTGACAGGGCAACA 
CATTCAAGAGTCTTTGTACAGAACAATAAGCCTCCCAAGTCAACATCATGCAAACGGTAT 
GCACAATGTCCGTAATCTGCATGGTCAGGCTAGGCCACAGAACCAGCAAATGCAGCAAAA 
TTGGTCACAGAGCTACAATACCCCGAATCCACCACATTGGCCACCACTAACACAATCCCG 
ACCACAACAGAATTGGACTCAGAACAACCCCAGGAATCTTCAGGGGCAACCACCTGTCCA 
AGGCCAAACTTGGCCTGTAATCACACAAACTCAAACGCAGCAGAAGAGCCCATATAAGAG 
TGGGAACCGACCATTGAAAAATACATCTGCTGGTTCAAGTCAGAATCAGGGCCACATTGG 
TAAGCCATCTGGTCATATGAATGGTGTGAACTCTGCAAGACCTGCATATACGAATGGTGT 
GAACTCCGCAAGGCCTCCATCAAAAATTCCAAGCCAAGGCGGACAGATCTGGAGACCGAG 
ACATGAGCAGTAGAATGAGGTGTGCAGACATGGTTCAGAGATACTCCTTCACATATTTTG 
GATGATTTTGTATTCTGACCTTGGGGCTTTTTTTCTATGGATCCATTCGTTACAATCAAC 
AGATTTGCAATAGCAGAATGTTGTTACTAAAAAATGAGGACGAGGTAAACTTTTACTCAG 
TAAAACACCACAATCAAATTTACAGTTACATTAAGAGAAAAAAGAAGAAAACAATAAGAG 
ATATACTACCAAACAAAATATATTGTGTTGACTAGTGCAGTAACTTGTGTGGTATTAAGC 
TCGAAGGAGACGCTTCTCGCATGTTAGAATCCTGTAACTTGCGTGAGGACCCTCGGATGT 
GTCACGCAGAGAAGTATGCCAACCCATGGCCTTTGTGATTTCTTGAATTTCATCCATAAC 
ATCAATTGA
>AT5G65740.1 |  protein binding / zinc ion binding 
GATCTGCGTAGATGATGAATGTTTCTGGAGAATGTGTAGGCCGTGAAAGATGCGAGGAAT 
TAGCCAAGTCTTCTTCGTTTTACCGGAAAGTTTACTCGGAGGTTTGGTTAACCATCGATC 
CCTTCCCTTCTTCTGAAATCGAGTGCTCTCACATATTCAACGAACCATTGTTGTATTGGT 
TTCTTAGATAGAAGAAATTGGATGGGAACCAATAAGGAGATTAGGTGGAGATTTAACGTT 
TTTTAGCTTTCACATTCTGTAAGTTCCATAATTTTAGGGTTGTCTTCAAAATCTTACTTA 
ATGTGATTAGTACTTTGCAACCTATGTAGCTCCATCTTCATGTGACATGTTAGCTTTGTG 
CCATCATCATGATTATGTACAGAGATAAGAAGGGAAGAGCTCACAACTTAGAAATTCAAC 
TGAACAGAGACTATCCTAATTCACCACCTTCTGTTTCTGCGGTTTGTTAATGTCAAATCC 
TTAAGCTTTTTTCATTCTCCGTAGCGAATTAACTTTTGCTTCGATGTAGGATGTGCCATA 
TATGTTTACACTAGAATGGTCAACAAGTTCAAGATTGAAGGATGTAATGCACCAATTCCA 
AAAGGTAGATCTAAGACTTTGCTACATTCTCTCTTTGTAATCACTAATCAGCTTGTTTTT 
GTTGTTAACAGCATTTGGACTATCTTCAAGAATTTTGGTCTGTCTTGGACAATATCGATA 
AATCTCTATGTGTTGTTGATGTCAAGCAACCAGCTCGTGCCTCTGCTATTCGCCGGATTG 
ATGCTGGTTTAATACCTTTACCTCAATTCCATTTGTCTCCATACTCTTTTATTTCTGTCT 
TGACGAAATTCACTTTTATCTATCTCTACTTGGTTCATTTTTTTCTCAGGGAATGATTGT 
ATCATCATTGTTCATATCGACTTCAAAGACCCTAAATCCCTACCAGAGTATGTTTCTAGA 
CAAACACACACTCTCAATAACCTACTTGTCGACATTTTTTAATAGTTATAAGTGCTTAGA 
CAGGTCCCGGTTTATTGGTCCTGTGCCTTCAGCTACGCATATGAACAACTTGCATATGTT 
ATGGAGAAGAAATTGCAAAAGATGGTAAAATTATTTTGTCTCTACTCTCCCATTTTAAAT 
CTCTTTCGAGAGGTTGGTTATATAGCATGGAGTTATATGGATTGTTGAAAGCAGGAATGA 
CGGGTTAATGATAATCATACAGGTCAAATGAAAGATCATTTCCTGAGAACCTTGAATGTA 
TTCTAGGTACTGAGCTTCCAAAGCCTCTAGGTCTCCAAGTGGAAGACGATCAACAACAAG 
TTGAATGTGGGATTTGCTATGCGCAGTTTCTACCCACCGGTGATTTCTTAAACCGAAAAA 
GCAATGCTTCAGAATAGTAATTTGCTTTGATGGTTCGCTAACTTCTCATTTACTTTAATC 
TAAGATGAGGAGCTCGGAGCTAGAAGTGGGACACGAACAGATTACACATGTGAAAACATC 
AGTTGCAACAAGTCTTTCCATAGCCTCTGCCTCACAGACTGGTTAAGGTCTATCACAACA 
ACAAGACAGTAAGTGGAAACCTTAATCTCTCACGCTCTCATATCCAAACACACACAATCC 
TTGTGCTCTAAAGCTCAATTATGATCCAATTTCTTGCAGGTCATTTGATGTTCTGTTTGG 
GAACTGCCCTTATTGTTCAGACCCAGTTGCAGTCAAAACCAGCAACAAATAGAGTTAGAC 
AAACCATCATCCTAATTAGCTGATATCTGAATGTTGTAATGAAACGTGATACAAAGAGAA 
GAGTTAGTACAGTAATGAGTAGTAGTAGTAAGTGAGGACAAAAGTTCCTTTTTACTATTT 
TTCTTCTGTACGTTTAAGATAAGACTCATGTAGCTTTCAAATAAGAGATGTGAATGTACC 
TTGTTTTTTTC
>AT5G65740.1 |  protein binding / zinc ion binding 
GATCTGCGTAGATGATGAATGTTTCTGGAGAATGTGTAGGCCGTGAAAGATGCGAGGAAT 
TAGCCAAGTCTTCTTCGTTTTACCGGAAAGTTTACTCGGAGGTTTGGTTAACCATCGATC 
CCTTCCCTTCTTCTGAAATCGAGTGCTCTCACATATTCAACGAACCATTGTTGTATTGGT 
TTCTTAGATAGAAGAAATTGGATGGGAACCAATAAGGAGATTAGGTGGAGATTTAACGTT 
TTTTAGCTTTCACATTCTGTAAGTTCCATAATTTTAGGGTTGTCTTCAAAATCTTACTTA 
ATGTGATTAGTACTTTGCAACCTATGTAGCTCCATCTTCATGTGACATGTTAGCTTTGTG 
CCATCATCATGATTATGTACAGAGATAAGAAGGGAAGAGCTCACAACTTAGAAATTCAAC 
TGAACAGAGACTATCCTAATTCACCACCTTCTGTTTCTGCGGTTTGTTAATGTCAAATCC 
TTAAGCTTTTTTCATTCTCCGTAGCGAATTAACTTTTGCTTCGATGTAGGATGTGCCATA 
TATGTTTACACTAGAATGGTCAACAAGTTCAAGATTGAAGGATGTAATGCACCAATTCCA 
AAAGGTAGATCTAAGACTTTGCTACATTCTCTCTTTGTAATCACTAATCAGCTTGTTTTT 
GTTGTTAACAGCATTTGGACTATCTTCAAGAATTTTGGTCTGTCTTGGACAATATCGATA 
AATCTCTATGTGTTGTTGATGTCAAGCAACCAGCTCGTGCCTCTGCTATTCGCCGGATTG 
ATGCTGGTTTAATACCTTTACCTCAATTCCATTTGTCTCCATACTCTTTTATTTCTGTCT 
TGACGAAATTCACTTTTATCTATCTCTACTTGGTTCATTTTTTTCTCAGGGAATGATTGT 
ATCATCATTGTTCATATCGACTTCAAAGACCCTAAATCCCTACCAGAGTATGTTTCTAGA 
CAAACACACACTCTCAATAACCTACTTGTCGACATTTTTTAATAGTTATAAGTGCTTAGA 
CAGGTCCCGGTTTATTGGTCCTGTGCCTTCAGCTACGCATATGAACAACTTGCATATGTT 
ATGGAGAAGAAATTGCAAAAGATGGTAAAATTATTTTGTCTCTACTCTCCCATTTTAAAT 
CTCTTTCGAGAGGTTGGTTATATAGCATGGAGTTATATGGATTGTTGAAAGCAGGAATGA 
CGGGTTAATGATAATCATACAGGTCAAATGAAAGATCATTTCCTGAGAACCTTGAATGTA 
TTCTAGGTACTGAGCTTCCAAAGCCTCTAGGTCTCCAAGTGGAAGACGATCAACAACAAG 
TTGAATGTGGGATTTGCTATGCGCAGTTTCTACCCACCGGTGATTTCTTAAACCGAAAAA 
GCAATGCTTCAGAATAGTAATTTGCTTTGATGGTTCGCTAACTTCTCATTTACTTTAATC 
TAAGATGAGGAGCTCGGAGCTAGAAGTGGGACACGAACAGATTACACATGTGAAAACATC 
AGTTGCAACAAGTCTTTCCATAGCCTCTGCCTCACAGACTGGTTAAGGTCTATCACAACA 
ACAAGACAGTAAGTGGAAACCTTAATCTCTCACGCTCTCATATCCAAACACACACAATCC 
TTGTGCTCTAAAGCTCAATTATGATCCAATTTCTTGCAGGTCATTTGATGTTCTGTTTGG 
GAACTGCCCTTATTGTTCAGACCCAGTTGCAGTCAAAACCAGCAACAAATAGAGTTAGAC 
AAACCATCATCCTAATTAGCTGATATCTGAATGTTGTAATGAAACGTGATACAAAGAGAA 
GAGTTAGTACAGTAATGAGTAGTAGTAGTAAGTGAGGACAAAAGTTCCTTTTTACTATTT 
TTCTTCTGTACGTTTAAGATAAGACTCATGTAGCTTTCAAATAAGAGATGTGAATGTACC 
TTGTTTTTTTC
>AT5G65740.1 |  protein binding / zinc ion binding 
GATCTGCGTAGATGATGAATGTTTCTGGAGAATGTGTAGGCCGTGAAAGATGCGAGGAAT 
TAGCCAAGTCTTCTTCGTTTTACCGGAAAGTTTACTCGGAGGTTTGGTTAACCATCGATC 
CCTTCCCTTCTTCTGAAATCGAGTGCTCTCACATATTCAACGAACCATTGTTGTATTGGT 
TTCTTAGATAGAAGAAATTGGATGGGAACCAATAAGGAGATTAGGTGGAGATTTAACGTT 
TTTTAGCTTTCACATTCTGTAAGTTCCATAATTTTAGGGTTGTCTTCAAAATCTTACTTA 
ATGTGATTAGTACTTTGCAACCTATGTAGCTCCATCTTCATGTGACATGTTAGCTTTGTG 
CCATCATCATGATTATGTACAGAGATAAGAAGGGAAGAGCTCACAACTTAGAAATTCAAC 
TGAACAGAGACTATCCTAATTCACCACCTTCTGTTTCTGCGGTTTGTTAATGTCAAATCC 
TTAAGCTTTTTTCATTCTCCGTAGCGAATTAACTTTTGCTTCGATGTAGGATGTGCCATA 
TATGTTTACACTAGAATGGTCAACAAGTTCAAGATTGAAGGATGTAATGCACCAATTCCA 
AAAGGTAGATCTAAGACTTTGCTACATTCTCTCTTTGTAATCACTAATCAGCTTGTTTTT 
GTTGTTAACAGCATTTGGACTATCTTCAAGAATTTTGGTCTGTCTTGGACAATATCGATA 
AATCTCTATGTGTTGTTGATGTCAAGCAACCAGCTCGTGCCTCTGCTATTCGCCGGATTG 
ATGCTGGTTTAATACCTTTACCTCAATTCCATTTGTCTCCATACTCTTTTATTTCTGTCT 
TGACGAAATTCACTTTTATCTATCTCTACTTGGTTCATTTTTTTCTCAGGGAATGATTGT 
ATCATCATTGTTCATATCGACTTCAAAGACCCTAAATCCCTACCAGAGTATGTTTCTAGA 
CAAACACACACTCTCAATAACCTACTTGTCGACATTTTTTAATAGTTATAAGTGCTTAGA 
CAGGTCCCGGTTTATTGGTCCTGTGCCTTCAGCTACGCATATGAACAACTTGCATATGTT 
ATGGAGAAGAAATTGCAAAAGATGGTAAAATTATTTTGTCTCTACTCTCCCATTTTAAAT 
CTCTTTCGAGAGGTTGGTTATATAGCATGGAGTTATATGGATTGTTGAAAGCAGGAATGA 
CGGGTTAATGATAATCATACAGGTCAAATGAAAGATCATTTCCTGAGAACCTTGAATGTA 
TTCTAGGTACTGAGCTTCCAAAGCCTCTAGGTCTCCAAGTGGAAGACGATCAACAACAAG 
TTGAATGTGGGATTTGCTATGCGCAGTTTCTACCCACCGGTGATTTCTTAAACCGAAAAA 
GCAATGCTTCAGAATAGTAATTTGCTTTGATGGTTCGCTAACTTCTCATTTACTTTAATC 
TAAGATGAGGAGCTCGGAGCTAGAAGTGGGACACGAACAGATTACACATGTGAAAACATC 
AGTTGCAACAAGTCTTTCCATAGCCTCTGCCTCACAGACTGGTTAAGGTCTATCACAACA 
ACAAGACAGTAAGTGGAAACCTTAATCTCTCACGCTCTCATATCCAAACACACACAATCC 
TTGTGCTCTAAAGCTCAATTATGATCCAATTTCTTGCAGGTCATTTGATGTTCTGTTTGG 
GAACTGCCCTTATTGTTCAGACCCAGTTGCAGTCAAAACCAGCAACAAATAGAGTTAGAC 
AAACCATCATCCTAATTAGCTGATATCTGAATGTTGTAATGAAACGTGATACAAAGAGAA 
GAGTTAGTACAGTAATGAGTAGTAGTAGTAAGTGAGGACAAAAGTTCCTTTTTACTATTT 
TTCTTCTGTACGTTTAAGATAAGACTCATGTAGCTTTCAAATAAGAGATGTGAATGTACC 
TTGTTTTTTTC
>AT5G65740.2 |  protein binding / zinc ion binding 
GATTACTCGAGATGCAGAAAGTTTCAGAGGTTGAAGATGATCTGCGTAGATGATGAATGT 
TTCTGGAGAATGTGTAGGCCGTGAAAGATGCGAGGAATTAGCCAAGTCTTCTTCGTTTTA 
CCGGAAAGTTTACTCGGAGGTTTGGTTAACCATCGATCCCTTCCCTTCTTCTGAAATCGA 
GTGCTCTCACATATTCAACGAACCATTGTTGTATTGGTTTCTTAGATAGAAGAAATTGGA 
TGGGAACCAATAAGGAGATTAGGTGGAGATTTAACGTTTTTTAGCTTTCACATTCTGTAA 
GTTCCATAATTTTAGGGTTGTCTTCAAAATCTTACTTAATGTGATTAGTACTTTGCAACC 
TATGTAGCTCCATCTTCATGTGACATGTTAGCTTTGTGCCATCATCATGATTATGTACAG 
AGATAAGAAGGGAAGAGCTCACAACTTAGAAATTCAACTGAACAGAGACTATCCTAATTC 
ACCACCTTCTGTTTCTGCGGTTTGTTAATGTCAAATCCTTAAGCTTTTTTCATTCTCCGT 
AGCGAATTAACTTTTGCTTCGATGTAGGATGTGCCATATATGTTTACACTAGAATGGTCA 
ACAAGTTCAAGATTGAAGGATGTAATGCACCAATTCCAAAAGGTAGATCTAAGACTTTGC 
TACATTCTCTCTTTGTAATCACTAATCAGCTTGTTTTTGTTGTTAACAGCATTTGGACTA 
TCTTCAAGAATTTTGGTCTGTCTTGGACAATATCGATAAATCTCTATGTGTTGTTGATGT 
CAAGCAACCAGCTCGTGCCTCTGCTATTCGCCGGATTGATGCTGGTTTAATACCTTTACC 
TCAATTCCATTTGTCTCCATACTCTTTTATTTCTGTCTTGACGAAATTCACTTTTATCTA 
TCTCTACTTGGTTCATTTTTTTCTCAGGGAATGATTGTATCATCATTGTTCATATCGACT 
TCAAAGACCCTAAATCCCTACCAGAGTATGTTTCTAGACAAACACACACTCTCAATAACC 
TACTTGTCGACATTTTTTAATAGTTATAAGTGCTTAGACAGGTCCCGGTTTATTGGTCCT 
GTGCCTTCAGCTACGCATATGAACAACTTGCATATGTTATGGAGAAGAAATTGCAAAAGA 
TGGTAAAATTATTTTGTCTCTACTCTCCCATTTTAAATCTCTTTCGAGAGGTTGGTTATA 
TAGCATGGAGTTATATGGATTGTTGAAAGCAGGAATGACGGGTTAATGATAATCATACAG 
GTCAAATGAAAGATCATTTCCTGAGAACCTTGAATGTATTCTAGGTACTGAGCTTCCAAA 
GCCTCTAGGTCTCCAAGTGGAAGACGATCAACAACAAGTTGAATGTGGGATTTGCTATGC 
GCAGTTTCTACCCACCGGTGATTTCTTAAACCGAAAAAGCAATGCTTCAGAATAGTAATT 
TGCTTTGATGGTTCGCTAACTTCTCATTTACTTTAATCTAAGATGAGGAGCTCGGAGCTA 
GAAGTGGGACACGAACAGATTACACATGTGAAAACATCAGTTGCAACAAGTCTTTCCATA 
GCCTCTGCCTCACAGACTGGTTAAGGTCTATCACAACAACAAGACAGTAAGTGGAAACCT 
TAATCTCTCACGCTCTCATATCCAAACACACACAATCCTTGTGCTCTAAAGCTCAATTAT 
GATCCAATTTCTTGCAGGTCATTTGATGTTCTGTTTGGGAACTGCCCTTATTGTTCAGAC 
CCAGTTGCAGTCAAAACCAGCAACAAATAGAGTTAGACAAACCATCATCCTAATTAGCTG 
ATATCTGAATGTTGTAATGAAACGTGATACAAAGAGAAGAGTTAGTACAGTAATGAGTAG 
TAGTAGTAAGTGAGGACAAAAGTTCCTTTTTACTATTTTTCTTCTGTACGTTTAAGATAA 
GACTCATGTAGCTTTCAAATAAGAGATGTGAATGTACCTTGTTTTTTTCTTTTGTGGCCA 
CTCAATTCCCCAAAGCTGATCTATCAATCACAATCAATGTGGAGTTTCAAGCAATAACTC 
TTTTACTTAGTAATTTTGAAAAAGAGTATTTGAATGCTATTGTTTGCCTTTTTCTCCATG 
GATACATCCTTTCTCTCCAGCTGTAATAGTACTGTCGGTGGCTTAACCA
>AT5G65740.2 |  protein binding / zinc ion binding 
GATTACTCGAGATGCAGAAAGTTTCAGAGGTTGAAGATGATCTGCGTAGATGATGAATGT 
TTCTGGAGAATGTGTAGGCCGTGAAAGATGCGAGGAATTAGCCAAGTCTTCTTCGTTTTA 
CCGGAAAGTTTACTCGGAGGTTTGGTTAACCATCGATCCCTTCCCTTCTTCTGAAATCGA 
GTGCTCTCACATATTCAACGAACCATTGTTGTATTGGTTTCTTAGATAGAAGAAATTGGA 
TGGGAACCAATAAGGAGATTAGGTGGAGATTTAACGTTTTTTAGCTTTCACATTCTGTAA 
GTTCCATAATTTTAGGGTTGTCTTCAAAATCTTACTTAATGTGATTAGTACTTTGCAACC 
TATGTAGCTCCATCTTCATGTGACATGTTAGCTTTGTGCCATCATCATGATTATGTACAG 
AGATAAGAAGGGAAGAGCTCACAACTTAGAAATTCAACTGAACAGAGACTATCCTAATTC 
ACCACCTTCTGTTTCTGCGGTTTGTTAATGTCAAATCCTTAAGCTTTTTTCATTCTCCGT 
AGCGAATTAACTTTTGCTTCGATGTAGGATGTGCCATATATGTTTACACTAGAATGGTCA 
ACAAGTTCAAGATTGAAGGATGTAATGCACCAATTCCAAAAGGTAGATCTAAGACTTTGC 
TACATTCTCTCTTTGTAATCACTAATCAGCTTGTTTTTGTTGTTAACAGCATTTGGACTA 
TCTTCAAGAATTTTGGTCTGTCTTGGACAATATCGATAAATCTCTATGTGTTGTTGATGT 
CAAGCAACCAGCTCGTGCCTCTGCTATTCGCCGGATTGATGCTGGTTTAATACCTTTACC 
TCAATTCCATTTGTCTCCATACTCTTTTATTTCTGTCTTGACGAAATTCACTTTTATCTA 
TCTCTACTTGGTTCATTTTTTTCTCAGGGAATGATTGTATCATCATTGTTCATATCGACT 
TCAAAGACCCTAAATCCCTACCAGAGTATGTTTCTAGACAAACACACACTCTCAATAACC 
TACTTGTCGACATTTTTTAATAGTTATAAGTGCTTAGACAGGTCCCGGTTTATTGGTCCT 
GTGCCTTCAGCTACGCATATGAACAACTTGCATATGTTATGGAGAAGAAATTGCAAAAGA 
TGGTAAAATTATTTTGTCTCTACTCTCCCATTTTAAATCTCTTTCGAGAGGTTGGTTATA 
TAGCATGGAGTTATATGGATTGTTGAAAGCAGGAATGACGGGTTAATGATAATCATACAG 
GTCAAATGAAAGATCATTTCCTGAGAACCTTGAATGTATTCTAGGTACTGAGCTTCCAAA 
GCCTCTAGGTCTCCAAGTGGAAGACGATCAACAACAAGTTGAATGTGGGATTTGCTATGC 
GCAGTTTCTACCCACCGGTGATTTCTTAAACCGAAAAAGCAATGCTTCAGAATAGTAATT 
TGCTTTGATGGTTCGCTAACTTCTCATTTACTTTAATCTAAGATGAGGAGCTCGGAGCTA 
GAAGTGGGACACGAACAGATTACACATGTGAAAACATCAGTTGCAACAAGTCTTTCCATA 
GCCTCTGCCTCACAGACTGGTTAAGGTCTATCACAACAACAAGACAGTAAGTGGAAACCT 
TAATCTCTCACGCTCTCATATCCAAACACACACAATCCTTGTGCTCTAAAGCTCAATTAT 
GATCCAATTTCTTGCAGGTCATTTGATGTTCTGTTTGGGAACTGCCCTTATTGTTCAGAC 
CCAGTTGCAGTCAAAACCAGCAACAAATAGAGTTAGACAAACCATCATCCTAATTAGCTG 
ATATCTGAATGTTGTAATGAAACGTGATACAAAGAGAAGAGTTAGTACAGTAATGAGTAG 
TAGTAGTAAGTGAGGACAAAAGTTCCTTTTTACTATTTTTCTTCTGTACGTTTAAGATAA 
GACTCATGTAGCTTTCAAATAAGAGATGTGAATGTACCTTGTTTTTTTCTTTTGTGGCCA 
CTCAATTCCCCAAAGCTGATCTATCAATCACAATCAATGTGGAGTTTCAAGCAATAACTC 
TTTTACTTAGTAATTTTGAAAAAGAGTATTTGAATGCTATTGTTTGCCTTTTTCTCCATG 
GATACATCCTTTCTCTCCAGCTGTAATAGTACTGTCGGTGGCTTAACCA
>AT5G65740.2 |  protein binding / zinc ion binding 
GATTACTCGAGATGCAGAAAGTTTCAGAGGTTGAAGATGATCTGCGTAGATGATGAATGT 
TTCTGGAGAATGTGTAGGCCGTGAAAGATGCGAGGAATTAGCCAAGTCTTCTTCGTTTTA 
CCGGAAAGTTTACTCGGAGGTTTGGTTAACCATCGATCCCTTCCCTTCTTCTGAAATCGA 
GTGCTCTCACATATTCAACGAACCATTGTTGTATTGGTTTCTTAGATAGAAGAAATTGGA 
TGGGAACCAATAAGGAGATTAGGTGGAGATTTAACGTTTTTTAGCTTTCACATTCTGTAA 
GTTCCATAATTTTAGGGTTGTCTTCAAAATCTTACTTAATGTGATTAGTACTTTGCAACC 
TATGTAGCTCCATCTTCATGTGACATGTTAGCTTTGTGCCATCATCATGATTATGTACAG 
AGATAAGAAGGGAAGAGCTCACAACTTAGAAATTCAACTGAACAGAGACTATCCTAATTC 
ACCACCTTCTGTTTCTGCGGTTTGTTAATGTCAAATCCTTAAGCTTTTTTCATTCTCCGT 
AGCGAATTAACTTTTGCTTCGATGTAGGATGTGCCATATATGTTTACACTAGAATGGTCA 
ACAAGTTCAAGATTGAAGGATGTAATGCACCAATTCCAAAAGGTAGATCTAAGACTTTGC 
TACATTCTCTCTTTGTAATCACTAATCAGCTTGTTTTTGTTGTTAACAGCATTTGGACTA 
TCTTCAAGAATTTTGGTCTGTCTTGGACAATATCGATAAATCTCTATGTGTTGTTGATGT 
CAAGCAACCAGCTCGTGCCTCTGCTATTCGCCGGATTGATGCTGGTTTAATACCTTTACC 
TCAATTCCATTTGTCTCCATACTCTTTTATTTCTGTCTTGACGAAATTCACTTTTATCTA 
TCTCTACTTGGTTCATTTTTTTCTCAGGGAATGATTGTATCATCATTGTTCATATCGACT 
TCAAAGACCCTAAATCCCTACCAGAGTATGTTTCTAGACAAACACACACTCTCAATAACC 
TACTTGTCGACATTTTTTAATAGTTATAAGTGCTTAGACAGGTCCCGGTTTATTGGTCCT 
GTGCCTTCAGCTACGCATATGAACAACTTGCATATGTTATGGAGAAGAAATTGCAAAAGA 
TGGTAAAATTATTTTGTCTCTACTCTCCCATTTTAAATCTCTTTCGAGAGGTTGGTTATA 
TAGCATGGAGTTATATGGATTGTTGAAAGCAGGAATGACGGGTTAATGATAATCATACAG 
GTCAAATGAAAGATCATTTCCTGAGAACCTTGAATGTATTCTAGGTACTGAGCTTCCAAA 
GCCTCTAGGTCTCCAAGTGGAAGACGATCAACAACAAGTTGAATGTGGGATTTGCTATGC 
GCAGTTTCTACCCACCGGTGATTTCTTAAACCGAAAAAGCAATGCTTCAGAATAGTAATT 
TGCTTTGATGGTTCGCTAACTTCTCATTTACTTTAATCTAAGATGAGGAGCTCGGAGCTA 
GAAGTGGGACACGAACAGATTACACATGTGAAAACATCAGTTGCAACAAGTCTTTCCATA 
GCCTCTGCCTCACAGACTGGTTAAGGTCTATCACAACAACAAGACAGTAAGTGGAAACCT 
TAATCTCTCACGCTCTCATATCCAAACACACACAATCCTTGTGCTCTAAAGCTCAATTAT 
GATCCAATTTCTTGCAGGTCATTTGATGTTCTGTTTGGGAACTGCCCTTATTGTTCAGAC 
CCAGTTGCAGTCAAAACCAGCAACAAATAGAGTTAGACAAACCATCATCCTAATTAGCTG 
ATATCTGAATGTTGTAATGAAACGTGATACAAAGAGAAGAGTTAGTACAGTAATGAGTAG 
TAGTAGTAAGTGAGGACAAAAGTTCCTTTTTACTATTTTTCTTCTGTACGTTTAAGATAA 
GACTCATGTAGCTTTCAAATAAGAGATGTGAATGTACCTTGTTTTTTTCTTTTGTGGCCA 
CTCAATTCCCCAAAGCTGATCTATCAATCACAATCAATGTGGAGTTTCAAGCAATAACTC 
TTTTACTTAGTAATTTTGAAAAAGAGTATTTGAATGCTATTGTTTGCCTTTTTCTCCATG 
GATACATCCTTTCTCTCCAGCTGTAATAGTACTGTCGGTGGCTTAACCA
>AT5G65740.3 |  protein binding / zinc ion binding 
GATCTGCGTAGATGATGAATGTTTCTGGAGAATGTGTAGGCCGTGAAAGATGCGAGGAAT 
TAGCCAAGTCTTCTTCGTTTTACCGGAAAGTTTACTCGGAGGTTTGGTTAACCATCGATC 
CCTTCCCTTCTTCTGAAATCGAGTGCTCTCACATATTCAACGAACCATTGTTGTATTGGT 
TTCTTAGATAGAAGAAATTGGATGGGAACCAATAAGGAGATTAGGTGGAGATTTAACGTT 
TTTTAGCTTTCACATTCTGTAAGTTCCATAATTTTAGGGTTGTCTTCAAAATCTTACTTA 
ATGTGATTAGTACTTTGCAACCTATGTAGCTCCATCTTCATGTGACATGTTAGCTTTGTG 
CCATCATCATGATTATGTACAGAGATAAGAAGGGAAGAGCTCACAACTTAGAAATTCAAC 
TGAACAGAGACTATCCTAATTCACCACCTTCTGTTTCTGCGGTTTGTTAATGTCAAATCC 
TTAAGCTTTTTTCATTCTCCGTAGCGAATTAACTTTTGCTTCGATGTAGGATGTGCCATA 
TATGTTTACACTAGAATGGTCAACAAGTTCAAGATTGAAGGATGTAATGCACCAATTCCA 
AAAGGTAGATCTAAGACTTTGCTACATTCTCTCTTTGTAATCACTAATCAGCTTGTTTTT 
GTTGTTAACAGCATTTGGACTATCTTCAAGAATTTTGGTCTGTCTTGGACAATATCGATA 
AATCTCTATGTGTTGTTGATGTCAAGCAACCAGCTCGTGCCTCTGCTATTCGCCGGATTG 
ATGCTGGTTTAATACCTTTACCTCAATTCCATTTGTCTCCATACTCTTTTATTTCTGTCT 
TGACGAAATTCACTTTTATCTATCTCTACTTGGTTCATTTTTTTCTCAGGGAATGATTGT 
ATCATCATTGTTCATATCGACTTCAAAGACCCTAAATCCCTACCAGAGTATGTTTCTAGA 
CAAACACACACTCTCAATAACCTACTTGTCGACATTTTTTAATAGTTATAAGTGCTTAGA 
CAGGTCCCGGTTTATTGGTCCTGTGCCTTCAGCTACGCATATGAACAACTTGCATATGTT 
ATGGAGAAGAAATTGCAAAAGATGGTAAAATTATTTTGTCTCTACTCTCCCATTTTAAAT 
CTCTTTCGAGAGGTTGGTTATATAGCATGGAGTTATATGGATTGTTGAAAGCAGGAATGA 
CGGGTTAATGATAATCATACAGGTCAAATGAAAGATCATTTCCTGAGAACCTTGAATGTA 
TTCTAGGTACTGAGCTTCCAAAGCCTCTAGGTCTCCAAGTGGAAGACGATCAACAACAAG 
TTGAATGTGGGATTTGCTATGCGCAGTTTCTACCCACCGGTGATTTCTTAAACCGAAAAA 
GCAATGCTTCAGAATAGTAATTTGCTTTGATGGTTCGCTAACTTCTCATTTACTTTAATC 
TAAGATGAGGAGCTCGGAGCTAGAAGTGGGACACGAACAGATTACACATGTGAAAACATC 
AGTTGCAACAAGTCTTTCCATAGCCTCTGCCTCACAGACTGGTTAAGGTCTATCACAACA 
ACAAGACAGTAAGTGGAAACCTTAATCTCTCACGCTCTCATATCCAAACACACACAATCC 
TTGTGCTCTAAAGCTCAATTATGATCCAATTTCTTGCAGGTCATTTGATGTTCTGTTTGG 
GAACTGCCCTTATTGTTCAGACCCAGTTGCAGTCAAAACCAGCAACAAATAGAGTTAGAC 
AAACCATCATCCTAATTAGCTGATATCTGAATGTTGTAATGAAACGTGATACAAAGAGAA 
GAGTTAGTACAGTAATGAGTAGTAGTAGTAAGTGAGGACAAAAGTTCCTTTTTACTATTT 
TTCTTCTGTACGTTTAAGATAAGACTCATGTAGCTTTCAAATAAGAGATGTGAATGTACC 
TTGTTTTTTTCTTTTGTGGCCACTCAATTCCCCAAAGCTGATCTATCAATCACAATCAAT 
GTGGAGTTTCAAGCAATAACTCTTTTACTTAGTAATTTTGAAAAAGAGTATTTGAATGCT 
ATTGTTTGCCTTTTTCTCCATGGATACATCCTTTCTCTCCAGCTGTAATAGTACTGTCGG 
TGGCTTAACCA
>AT5G65740.3 |  protein binding / zinc ion binding 
GATCTGCGTAGATGATGAATGTTTCTGGAGAATGTGTAGGCCGTGAAAGATGCGAGGAAT 
TAGCCAAGTCTTCTTCGTTTTACCGGAAAGTTTACTCGGAGGTTTGGTTAACCATCGATC 
CCTTCCCTTCTTCTGAAATCGAGTGCTCTCACATATTCAACGAACCATTGTTGTATTGGT 
TTCTTAGATAGAAGAAATTGGATGGGAACCAATAAGGAGATTAGGTGGAGATTTAACGTT 
TTTTAGCTTTCACATTCTGTAAGTTCCATAATTTTAGGGTTGTCTTCAAAATCTTACTTA 
ATGTGATTAGTACTTTGCAACCTATGTAGCTCCATCTTCATGTGACATGTTAGCTTTGTG 
CCATCATCATGATTATGTACAGAGATAAGAAGGGAAGAGCTCACAACTTAGAAATTCAAC 
TGAACAGAGACTATCCTAATTCACCACCTTCTGTTTCTGCGGTTTGTTAATGTCAAATCC 
TTAAGCTTTTTTCATTCTCCGTAGCGAATTAACTTTTGCTTCGATGTAGGATGTGCCATA 
TATGTTTACACTAGAATGGTCAACAAGTTCAAGATTGAAGGATGTAATGCACCAATTCCA 
AAAGGTAGATCTAAGACTTTGCTACATTCTCTCTTTGTAATCACTAATCAGCTTGTTTTT 
GTTGTTAACAGCATTTGGACTATCTTCAAGAATTTTGGTCTGTCTTGGACAATATCGATA 
AATCTCTATGTGTTGTTGATGTCAAGCAACCAGCTCGTGCCTCTGCTATTCGCCGGATTG 
ATGCTGGTTTAATACCTTTACCTCAATTCCATTTGTCTCCATACTCTTTTATTTCTGTCT 
TGACGAAATTCACTTTTATCTATCTCTACTTGGTTCATTTTTTTCTCAGGGAATGATTGT 
ATCATCATTGTTCATATCGACTTCAAAGACCCTAAATCCCTACCAGAGTATGTTTCTAGA 
CAAACACACACTCTCAATAACCTACTTGTCGACATTTTTTAATAGTTATAAGTGCTTAGA 
CAGGTCCCGGTTTATTGGTCCTGTGCCTTCAGCTACGCATATGAACAACTTGCATATGTT 
ATGGAGAAGAAATTGCAAAAGATGGTAAAATTATTTTGTCTCTACTCTCCCATTTTAAAT 
CTCTTTCGAGAGGTTGGTTATATAGCATGGAGTTATATGGATTGTTGAAAGCAGGAATGA 
CGGGTTAATGATAATCATACAGGTCAAATGAAAGATCATTTCCTGAGAACCTTGAATGTA 
TTCTAGGTACTGAGCTTCCAAAGCCTCTAGGTCTCCAAGTGGAAGACGATCAACAACAAG 
TTGAATGTGGGATTTGCTATGCGCAGTTTCTACCCACCGGTGATTTCTTAAACCGAAAAA 
GCAATGCTTCAGAATAGTAATTTGCTTTGATGGTTCGCTAACTTCTCATTTACTTTAATC 
TAAGATGAGGAGCTCGGAGCTAGAAGTGGGACACGAACAGATTACACATGTGAAAACATC 
AGTTGCAACAAGTCTTTCCATAGCCTCTGCCTCACAGACTGGTTAAGGTCTATCACAACA 
ACAAGACAGTAAGTGGAAACCTTAATCTCTCACGCTCTCATATCCAAACACACACAATCC 
TTGTGCTCTAAAGCTCAATTATGATCCAATTTCTTGCAGGTCATTTGATGTTCTGTTTGG 
GAACTGCCCTTATTGTTCAGACCCAGTTGCAGTCAAAACCAGCAACAAATAGAGTTAGAC 
AAACCATCATCCTAATTAGCTGATATCTGAATGTTGTAATGAAACGTGATACAAAGAGAA 
GAGTTAGTACAGTAATGAGTAGTAGTAGTAAGTGAGGACAAAAGTTCCTTTTTACTATTT 
TTCTTCTGTACGTTTAAGATAAGACTCATGTAGCTTTCAAATAAGAGATGTGAATGTACC 
TTGTTTTTTTCTTTTGTGGCCACTCAATTCCCCAAAGCTGATCTATCAATCACAATCAAT 
GTGGAGTTTCAAGCAATAACTCTTTTACTTAGTAATTTTGAAAAAGAGTATTTGAATGCT 
ATTGTTTGCCTTTTTCTCCATGGATACATCCTTTCTCTCCAGCTGTAATAGTACTGTCGG 
TGGCTTAACCA
>AT5G65740.3 |  protein binding / zinc ion binding 
GATCTGCGTAGATGATGAATGTTTCTGGAGAATGTGTAGGCCGTGAAAGATGCGAGGAAT 
TAGCCAAGTCTTCTTCGTTTTACCGGAAAGTTTACTCGGAGGTTTGGTTAACCATCGATC 
CCTTCCCTTCTTCTGAAATCGAGTGCTCTCACATATTCAACGAACCATTGTTGTATTGGT 
TTCTTAGATAGAAGAAATTGGATGGGAACCAATAAGGAGATTAGGTGGAGATTTAACGTT 
TTTTAGCTTTCACATTCTGTAAGTTCCATAATTTTAGGGTTGTCTTCAAAATCTTACTTA 
ATGTGATTAGTACTTTGCAACCTATGTAGCTCCATCTTCATGTGACATGTTAGCTTTGTG 
CCATCATCATGATTATGTACAGAGATAAGAAGGGAAGAGCTCACAACTTAGAAATTCAAC 
TGAACAGAGACTATCCTAATTCACCACCTTCTGTTTCTGCGGTTTGTTAATGTCAAATCC 
TTAAGCTTTTTTCATTCTCCGTAGCGAATTAACTTTTGCTTCGATGTAGGATGTGCCATA 
TATGTTTACACTAGAATGGTCAACAAGTTCAAGATTGAAGGATGTAATGCACCAATTCCA 
AAAGGTAGATCTAAGACTTTGCTACATTCTCTCTTTGTAATCACTAATCAGCTTGTTTTT 
GTTGTTAACAGCATTTGGACTATCTTCAAGAATTTTGGTCTGTCTTGGACAATATCGATA 
AATCTCTATGTGTTGTTGATGTCAAGCAACCAGCTCGTGCCTCTGCTATTCGCCGGATTG 
ATGCTGGTTTAATACCTTTACCTCAATTCCATTTGTCTCCATACTCTTTTATTTCTGTCT 
TGACGAAATTCACTTTTATCTATCTCTACTTGGTTCATTTTTTTCTCAGGGAATGATTGT 
ATCATCATTGTTCATATCGACTTCAAAGACCCTAAATCCCTACCAGAGTATGTTTCTAGA 
CAAACACACACTCTCAATAACCTACTTGTCGACATTTTTTAATAGTTATAAGTGCTTAGA 
CAGGTCCCGGTTTATTGGTCCTGTGCCTTCAGCTACGCATATGAACAACTTGCATATGTT 
ATGGAGAAGAAATTGCAAAAGATGGTAAAATTATTTTGTCTCTACTCTCCCATTTTAAAT 
CTCTTTCGAGAGGTTGGTTATATAGCATGGAGTTATATGGATTGTTGAAAGCAGGAATGA 
CGGGTTAATGATAATCATACAGGTCAAATGAAAGATCATTTCCTGAGAACCTTGAATGTA 
TTCTAGGTACTGAGCTTCCAAAGCCTCTAGGTCTCCAAGTGGAAGACGATCAACAACAAG 
TTGAATGTGGGATTTGCTATGCGCAGTTTCTACCCACCGGTGATTTCTTAAACCGAAAAA 
GCAATGCTTCAGAATAGTAATTTGCTTTGATGGTTCGCTAACTTCTCATTTACTTTAATC 
TAAGATGAGGAGCTCGGAGCTAGAAGTGGGACACGAACAGATTACACATGTGAAAACATC 
AGTTGCAACAAGTCTTTCCATAGCCTCTGCCTCACAGACTGGTTAAGGTCTATCACAACA 
ACAAGACAGTAAGTGGAAACCTTAATCTCTCACGCTCTCATATCCAAACACACACAATCC 
TTGTGCTCTAAAGCTCAATTATGATCCAATTTCTTGCAGGTCATTTGATGTTCTGTTTGG 
GAACTGCCCTTATTGTTCAGACCCAGTTGCAGTCAAAACCAGCAACAAATAGAGTTAGAC 
AAACCATCATCCTAATTAGCTGATATCTGAATGTTGTAATGAAACGTGATACAAAGAGAA 
GAGTTAGTACAGTAATGAGTAGTAGTAGTAAGTGAGGACAAAAGTTCCTTTTTACTATTT 
TTCTTCTGTACGTTTAAGATAAGACTCATGTAGCTTTCAAATAAGAGATGTGAATGTACC 
TTGTTTTTTTCTTTTGTGGCCACTCAATTCCCCAAAGCTGATCTATCAATCACAATCAAT 
GTGGAGTTTCAAGCAATAACTCTTTTACTTAGTAATTTTGAAAAAGAGTATTTGAATGCT 
ATTGTTTGCCTTTTTCTCCATGGATACATCCTTTCTCTCCAGCTGTAATAGTACTGTCGG 
TGGCTTAACCA
>AT5G67100.1 |  ICU2 (INCURVATA2) DNA-directed DNA polymerase 
ATGTCCGGCGATAATTCAACGGAAACTGGACGAAGACGTAGCCGAGGCGCGGAGGCGTCG 
AGTAGGAAAGACACACTCGAGCGTCTGAAGGCGATTCGACAAGGAGGAATCCGTTCTGCG 
TCAGGTGGTGGGTACGATATTAGGCTGCAGAAGCCAATCTTCGATACCGTTGATGACGAA 
GAGTACGACGCACTTGTTTCCCGGCGGCGCGAGGAGGCTCGCGGGTTTGTAGTTGAAGAT 
GGGGAAGGTGGCGATTTGGGATATCTCGACGAAGGTGAGGAGGAGGATTGGTCGAAGCCA 
AGTGGACCAGAATCGACTGATGAATCAGACGACGGTGGTAGGTTTAGTGGGAGACTTAAG 
AAGAAGAAGAAAGGGAAAGAGCAAACGCAGCAACCTCAGGTTAAGAAGGTGAATCCGGCG 
TTAAAAGCTGCGGCTACTATCACTGGTGAAGGTAGACTTTCGTCTATGTTCACATCTTCG 
AGTTTCAAGAAAGTTAAGGAGACTGATAAGGCACAGTATGAGGGTATTCTTGACGAGATA 
ATAGCTCAGGTTACTCCAGATGAGTCGGATAGAAAAAAGCATACGAGGAGAAAACTACCA 
GGTACTGTTCCAGTTACCATCTTCAAGAATAAAAAACTGTTTTCTGTTGCCTCGAGTATG 
GGAATGAAAGAGTCTGAACCAACACCTTCAACTTATGAGGGTGATTCTGTTTCCATGGAT 
AATGAATTGATGAAAGAGGAAGATATGAAAGAATCTGAAGTCATTCCTTCTGAGACTATG 
GAATTACTTGGAAGTGATATTGTCAAAGAGGATGGATCAAACAAGATAAGGAAAACTGAA 
GTGAAGAGTGAGTTAGGTGTCAAGGAGGTATTTACATTGAATGCAACGATTGATATGAAA 
GAGAAGGATTCGGCTTTAAGTGCCACTGCTGGTTGGAAGGAAGCGATGGGAAAAGTTGGA 
ACTGAGAATGGGGCTTTGCTTGGTTCTAGTTCTGAAGGGAAAACGGAATTTGATTTGGAT 
GCTGACGGATCACTTCGTTTCTTCATTCTTGACGCTTATGAGGAGGCTTTTGGTGCGAGC 
ATGGGCACAATATATCTGTTTGGGAAGGTGAATCTCTAGATTTTTCATTCATTTTTAAAG 
TTGTTCTTTTGGCCTTAATCTAGAGAATGAATTCGGTCTCTCTTTTTTTAACAATTCAGG 
TTAAAATGGGAGATACTTACAAGAGTTGCTGTGTGGTAGTTAAGAATATCCAGAGGTGTG 
TTTATGCTATTCCAAATGATTCCATATTTCCTTCCCATGAACTAATCATGCTCGAGCAAG 
AGGTGAAAGACTCTCGACTTTCTCCTGAATCCTTCCGTGGGAAATTGCATGTGAGTTTGA 
CTACCTTTGTTACATGCTAAGAGGAAGCAATCTATTTTCCTCTGTTGTTCATTGTTTTTG 
GCTGTGTCTTCTCAGGAAATGGCATCAAAACTGAAAAACGAAATTGCTCAGGAATTGTTA 
CAGCTCAATGTTTCAAATTTTAGCATGGCGCCTGTCAAGGTTTGGATATTTGACTTCTTT 
TTCATGTATTCTAGCAGCAATACTTTTCTTTTGACTCTCTATTCTGCTCTTTATGTACGA 
ATATCAGAGAAACTATGCTTTTGAGAGGCCTGATGTGCCTGCTGGCGAACAATATGTTTT 
GAAGATAAATTATTCATTTAAGGTACATTTCAGCTGTTCAAAATAAAACTAAAAATCGTC 
TGTTTTCTTACATCTCAACAATATGACAAGTTTCCTCTTTTATAACAGGATCGTCCACTT 
CCAGAAGATCTTAAAGGCGAGTCTTTCTCCGCTTTGCTCGGGTCTCATACCAGGTTCTAG 
CTTCTTACTGCTGAGTTTCATTACCTTTCCATGTGTTTGGTAGTTGGTTTGTTAAGTTTG 
TATTTTCTGGTCTTCTGTAAGCTTCTTAGTTAACTATGTATGCTGGCTATGTCAATTTAG 
CACGGTGCAATTTTTTCATCCTTATCAAAGTTAATTCATATGCAGTGCTTTGGAGCATTT 
TATCCTTAAGAGGAAGATCATGGGACCTTGTTGGCTCAAAATTTCAAGCTTCTCTACTTG 
CTCTCCTTCGGAAGGAGTAAGACCTTAAATCTGTGCCATAATCATATAATCAGTGATTTT 
TCTAGTTCTGTTTATCTCCGCTAATGAGAGGACTTGCCACTTGTGCAGGTGAGTTGGTGC 
AAGTTTGAGGTTACTGTTCAATCTCCCAAGGATATCACTATTTTAGTTTCAGAGGAAAAG 
GTGGTTCACCCTCCTGCTGTTGTTACAGCCATAAATTTAAAGACTATAGTCAATGAAAAG 
CAGAACATAAGCGAAATTGTTTCTGCATCTGTTCTCTGCTTTCACAACGCCAAGGTTTGT 
TCTACAACATTTAACCAATGCTTCTTAGCCTTTTTTGTTGTTGTTGTTGTTGTCTTTGTG 
AAGAATACGGATGTATGATCATGGCATTACCAATCACCAGTAGGTTTTCGTACCATGTGG 
TTTTATATTAACGCTCATTTTGGACGATTGTTTCTTGCTCAAAAGACACTCTTTCTGTCT 
ACATTAGTAGCTTGACATATGATGTGCGTGCTCCTTGATCTTTCAGATTGATGTTCCAAT 
GCCAGCTCCAGAAAGAAAGAGATCTGGTATTCTGAGTCATTTCACTGTTGTTAGGAATCC 
TGAAGGAACCGGTTACCCAATTGGTTGGAAAAAAGAAGTGTCTGACAGAAATTCAAAGAA 
CGGCTGCAATGTATTAAGTATTGAAAACAGGTGTGTTGCAGCTCTGTTACTGAATAGGCT 
GTGTTTGTGATCCTTCACATATATCTTTGGCAATTCATGTTGGCTTCGTCCAATATTTTG 
TTCCTTTTCTTACTGCAGTGAAAGAGCATTGCTGAACCGATTGTTTTTGGAGTTAAACAA 
ATTGGACAGTGATATTCTTGTGGGACATAATATTTCAGGTTTTGATCTGGATGTTCTTCT 
TCAAAGGGCCCAGGTAAAGCAAAATCTCTTTTTACCATTAAGAAAAATGGTTGTGTCTTT 
CATTTTATTTTATTTTCTTATCTTTCTATGATATGCTTCATATTAGTTTTGTAAGATCTT 
GTCTTTCCAGGCCTATTAGATGATATTTAACGTAATAAGCCAGCAAGTTTTTATTTCATG 
CATTGTACATCATTAGTCCCTTTTCCAGTCTCTCCTGTTGTGATGATCATGTAATAGAGA 
TATATACATGTCTGTCTTGTTCTTTAAACTGAATGATTACTATTGTGCAGGCTTGCAAAG 
TTCAGAGTAGCATGTGGTCCAAAATTGGCCGACTCAAACGCTCTTTTATGCCTAAGCTTA 
AAGGAAACAGTAATTATGGGTCAGGAGCTACACCAGGGCTCATGTCTTGTATTGCTGGAA 
GGCTCTTGTGTGATACAGATCTGTGTTCTCGTGACTTGTTGAAGGAGGTATGATACCCTT 
GCAGGTCTTGTAAGCAGTAAGTTGAAGCTCAGTCCCTCATGTATAAGCATCTGTTTCTTG 
CAGGTCAGTTATTCTTTAACGGACCTCTCAAAGACACAGCTGAACCGGGACAGGAAAGAG 
ATAGCGCCTAATGATATTCCCAAAATGTTTCAGTCATCCAAAACACTTGTGGAACTTGTA 
AGTTCTTCGATGAGCCCGGTCATGTCTGTTTTATGTATGAGTTGGTACTACCACATTAGG 
GACGATAGGTTATGAATCCTTGCATGCGAAACAATTTAGTGCAAACTATTGAAGAATAAA 
TAATCCAGTCATACATAGAAGTAAAGGGATTGCAGATAACAGCAGTCACTTAAGGTTGAT 
GAGTGATGACTGCATCTTAATTGCTCGCTTGTTATAACCCTTTGATTTTCTTTTCTTTCA 
GATTGAATGTGGTGAGACGGATGCATGGTTATCCATGGAGCTCATGTTTCATCTAAGTGT 
TCTTCCTCTCACTCTCCAGCTTACTAACATAAGTGGCAATCTTTGGGGGAAAACACTTCA 
AGTAATGACTCTCCCTCTCCCTCCCATCCGGGAAAATATGTGTTACTGTGCTGACTCATG 
CATTTTTTGTTCATGACCAGGGAGCCAGGGCACAGAGAATCGAATACTACTTACTACATA 
CATTCCACTCGAAAAAGTTCATTCTCCCTGACAAAATTTCACAACGTATGAAGGAAATAA 
AGTCATCAAAAAGAAGAATGGATTATGCTCCAGAAGACCGCAATGTAGATGAATTGGATG 
CTGACCTGACTTTGGAGAATGATCCGTCTAAGGGCAGCAAAACAAAAAAAGGTCCAGCCT 
ACGCTGGTGGACTGGTCTTGGAGCCAAAGAGAGGCTTATATGACAAATATGTCTTGCTTC 
TGGATTTCAATAGTCTTTACCCTTCTATTATACAGGTTAGCAGATTGTTTCTATTTCTCA 
AGCCTTTGGTGGATGTTTCCGCCTGCTTGGTAGTTAACAGTCATGATATTTTCAGGAATA 
CAATATCTGTTTTACGACTATACCACGATCAGAAGATGGAGTTCCTCGTTTACCTTCGAG 
TCAGACACCTGGAATTCTTCCAAAGGTATAGTCATCATTACACGAGTTTGCATTTTACTG 
TGACTATTTTCAATTCCGTATATATTTTCTATATGTTATAGGTTATCCAACGTCAAATCT 
ATAAATTACCCCAACCCAATCAGAAATTAATTGAAAGAAAAATTCAACAACCAAAATATT 
TTGCCTCATTTTCTTTTCCTAACCTCTCAAGGGATATGCGAGAAATCCTCAGAACAATGC 
GACCTAGCTGGTCAGTATTGTATTGGTGACTGCTGCTTTCTGTAGTTTAAGTAAACCTAA 
TTCTGACATAATCGTCTAAATTATTGCTATATACATTTTTTTTTCCTCGACTTTAAGTTT 
CTCTCCTTGATCTGGTATGCCCATGAATCCCACTATATGTCTTTGTTTTAGTTGATGGAA 
CATTTGGTCAGTATAAGGAAAAGCGTCAAATTAAAGATGAAGAAGGAAACAGGTCTCAAG 
TACTGGGAGCTTGACATTCGACAGCAGGCATTGAAGCTCACAGCCAATAGGTTTGCATTT 
TATGGTTTTACTTGTGCGGCAATAATTGCCAATCACCGCAATTTGATGTTTATGTTTTTT 
TATTCATTCTAAACACAGTATGTATGGCTGTCTGGGGTTTTCTAATTCAAGATTCTATGC 
TAAGCCTTTAGCAGAGCTCATAACACTACAGGTAAGTGATGCTTTCTGTGTTTTCTAGTG 
ACATGTTTTTTCTTTTTTTCTCTATTTTTGCGTGATCAGGCTGATTGGCTTAACATTGCA 
GGGAAGGGATATCCTGCAAAGAACCGTGGATCTTGTCCAGAACCATTTAAATCTAGAGGT 
AACTCTTATACTTGGAGTCTCAGGAAATGCATTTCAGTAGAGAAATTAGTGAACTGTGTA 
AACAACTCTGTTCTATCAAGTCTAGAATTAAAATCTTGCTTTTACGTAGGTAATATACGG 
TGACACAGATTCAATCATGATTCACAGCGGACTAGATGATATTGAAGAGGTGAAAGCCAT 
TAAATCAAAAGTCATCCAAGAGGTAGGTTGGATACTAGATTTATCTCTATATAGCTTTCC 
TTGGGGAAAGTGCTTCTCTAAGAAGATTATAAAAAATTTATACAAGAAAAATCAGACATT 
TGATTTTGGGCCTTCCCCTTTCAATTTTTAGGTCAATAAGAAGTATAGATGTCTAAAAAT 
TGACTGTGATGGCATATACAAGAGAATGCTTCTTCTTCGAAAAAAGAAGTATGCTGCTGT 
CAAGTTGCAGTTTAAGGATGGGAAGCCTTGCGAGGTAATTGTTTTTTTGTAAACATTTTT 
GCATACCCTTTCTTGCAGAAAATTATGGGTACTAGATGCATTCTCAATGCAGGACATTGA 
AAGAAAAGGTGTGGATATGGTTCGTCGAGATTGGAGCTTACTCTCGAAGGAAATAGGAGA 
TTTATGCCTGAGTAAAATCTTGTATGGAGGGTATGTTTTGAAACATCAACTAAAGAACAT 
TGTTTTTACTCTCTCATGCAAGCACAACAAGTCTCTTCTTCTGTGCAGATCCTGTGAGGA 
TGTTGTTGAAGCAATTCATAACGAACTAATGAAGGTAATCTTTGTTATGATTTATTAATC 
TTTGCTAATTAGTTTGATCGTCTTTATCATCCAACACATGTTGCTTTGTCCATGTAACAG 
ATAAAAGAGGAAATGAGAAATGGGCAAGTTGCTCTTGAGAAGTATGTCATCACCAAGACA 
TTGACTAAACCGCCTGCAGCTTATCCAGATTCCAAAAGCCAACCACACGTTCAAGTGAGT 
ATGAGAGCTATTATTCTCGTTATTTCTCCCTTATTATATGCTTTCTATATATTCACTTAA 
CTTAACTCTCTGATTGTGTGGCTAAATTTTTCTTCTCAGGTTGCACTCAGAATGAGGCAA 
CGTGGTTATAAAGAAGGTTTCAATGCTAAGGATACTGTACCGTATATAATCTGCTATGAG 
CAGGTTCCCAAAACAGAAGACCAGCTAAATATTATAAGATACCCTTTAGTTTTTTCTACT 
AAATATTTTATGCCTCCTCTGTGCAGGGTAATGCTAGCTCTGCTAGTTCAGCAGGAATTG 
CCGAACGTGCTAGGCATCCTGATGAGGTGAAATCAGAAGGCAGCAGATGGTTGGTTGACA 
TAGATTACTACTTAGCACAACAGATTCATCCGGTGGTGTCTCGTCTATGCGCAGAGATTC 
AAGGAACAAGTCCTGAACGTCTAGCTGAATGTTTAGGACTTGACCCATCAAAGGTAAAAC 
AGCTTTCACTCCAGCAAATTTCCGATTCATATTCAGTGATCATGAATTCATGATAACTGA 
TGTGGAAATAATGTTTTATTCTAGTACCGAAGCAAATCAAACGATGCTACAAGCAGTGAT 
CCCTCTACCTCCCTCTTATTCGCAACAAGCGATGAAGAAAGGTATTGATATCTTTCCCAT 
TTGTAATTTGCTATCATATATTTGCTTCACGGATTTGCAATATTCCTCAAACTTAAGATC 
CGCAACAACGTAATTTACATGGAAAAATGCAGATATAAAAGTTGCGAGCCTTTAGCATTA 
ACATGCCCCAGCTGCTCTACTGCTTTCAACTGTCCATCTATTATTAGTTCTGTTTGTGCG 
TCAATCAGTAAGAAACCTGCAACACCTGAAACAGAGGAATCTGATTCCACATTCTGGCTT 
AAACTGCATTGCCCGAAATGTCAGCAGGAAGATAGCACGGGAATAATATCCCCTGCAATG 
ATAGCTAACCAGGTAGGCAAATTTTGTTGAAAAGGATCCTAATTTGTTAAGTTTCTCAGA 
ATAAAAAATATGTATCCTTGTGATTTGGCCTGCAGGACAAATGCTTCAGTTATTAACTCA 
TTATCATGCCTTTCAGGTAAAAAGACAGATCGATGGATTTGTGTCAATGTACTACAAAGG 
CATAATGGTGGTATGTAAAACCTTCTCGCCTTGTTTTTTCCTCATAGTTCTGAACATTTG 
TGATTTGTCCTTCTTAATTTATGCTAAGACGTTTTCTTGTACATTTTGCCTTCAACAGTG 
TGAAGACGAGTCATGCAAGCACACAACCCGCTCCCCCAACTTTCGTCTACTCGGTGAACG 
TGAACGGGGGACAGTTTGCCCAAACTATCCTAACTGTAACGGAACCCTCTTACGAAAGGT 
ATATACCATCATCAACCTTATAACTCCTATCTCTCTATTGCTTCACAGACTAACTCTTGA 
CTTTACAGTACACTGAAGCAGACTTGTACAAGCAACTGTCATACTTCTGCCACATCTTAG 
ACACACAATGCTCTTTAGAAAAGGTTTCTACTTTACAACCTTGTTATATTATTAATATCA 
ATTTGTCTTGTCTATATCCCTAAAGTTATCGGTACCATTTGAAATAACAGATGGATGTTG 
GCGTGAGAATTCAAGTAGAGAAAGCAATGACGAAGATAAGACCTGCGGTTAAGTCAGCAG 
CAGCAATCACTCGAAGTAGTAGAGACCGGTGTGCTTATGGATGGATGCAACTCACAGACA 
TAGTCATTTGA
>AT5G41880.1 |  POLA3 DNA primase 
ATGACGAGAGAGGAGACTGAAACCAGTGGAGAGGATATGATGATTGATGACCCAAAACCC 
AAAATCGAAAACGATTTCAATGTTCATTACCTCCGAATTTACTACGGCAAGTTTTAATCT 
TTATCACATTTGGGTATATGTCTCTTCATAAATCAAATCTGACTTTTTTCGCTCATAACA 
ACATATATGCAGGAAATCTATTTCCTTACACTGATATTCACAAATGGCTTTCTTATGGGC 
ACGGTACTTGTTTGTTTACTTGTCTTTCTTTCTTTCTGTCACACTCTTTAAAGGTTAGAA 
ATGGTTGTGATGAATTGTATATTTGTCTGTGTTTGTGAATCTGTAGATGGGAAACATCCT 
GGTTGTGATGAATATTACTTTGGTAGAAGAGAATTCTCGTTTACGCTTGAAAACGATGTT 
TATTTGCGGTATAAGTCTTTCAAGAATGCTTCACTTATGGAAGCTGCTATCAAATCGAAT 
TTTCCATACAAGATTGATATTGGTGCTGTGTATAGCGTTGATGTAAGTTGCAAAAATCCG 
TTTTTCAAGCTTTGGTGCTGGTCTATGAAACTAGATTTACTCATTTGAGTTTTGTAAATG 
TGTTTTTTCAGCCGGATAAGAGACATGCATATGCTCAAAGTGGAACCAATTTGTTTACTC 
CAGTGGAGAGGGAGTTAGTCTTTGATATTGTGAGTTTTAATATCTTATTAAGAATTTCGT 
ATAATTGGTTTTGTGTTTTTGTTCTTACGTAGTTTGTTGCTTGACTTGAATATATTGTTT 
CCTCAGGATATAACAGATTATGATGATGTTAGATACTGTTGTTCGGGAGCCGATGTTTGC 
TCCAAATGCTGGCCTTTAATGACAGTTGCTATCAAAGTCATTGATACTTCCTTAAGAGGT 
ATCAAAAATGTTTTCTTAACTCTCAAATGTATGATACAACTAGAGTTTGTAGTGTTCCTG 
AGATTTTCCATCCCTATGAGTTTTTGTAATATTTATAGCCCCTGTAACGTGAATGTCATT 
GTGGAGTTCACTTCTTGATCTAGTGTTTGTCAATGTGCAAGACTGCTTGGTCTTATCATA 
GAACAAACTTGTAGTCACTCATTCTGGTCTTGTCAATTGCAGAGGATTTTGGTTTCAAAC 
ACATCCTCTGGGTCTTCAGTGGACGTCGTGGAGTTCACTGTTGGGTTTGTGATGCTAAAG 
CTCGAAGGTGAAACAATTACTAACATTGTTTTTCACTTCGCTTGGTGTATGAATCACTTT 
CTGCATTTCATCTTCTGTTTTATGAAATGAAACGTTGTGTGATTAAATCCTGCAGGTTGA 
CTAATGAACAAAGATCAGCAGTTGCTGAATACTTTCGTGTTTATAAGGTAGTGTTCTCAA 
GAGCTCAACGATGGTTTATTTTGTTGGTTTCTGGCATTGTGAAATTGTCTGAGTTCAATT 
ATTGCCTATGTGACACAGGGAAATGAAAACAATGCAAAAAAGGTCGATCTGATGGGTCAT 
TCTCTTCATCCGTTTCTTGCGTAAGGGTTTCTCCATCACCTCTGCCTTTCTGATTTCAAA 
AACACTGTCTTTGTTACTAATTTCTTCTGGGATTTTCAGGAGATCATATGTGGACTTTAT 
TAAGAGTTTCTTTGAGGGTGAGTTACAAGCAACTCAAAGTATATTCTCAAGCAAAGAAAA 
GTATGAGAAGATACTTGGGATGATTACAGATGAAGGTATGAAAGAGTGTTGATGTATTTT 
TCCGCCTACGTGACGTCCTAATCTCAGTTTGTGTCATTTACAATGATTTGCATCTTCATG 
ACAGATATTCAAGCAGACCTCAGAGGAAAGTGGGAGAATTCTGCGAGATCATCTCTATCA 
GAAGAAGCCACCAGCCTTTTAAGGTGGGAACAACTTAAGAAAGCTCTTCAATCGAAGAGA 
AACAAGGTGTGTAATGTTTTAAAGGAATTCAAAACATGTATGTTAAGTGTTGTGAAAACC 
TTATTTGTCTTTCACTCAGCTTTTAGCTTGATGAACTTGAATCTTAGTTTTGCTCATCTT 
CAATCTTGTATCCATAATGTTTTAGGCTCTATCACTGCGGACGTGCGTAGAAGAAATTGT 
CTTCACCTTTACGTATCCTCGAATTGATTTGGAGGTTTGTTCTACTCTATGCTACAATTT 
TCATAAACCCATTGTGCTATTATGGTAGATATTCCCTCGCCGTATTAGATCTTATAGCAA 
CTGACAAGTTTTGTGACTGTTTAGTTGTATGGTTTCTTCTTTTATTGCAGGTTTCAAAAC 
AAATGAACCATTTGCTTAAGGCACCCTTCTGCGTCCATCCAAAAACAGGTCCCTTTCATT 
GTTTCTTGAATATATCCTACCAGGTAATTACTCTCATATTCATACTTAGTTCAATGTATG 
AATGTTGTCTGGTTTTCAGGTCGTGTCTGTGTTCCTATTGACCCGAATAACTGTGATGAG 
TTTGATCCATTGGCAGTTCCAACTCTTTCACAGGTAAATTAATAATAGATAATGTGATAC 
GCTAGAGTGTGGATCTGAATTATTTCATCAGAGAGATATTTTTCCTTAAGCTTATACTTC 
ATCTTCTAATGATTTTCAGCTAATAGAAGAAATCAATTCCGGTGGCCTCAGAATGGACGT 
GGATGATGATGGTATGTTCTCAAATAGAATCAGTGTTGAATTGTTTTGGATTAGAGTTTA 
CTATCATAGTTAATATGAGTTATTTAACACTTGCAGATTCAGATAGTAGTTTACTTGGGA 
AATCAATAAAGTTCTTCAGATCCTCATTCCTAGAACCCTTACTAAAATCATGCAAGGTAA 
ATATCCCATTTCTCTACTTTTACCCACGGTTTTTAAACTGTGCTTGATCATACCAAAAAA 
AGTAAAACGGTTCTGATGTAGTTGTGGAAAGAGTTGTAATATGTTACTGCAATGTCTGCA 
GGAAGAAATAGAGAGTTCATACAAAACCAAGATTGCTAAGACTAAGGATTCATTCAGCTG 
GTGACCTTA
>AT1G67320.1 |  DNA primase large subunit family 
GTAAAAATGGAAGTGATACGCTCTCAGAAGCGAACAGTCTCCAACGACGTCGTTTCAACT 
CCCACGCTTCCTCTGTATCTTACAGCTCCACACATGGAAGTCCGCTTAGAAGAGTTTGAG 
CTCTTCGCCATCGATCGCTTACGAGGTTTCAATCAAATTCAAACCAAAATTTCGCTGCTT 
TCGTGTAGAATCTTTCTGGGGTTTTGAAAAGTTTTTTAAATTTCTTTGTGATAGTTCTTA 
AAGGAGTCTCAGATGGATTAGCTCGTGCACGAAACCCTAACGAAATGGATGATCTTGTAT 
GTTCATAAAAATTTGATATTTTTAGTGACACTTTTCAGATTTTGTTATTCAAATTCAAAT 
TCTTTTTGATTATAGGTAGAGACTTTGTGGAAAGAACATATGAGACTTTCGAATGTTTCA 
GAAATGATCAATAAGGATATAATCTCGCATTTTGTTCTTCGTCTCGTTTATTGTAGATCG 
TAAGCTCTTCTTACTCTTGTGCCTTTGAGTTATTGTTTTGTCTTAGATTTTAGTTTCTAT 
AGTTTTTATTCTTTCTTGATTTTGATTTTTAAGGGATGAATTGAAGAAATGGTTTCTTAG 
CATGGAAACCGCGCTTTTCCGCCATAGATTCCGGCTTAAAAAGATTGAAGAACAGGTACT 
TCTGCCTTTGTTTATTGTTCGATGAGTCGTGATGTGGAATGGCGGGTAAAGTTTGTTTTT 
TTTGTTCCCAGAGAGCAATTGTGGGAGAATTTGGACTACCGTATAAGGCAGTCATAGGTG 
CAGAACTTGAGGTAATAGCTCATTGTCCTACAATATTTCAGGATTGTGGTTTGCAGAGGT 
GAAGAAATTGATCTTTGACCATTTGCAGAGTTTGAAGGAGAGGTTGGGGCTAGTTGCGCG 
TTCACATGGTCAAATTTCTTCTGATGGTAATGATACTAACTAAATCTCAGATCCCTTTTT 
TGTCTCCTAGTTGTGGCTTTTGTTCTCGTCGTGCATGTGTTGATGTTATCTGTTAATATT 
AGTGTAACATAGTAGGGACATGTAACATGTTGTATTTCGATCCGATGTTCACTCTGAGCC 
ATTTAGCAGTAAAACTTGTACCTTTTCTAATGGAAAAATTCTTGTCTTTCTTATCCTTTG 
CAGTTGAAAACATTTACTACAAGGTAGGTCTGCCTCATCTTTTGTATTTGTTCATATACT 
ACAAGCTACGAATTCATTTTATCTGATCAAGTTTCATTTTCACCTGAAAAAGGTTCCTTT 
TGAAGAGGTTCCTGACCTTGTAGCTAGTCGGAGAGTATTATTACAGAAAGGGTTTGCCTT 
TGTAGCTGGTACTCAGGTAAGTAATGCTTTCTATTTCAATTTGAAACAAAACTTCTCTTA 
TGTAGATAGTAGTGTCTCTTTCGTTTAACTCATATTTCCTTATGTCTTTGAGCAGTTGGT 
TTCCCTTGTTGTCACACAATTTCGATCTCATCTATCAAAGGCCCTCATTCTAACAAACAG 
GTTATTCTGGTTTATATGAATATTTAAAAGTTCTTCTCATATATGTCACACCTTAGTAAC 
AAGATTTTCTTTTTGTTTGCAGAAAGTGGACAACTACCATTCGAGAACGAGAAAAAGACA 
GACTAACTCCAGTAAGCACGGACCTGAAATCAATCAACTGCTTAATTTCATGTCCCATGT 
TTCCTTAACTTATCATTGCTCTCATTCAGATCGTAGAAGCGTTATCTACAAGCTACTTGG 
GTCCTGATTATTCTCAAGTGAGGATTGTCCTTTGAAACTTGTTTATACATTTATAGAATT 
GGAATCATTGAAGTTGTTAATATGTCTCTACAGTCAAATGAGTACGCTGACATATCACTT 
AAGGATATTGATCAAGTTTCCAAGAGTTCCTTCCCCCTTTGTATGAGGCATCTATTTGAA 
AAAGTAAGCTGCTTCATGGATTGCAAATCTTCTATTCTTCATTAATTACATAAACTGCTC 
CTATGCAATTGTAACATGTGAACGTTTCACATAGCTTCGAGAAGATCACCATCTAAAACA 
TGGAGGAAGAATGCAACTGGGTCTCTTTTTGAAGGTTTCTCCTTAAACACTACTCCCTTG 
TTAAGTTTTGTTGCATTTGAATGCGACGTGATGCAGATAGATTCACATCTAGATTTGAGG 
CTAGAAGTAATAACATTTCTATTGGTCAAACATCATAGTAAATAAGCCACCAGTTCTTTT 
TCATGTTTTTCTCCAATTTGTACCTCTTTGAAGTTGTATTGCCATGTAGGGTGTGGGTCT 
GAAGTTGGATGACGCCTTAGCGTTTTGGAGAGAAGAATTTACAAAAAAGGTAATTTGATT 
CGCTAAAGTTTCTCGTTCTCCTCACCCTTTTTCCATGTTTTTGTGTGTGCTAGCAAATTT 
GAATAACTAAGTAAGTAATACTGAGCTATTAGATGCATATTTCTCTTTCCGTTTTTATCC 
TCAGGTTGGCTCTGAGAGATTTGATAAAGAGTATGCGTATGCCATTCGCCATAACTATGG 
GAAGGAAGGCAAGAGAACAGTAAGTACCTAACTGTCCTTTCTAGGCCATTTTTTTCCAGA 
GTTCTCATCTCTTATTTATGTCATTGAAAGTGGCAATGATCAGCTTCTGATACCAAATTC 
ACATTGCAATTTCAGGATTATACCCCTTATGCTTGTTCAAAGATCATCACATCTGCTCCT 
GGTGCTGGGGATCATCACGGCTGCCCTTATCGACATTTCAGGTCAGTTTTCTCAGCAAAA 
ATATGTTCTCTTTCCCTGAAAGAAAAGGGTAACCGTTATATATTATTATTCAAATAGTAT 
CTCTTATCCATCACCAACATCTCATATCAACACAACCAGCGGCTGAAAATAATGGAGTTT 
TTGTATATATTTTGATTAGTGAACATAAGAAGATCATCTTTATAGAGACAGAAACTCCTT 
CCTTGGAATTATATATATAATTATGTGTGCAAAAGCGAATCCGAGCGCATTGTAGCTTGC 
TTCATTTGCTCAGCAGAAGTTGTTGCCTTTGGCCTTTGTCTAGCTATAAAGAGAAACAAT 
AATTACATATGTGTAGATGTGTGAATGATTAGGTGAATCCCAAAGTAATGTTTCTGATAC 
ATTCTGCTGCTTTGATGACAGTGAGGATAACCTGAAAGCAGCACTTAGTAGAATGGGATT 
GAGTTCTCGTGGTATGGAAGACGTAATGGATAAAGTGCGGAACAGACATTATCAGGTGAT 
TAATCTTAACTAAGACCTCAAATCTTTTTGGCGATTGTAGCAATAACTAACATGCTCTTC 
TTCATATGCATTTATATGGTAAAGCTCGCATGCACCTTAACCTTTGAAGCTGTTTATGGT 
ACATCATGTGATACTGGTATCAACCATCCCAACCAATACTTTGAAGAAAGTCAGAAGATT 
CTGAAATCCAAGACTCCAGCTGCTCCGGTTTAATCTCCTTATGGTTTCAATGTAATCCGT 
GACATAATATTAAAAATTTAAATCTTTAAGTTGATGCCAAACCTGTTTGATGATAGTACC 
ATGTTTTTAAAAGCCAAGCATACCTATATCAAGAAAAAAAA
>AT5G22010.1 |  AtRFC1 (replication factor C 1) ATP binding / DNA binding / DNA clamp loader/ nucleoside-triphosphatase/ nucleotide binding 
TTAGTAGTAGACACGGCGACCGTTTCTTCTTCTTCTTCTTCGCCTAAATCTCGCTTGTAG 
CCGGAAAATTCGCCGGAGGAGAATCAAGGGTTCGGTTTCGTTTCCCTTTTCGTCTTTTCG 
ATTTTGTAAAATTGACATAACCCTAAATTTAGAAGCCTCTGCGTCGAGTAAATATATTTC 
TGGATTCTGTTGATCTCTACTGTTACTAGGGTTTATGCATGCTTCCAGTTTTTCCGATCA 
AGAGTCTTCGTTTATTCCAAATTCTAATTTCTGGTTTGCTGCAGCATTGTGCTCTTTGGT 
TTGTAGTCGAATTCTCGAGACGGGCAAATGGTAAGTTATTCGTCCTTCCATTAACTTTGC 
TTGATTATCCAGAATGATATATTCTCATCGAGAAAGAGAGAAAGAGAGAAAGAGGGTGTA 
TTAGAGGTATGAAGTATATTGTGCTGATAAAGATATCATCTATTGTACTTGAATTGCAGT 
CGGATATTAGGAAGTGGTTTATGAAAGCTCATGAAAAAGGGAATGGAAGTGCTCCGAAAT 
CGACGTCTTCCAAGGCAGGTCCTGTGAAGAATGCTGCAGAGACTGCACCAATAAAATCAG 
AGCAGGTGAGGTTTCTTCTGCTCTATATATGTTCAGTATGAGGTGTGTATCTTAGTAAAA 
CACTAGAGTAGGTATTGCTAGCAGGACGAAAGTTAGTCGCTCTTTCTTTGTGACATTGTA 
AAGTTGCATTATGTGAGGTTGCATGAATCTTGAAACACATGATATTTGTTTCTTTTGTCT 
TTACTTTGTTTTCAGAGCCACTCATAGGCAACACATATATGCTATTTGCTGTTACAATCA 
TAAATATTTGGTTTGTTTTCTGGAATAAGTGTCGTTTCTGTTAATCATTTGGAACTAATT 
GACAGGCTAGTGAAGACTTGGAAACTGCTGATAGAAGAAAAACGAGCAAGTATTTTGGTA 
AAGATAAAACAAAAGTTAAAGATGAGAAAGAGGTGGAAGCAATTCCTGCCAAGAGGAAAC 
TTAAGACTGAGTCTGATGATTTAGTCAAGCCTCGTCCAAGAAAGGTTACAAAGGTTGTTG 
ATGATGATGATGATGATTTTGATGTACCTATTTCAAGGAAGACTCGTGATACCACTCCCA 
GCAAAAAACTAAAGTCGGGGTCAGGTAGAGGAATTGCAAGTAAAACTGTTGATAACGACG 
ATGATGATGATGGTGAAGATAAGGAGACTCCTCTAAAATCTGCCGGAAGAGGCCGTGGCG 
GTAGAGCTGCTCCAGGGGCCTCAACTGGTGGAAGAGGTAGAGGTGGAGGGCGAGGTGGAT 
TTATGAATTTTGGTGAAAGGAAAGACCCACCGCATAAAGGAGAAAAGGTCTGTATTTTAC 
TTGTTCGAATGTCTTATCTTATCTTGCTGTTACGTGTGGGGCTTAATGTATTTACTGACC 
TGTCTCTGTTTTTCAGGAAGTTCCTGAAGGCACCCCTGATTGCTTAGCTGGATTGACATT 
TGTAATTAGCGGAACACTTGACAGGTATTTCATTTTCTCATACTTTTTTCCTTTTCCCAC 
GTTACTATTCCCTGTTACAGTTTCCTGTACCGTTTTGACATTGCAGTTTAGAAAGAGAAG 
AAGCAGAAGATCTGATTAAGCGGCATGGTGGTCGTATTACAGGCTCTGTTAGCAAGAAAA 
CGGTCTTTCTTCATACCTTTTTTTATTTTTATTTTTGTTAAGTTAAAGGTAATGGCATAA 
AGTTACAATTCTTGTTTTCAGACCTACCTTTTGTGTGATGAAGACATTGGCGGAAGGAAA 
TCTGAAAAAGCTAAAGAGCTGGGGTGTGTCCTCATTGATTGCATATCATTACAGTAACAT 
TTTGAGGTGTTTTTGGTCTTCTAGCATTCTAACTTATAATATTCTGTTCAGCACTAAGTT 
CCTTACAGAGGATGGCCTATTTGACATAATCCGGTCCTCTAAACCTGTAAAAAAGTCTCT 
ACCTGAAAGGTCAAACAAAGGCACTGAAAAAATCTGTGCACCACCGAAGACAAGTCCTCA 
GAAAGAAGAAACAAGAGGTAGGAACTGTAGTCTTGTATAGCATGCACTTTGGGTATTTGT 
GTCTTCAATTTATTAATCTGTTGCCAGACATTGCTCCTTTGGCTTCAATAAACCCTTGAG 
CCATTTACTCAGTATCCATTTCTTCTCAGTTATCCTCACAGTTAATAGTGATTACAATCA 
TTTTTTAGGAAAACCTTTGGCAAAAAGTTCGCCCAAAAAGGTCCCCCCGGCGAAAGGAAA 
AAATAAAATTATCGAGACTTCCTTGCCCTGGACGGAAAAATACAGACCGAAGGTTCCAAA 
TGAGATTGTTGGGAATCAGTCGTTGGTATGTGATCGAAACTACTGTATGTTGGTTTTTGT 
TCAACGACATGAAAATGATGGATCCTTTATCAAATCGATTGCAGGTTACTCAACTTCACA 
ACTGGCTGTCCCACTGGCATGATCAATTTGGAGGTACTGGAAGTAAAGGAAAGGGGAAGA 
AATTGAATGATGCTGGTTCCAAGAAAGCTGTACTTTTGAGTGGAACACCTGGTATTGGAA 
AAACAACATCAGCAAAGTTGGTTAGTCAGATGCTTGGTTTCCAGGCAGTTGAGGTTAGCT 
CATGTTTCTTTAAATTTCATTGGTTAGTGATACAATTTCTTGCACATGCTTGAAAACAAA 
TGCAATCTGCTTTCTATTTAGGTTAATGCTAGTGACAGTCGTGGAAAGGCGAACTCGAAT 
ATTGCCAAAGGAATTGGTGGCAGCAATGCAAATTCTGTAAAAGAACTTGTCAATAACGAA 
GCCATGGCTGCCAACTTCGATAGGTATGTTGGTGTTTGACTGTTTGTTTTATTCCCCCTA 
ATGTTGATAACTGGTTCTAGATGCTTGTAGTTTTTTCCTGACTTGGTGGAAGATTCGATC 
TTCAGGTCAAAGCACCCGAAGACTGTTCTAATCATGGATGAAGTAGATGGAATGTCTGCA 
GGCGACAGGGGAGGTGTTGCAGATCTTATTGCTAGCATTAAAATATCAAAGATTCCTATC 
ATCTGCATTTGTAATGACCGATATAGTCAAAAACTGAAGAGTTTAGTAAACTACTGTCTT 
CCCCTCAATTACCGGAAGCCCACGAAACAGCAGGTTGGATTTAGATGATTGTTTGTCCTT 
TCTGCGTTTTTTTAAGGATTATGCACAGGATTTTCATTCTATGTACCATTATTAGTCCTT 
GAGCTCTTCATTATCTTTTCGATTTGTCTTTTATTGCAGATGGCAAAAAGGCTGATGCAT 
ATTGCTAAGGCAGAAGGCCTTGAAATTAATGAAGTAAGATTATGTACTTTGTTTCTTTAC 
TTCCACTAGCTTCTGTAAGTAATGCTAGCCAGTTCCATATAACTTACATCTGCTTGGGAC 
TATTGTCTTTGCGAAAAATCTGGTTCGTGTCAGCCCCCTTTTACTAATAAGAAGTATGAT 
AATAGAAGTATTAGATTTGGTGTGAAGTATAAGTGTCATGCAACGCTCGTTTCCTTAAAG 
CCTACTTTTGCGTTTCTTGATCTCTTTGATTCTATTTTGTGGAATTCAAGTGCTTGCGTA 
TACCAGTTGTAATGGATCAAAGACGTAAGAATGGAACTTGAACCCTGTATTGTCTGTGAC 
TCGTCCTGTATTCTAATACTTCTATCTTTTTCTGCTTAATCTCATAAGCATTTTGGTGGT 
GGGCGTTATGTGCTACCAGTTTGTCCCCTGAACATGATATATCTTTTCTTTTTGTCAGAT 
TGCCCTGGAAGAACTCGCTGAGAGAGTGAATGGTGACATACGATTGGCCGTAAATCAGCT 
CCAATATATGAGCCTGTCCATGTCAGTCATCAAATACGATGATATCAGGCAGCGCCTGCT 
AAGCAGTGCGAAGGATGAAGATATTTCCCCTTTCACAGCTGTTGACAAGTAATGTCTGAA 
GTCCTTTAGTTTAGTTTATCAATGCACATAGTATTGTTTGCCAAACTTTTTGAGTTAAGT 
CTTATAGCTGCTGTTATAGAAGAAATTTCTTACCCTGGTTTTGTCGTAAAAAGTTTGGTT 
TTAAGCGGTCTGGACATTTCATAATTTAATTATAAATGATTCCAGGTTGTTTGGTTACAA 
TGGTGGGAAGCTGAGAATGGATGAACGGATTGACCTAAGCATGAGTGATCCGGATTTGGT 
TCCCCTACTTATACAGGTATATTTTTTGGATTCTTGTGGGGTTATTGTGATATATCTTTT 
GGAACGGAAAATTGTTTCCTGCTACCTCTGACATTAGTGATTTCTAAAACTTGTATTCCC 
AACATGAAATTTGTACCTCATTTACCGTTAAATTTAAAGATTATTTATTTTCTTTCCATC 
TGGGCAGGAAAACTATCTCAATTATAGGCCAAGCGGTAAAGATGAGGCAAAACGAATGGA 
TTTACTCGCTCGTGCTGCTGAATCTATTGCCGATGGAGATATTATCAACGTGCAGATTCG 
AAGATACAGACAATGGCAGCTCTCTCAATCTTGCTGTGTTGCATCTTCTATTCTCCCGTA 
AGTTGCTTCCAGTTCTTGAGAATAAAATTGATCCTTCTTTACCAGAAGTACTATTTTATT 
ATCTCTACAAGAAGTTTGTGTTACCGATGAATATGCCATGTTAATCATCTAGTGTTTTCA 
TTTTGTTTCTATTTTTTCTATACACTAAGTTCCTCTGTGATGGAGATCGAGTTTAATAAA 
CCATATGCTGCCGTGTATATTCATATGTGTTGTTTTTCTTTGTATGGATTTCGGATCTCC 
GGTATAGAATTTCAGGGAGAAAAATGATATGCTTTCTAATATTTGAGAACTGACGTGTAC 
TTGTTTTGTTTGAATAGAGCTTCATTGTTGCATGGATCAAGGGAGGTACTCGAGCAGGTA 
ATAGTCTTTCAGTAAAGCGCATTACACCCTATGGATGTAACCTGGAATCTTTTGCTATCA 
TTCAATGTGCCTCCTTTTTCTGATGATGCATGACCGTAATCAACATGATTTCTGCATTTA 
AGATTTTGAGTCTGCAAGTCGGAGTCAGTTCTTTATTAGGTTGTAATTTTAAGCATGATT 
ACAATGGCGTATATAGATGGTTATGGTATGAGCCCTCCTTTTGTCGCTCTGGAGCTGCCT 
GAAATATCTTGGTTCAGATTAACCATGCATGATTACTGAATGCAGGGAGAGCGTAATTTC 
AATAGATTTGGTGGGTGGCTTGGCAAGAATTCTACTGCGGGAAAAAATAGACGGTTAATG 
GAGGATCTGCATGTTCATGTCCTTGCTTCCCGTGAATCCAGCGCTGGAAGGTTGTTTCCA 
CCTGTACAGTTAGCTTTATGATTTACTTCTTTCTGCTAGTGAAATGTTTCCTTTTCTCTG 
CGATTTACTACTCTGATAGTCTTTAGACATTGTGTATTTTAGCTGCTACCTTCCCTTTCT 
TCATATCTTATCCTTTGTGTATATACTGCCTTTCTTCTTAGCAATATTCTGTGATATATT 
TTCTTATTTCAACTTTCTGACAAACGTCAACATTAACCACAGGGAGACACTTCGTGTTGA 
TTATCTTCCCCTTCTCTTGAGCCGCTTGACTAGCCCACTTCAGACACTGCCTAAGGTTTG 
ACTTATTAAGATGTGTTTATAAAATCAAGGATAAGGTTAATATTATAAGATATTATATAT 
GTTATCTGTTACTTGATCATATATATATATGTGATAATATTTACTCAGGATGAAGCAGTT 
TCAGAAGTTGTTGATTTCATGAACTCCTACTCTATAAGCCAGGAGGACTTTGATACTATT 
TTGGAGTTGGGAAAATTTAAGGTATACACGATTTCCTTTTTCATGGGATATCACTGCCAC 
AGCTACGACAATGAATCTTCTCTAATGTACTGCAAACTTTACAAATCAGGGACGTGAAAA 
TCCGATGGAGGGTGTTCCACCTCCAGTTAAAGCAGCTTTGACCAAAAAATATAATGAGAT 
GAATAAAACCAGAATGGTACGTGTGGCGGACATGGTGCAGCTTCCGGGAGTGAAAAAGGC 
GCCAAAGAAGCGAATAGCTGCTATGCTGGAACCAACTGTTGATAGTTTGAGAGATGAAGA 
TGGTGAGCCGTTAGCAGATAATGAAGAAGGAAATGGATCAGACGCTGAAGAAGACTCAGG 
TACTATACATCTTTGTGAACTTATTTGTGTAGATTCAGGTAACTGGATCTGTATAATCAA 
AGACTGAGCCTCAGAAAGACATTACAAAATTACCTTCGATATCTAATATGACTTGGAAGT 
AGACCAGACGAAATCCTGACTTGGTTTCTTCTCTGTTTTGTTTCGATCTTCCAGAAGAAG 
CAACCGATGGAGAAAAGCTGGAGTCCAATCTTAAAAATCTGAATGCTAGAGGTTCGTCTT 
GTTACTGCTTTAGATAGTTGTCTTTACCTTAAGAAAGCCATTCAGTCTAGAACCTAAATT 
CATATATACTGGCTCTGAATGATGACGACTTTCCAAAAACTTGACTCCTTATCCCTCTCT 
GGGCGGGGATCTGCAAGTCTTAACGGAATATAATCGGGTTGCAGGGATCCAAGTGGAATT 
GGATTTGAAAGGAGCTGGAAGCTCAGGTTCAAGAAAGGCGGCTGGTAAAGGCAGAGGCAG 
AGGGAAAGCAGCTGATACGTCTGCTGAGAAGAAAGCTACAGGAAGAGGCTCTGGTGCCAA 
GAGAAAGAGATAAGAAGCCAATCGCATCGGTTTCCAGGCAAATTTTTTCCAAGAAGTCTC 
TATTGGAATCTCCATGTCTGTACAACGAAGGTTTTTTTTTTCTGGATTGGCAGATGAATT 
TATGATGTTTCTGGGGTTTAAGAGCGGATTCTAGTTTTGCTTGAACTCAGAATGCCTGCC 
ATTTAACCGTTCGACTAATGATGAACACTAGTATGGTCAAAATGAACGCAGAATGCAAAT 
GGATGAAGATTTTTGT
>AT1G77470.1 |  replication factor C 36 kDA putative 
AGAAAATGGCGGAAGGAAAGAGCCTTGAGGGTTTGGCGCCATTACCGGGGAGAGAGTGAA 
ATTAGGGCTGAGCGAGAGAGATTCTGAAATAATTTCTTTTACGGCGGTGAAGATGACTGA 
GCTAACGTCGGCGATGGACATTGACGTAGACGAAATTCAGCCTCGCAAGCCGATAAACAA 
GGGCAAAGACGTCGTCGGTTTTGGACCTCCGCCGCAGAGTAAGGCGACGCCTTGGGTTGA 
GAAGTATCGACCTCAGTCGCTTGATGACGTGGCTGCACATCGTGACATTATTGATACGAG 
TAATTGAACTTTACACATAACACTCTCTCCCTCTATTTCCCCATACCCTAGGGTTTTAGG 
GATTTAGTGTTTACAGTTTTCTAAAATTGAAATTGATGTTGTTTCATATATGATTGAGTA 
GGCTAATGCATGTTATAGCTTATTACCTATATGCTCACTGAAGGTGTTGTTGTGATTTTG 
AAAACAGTTGATAGGCTGACCAATGAGAACAAATTGCCCCATCTTCTGTTGTATGGTCCT 
CCCGGTACTGGCAAAACATCCACCATTCTAGCTGTTGCCCGGAAACTATATGGACCAAAG 
TACCGGAATATGATTCTTGAACTGAACGCATCAGACGATAGAGGAATCGATGTTGTAAGG 
CAGCAGATTCAAGATTTCGCTAGCACGCAGAGTTTCTCTTTGTGAGTATCCTATCATGTT 
TCCATTTGTGCATTTAGATACCTCAAAAACTGGCTTTTATTACTCATAATATCGAATGCA 
TTGTGATGGGCGTGAGCTATGTTTAAATGTAGCATCATAAGTTTGTGTTTAACAAGTTTG 
CTGTGGATATAGAAATAAAAGAAAATTCATGATTGTAGAGGAAAATCTTCGGTGAAGTTG 
GTTTTGCTAGATGAAGCAGATGCCATGACAAAAGATGCTCAGTTTGCCTTGCGTAGAGGT 
AAAACCTTTTAGTGTTATCTAGCTCTCTCTGGTTATTTTGCTTAAGCACGGTTCTAACTT 
CTAACATCTTTGGCGTCCTTATTTTCTTAAATTTTGCAAGTGATTGAGAAATACACTAAG 
AGTACTAGGTTTGCGCTCATTGGAAACCATGTCAATAAGATCATCCCAGCTTTGCAGTCG 
AGATGTACTCGATTTAGATTTGCCCCTCTTGATGGAGTTCATATGAGTCAACGTCTTAAA 
CATGTAATAGAAGCTGAAAGGTGAGAATTATAGCTATTTCGGTCTTGTAAACTTTCTTAT 
TGTGTTTTCTTCATCCTCCCTCTTCACTATTTGTTTCTTTTAACCCTTTGTTTTGTGCTT 
CCTTTTCATAATTGGACTAGGCTTGTTGTAAGTGACTGTGGTTTGGCAGCTCTTGTACGG 
CTGAGCAATGGGGACATGAGAAAAGCATTGAACATTTTGCAGGTTCTGTAATATTTCCTT 
TTGGTTCTGTCACATAATCTACAATTGTAAATCTAAAAAAGATAATACATTTCAATCACT 
ATGAATGGATCTGTAAAAATTTCTAACGGATTTATTGGTGTGGACAGTCAACGCATATGG 
CGTCAAAGGAAATTACAGAGGAAGAGTCAAAGCAAATTACAGAGGAAGACGTTTACCTCT 
GCACCGGAAACCCATTGCCCAAGGACATTGAGCAGATATCTCACTGGCTTCTGAATAAAC 
CATTTGATGAGTGCTACAAAGGTACTATATCATTTTCTGAGACCTACAAAAGTATTGAAC 
GATAACTGATATTTACTCACTTAATGATTCCATGGTCCTGACTCCTGAGTCCTGATTATT 
ACTTCACCCTGCAGACGTTTCAGAAATCAAGACGAGAAAAGGACTTGCCATTGTTGATAT 
CGTCAAAGAGATTACCTTGTGAGTGACATACTTGGTTGCTGCTTCTAATGCTGTTTTATC 
CGTACGTCTGTGAACTGAGTTTTGTTTCTACATCAGGTTTATTTTTAAAATCAAGATGCC 
TTCCGCTGTCAGAGTTCAACTGATAAACGATTTGGCAGACATTGAGTTAGTATCTTTTGC 
ATCTTAAACTTAAAATTAGGATTGCCTGGAGTAGAATATTTAAGCTTGTGTTATCCACAA 
TCTTTTTTTTTTTGTAATTTCGAGTCGTTTTACTGTTTATAGGTACAGATTAAGTTTTGG 
TTGCAACGACAAACTGCAGCTTGGAGCTATCATTTCTACTTTCACACATGCCCGGTCTAT 
CATTGTTGGTGCAGCAAAGTAAACCATGTTTTTACCATTTTGGAACCCGCAGTAGCTCGC 
CACCTTAACAAACCGCTAGAATGTTTTATCTCCGTGATGTTTTCCTGATAGTCTCTGTAC 
ATTTTGTGGCGTTTGTGACCAATAGGCTTGCTTTTTATTTCTTATGAAGAGTTTCAATGC 
CACCTTGTTATCCTCTTCTCATCTCCTCGAATTTGTAACTTTCAATTTCTTGATCAAATT 
ATGTTTTAATGATCTTGTGGTCGTGTCT
>AT5G27740.1 |  EMB2775 (EMBRYO DEFECTIVE 2775) DNA binding / nucleoside-triphosphatase/ nucleotide binding 
AAAAGAGAGGGTTTGGTCCTATGACCTGACGTGGGAATGTGTAAGCGAAAGAAAAATAGC 
TAAAGACGTCTCACACAAAAAAGCTGCTAGAGGAAGAAGACGATTCACTTCTTTCCCGCC 
ACTTTCACTATCTTCTCCGGTGGTGAGCAAAGATGTTGTGGGTCGACAAGTACAGGCCGA 
AATCACTCGACAAGGTCATAGTTCATGAAGATATCGCCCAAAAACTCAAGAAATTGGTAC 
GCCTTTTTGTTCAAACCCTAGGTAATTTTTTGGAGGGGTTTTCGATGAATTGGAAGCTAA 
TTTTCGATTCTCCTCTTAGGTTTCCGAGCAAGATTGTCCACATTTGCTCTTTTATGGGCC 
GTCAGGTTCTGGTAAGAAAACCCTAATTATGGCTCTTCTCAAGCAGATATATGGGGCCAG 
TGCAGAGAAGGTAATCCTTCTTTCTTATACCCTAATATCGTTCTGATTACTAAAAGATGA 
AGACTTTGAACCCTAATGTTCTTTAGCAAAGCAACATTAGGAAGTTATTCTCACTAGCAC 
ATACTCTTTATTTTCTCTTAGATTGATGTTTATCTTCTTATTGCTACTTTCTTTTGTATG 
TGGCAACTGAGAAACTGCTTGATTTACTTGACTTCAGGTGAAAGTGGAGAACAGGGCATG 
GAAAGTTGATGTGAGTTGCATTGCTTTAATTTTGAAGTTCTCGCTGCTTGATATCCATAG 
TCGTCTTGTGTCCTTGTTGGATCAGTAAATGTGGTTAAGATTGTATCATCCTACTTGTGA 
AACACAGAGATGTGAATTGTGTTTGCTGTCAATTTCTTTAGTGGGTGGTCCTCCTAGGCG 
GATTCTTCTTTTATACATGACAACATTGTGATACATTACGCAGGCTGGGAGTAGAACTAT 
TGATCTGGAGCTCACTACATTATCAAGCACCAATCATGTGGAACTTACTCCAAGTGATGC 
AGGCTTTCAGGACAGATATATTGTTCAGGAGATAATTAAAGAAATGGCCAAGAACAGACC 
AATTGACACGAAAGGAAAGAAGGGATATAAGGGTAAGAATTACTGTTCCCCTTGTTCTAT 
ATAATAGTATCATTAGTGTAGACAATTTGGATTACAATGGCTTATAGTAGTTATTTGAAG 
CATCTATGAAGAGTGAGGCTTTTATAAGGGCATTTGATGCCATCTTCAATCCGTATACTG 
CTGTGGTAGACTGGGTCTACATTTTATGGTTCGTAATATAGTTTTCGTTTACTTTTTCAT 
GTTCAATTAGATGGTTGCCTCGTATATCTAGTTTTAAGAGTTCTTGTTCAGCTGAGTGCT 
TCTTTATACATTTAGATGGTTCTCTGTTTTTGATTATCAACTTATCACTGGTCTCTAACA 
TCCCTTTATGACCTGCCAAAGTAGTTCAACTTCTTTTCACATATGGATGTTGGAAGATGT 
CTGATACATGCAGATTTTTTTTTTTTGTTTCGGCAGTGTTGGTATTAAATGAGGTTGACA 
AGCTCTCACGAGAAGCTCAACATTCTCTGCGGAGAACAATGGAGAAATACAGCTCATCTT 
GCCGTCTCATCTTATGCTGCAACAGCTCTTCGAAGGTTACCGAAGCCATTAAGTCTCGTT 
GTCTCAATGTGCGCATAAATGCACCTTCGCAGGAAGAGGTACATAAAATCACCCTATGTT 
TTTGTAAAATATTGTTTATACAATAAAGGAGGCTTTGTGTTTAGTTCGGTGTTGAGAAAC 
CACATCTTGTTTTGTGGCTTTTAGTGGCTATCTTAGAGCAAACTCATATCAAATCCTGTC 
TTAAAAATGCGCATCCTATGGGAGATGAGATCTCGAAATTGCATTTCGTATTTTTCCTTT 
AAATCAACTCGATGTAGAAATCGATTTGTACGTATTCTTGTGTACATTTCACTAGTTTGG 
CAAGAAAAAACAAGTTAAATTGTCTTTATATATCTGCTTTTATCCTTACTGAGAAATTTT 
TCATGACTGTCGGCGTTCTTGTGATTATTCTATTGTTCATGTGATTTAAAAATATACTAT 
TAAGAATCTGTAGTTGCTATCAGAAATATTACCTAAGATTCAGTGTTTGCTTCATTTGGC 
CTTTGTAAACTTTCTTGCGAAAACCAGTATGCAAGATTATTGTTAACTAAAATGTAGCTC 
TCTGGTACCAGATAGTGAAAGTGTTGGAGTTCGTTGCAAAGAAAGAAAGTCTGCAACTGC 
CCCAGGGTTTTGCTGCTCGTATTGCTGAAAAATCAAATCGCAGTCTAAGAAGAGCTATTT 
TGTCACTTGAAACTTGTCGTGTCCAAAAGTAAGGATCAGAAACTTTATATATGCAGATAA 
TCAATGAGTTTGATTCTTTTGTTGTTTCATGTTTAGAAAATTTAACTTTACATTACTTTC 
AACTTGATATTCATTTTTTCTTTGTAGCTATCCGTTCACAGGTAACCAAGTGATATCTCC 
CATGGATTGGGAAGAGTATGTTGCTGAAATAGCAACTGACATGATGAAAGAACAAAGCCC 
TAAAAAGTCAGACTCTAGTGAATCATTTACTTTTACAAAATAGAACTTCAAAGATAACTT 
TGACTTTATCATCTCTTGTGTGCTTCTTCAGGTTATTTCAGGTGCGTGGAAAGGTGTACG 
AATTACTAGTTAATTGTATTCCACCAGAAGTCATTCTAAAGGTCTTAAACATAACCTTAT 
TCACTTATATATAATTATGTATTTGGGTCCCTTTCTCTTTCATTTTACTCATAGTTTATG 
CTTTCCCAGAGACTCCTTCATGAATTGCTGAAGAAACTGGACTCAGAGCTAAAGCTTGAA 
GTCTGCCACTGGGCTGCATATTATGTAAGAGTATTTTTAAACGGCTCTTAGTCTTAGATT 
GCGAATTTGATTTCTCCTCACCATTATCTCAACTTCTGTGTGCTCATTTGAGACTGAGTT 
ACCATTCTTCTGTTTTGGTGGCTTGCTTGATGATATGTCTTTGGCCCTTCTTACAGGAAC 
ATCGGATGCGATTAGGTCAGAAAGCCATATTTCACATAGAAGGTATATAAACTCTTTCAG 
TTATTGCATATGGCCGATATAGGCTACATAAAAAATATCATCTTCTTACTTTGAGTTGGT 
GTTACACTGCAGCATTTGTGGCCAAGTTTATGAGCATATACAAAAACTTCCTCATTTCAA 
CGTTTGGGTAGAGAAGAGAGGCTTCAAATCGAGGAAAAGAAGATAGACTTGCACTTGTAC 
TGTTTATTTTATGCGTGATCCGAGGTTCTGAAGTTAAGGTTTCTGTTTAGTGGGTCGTCT 
TAACTTTTGATGTTTGAATTTGTTTCCCTCAACTTGACTGTCTTAATTTTAATAAACTAT 
GGAAGCGGTTTGGCCTATCAGTCTGC
>AT1G63160.1 |  replication factor C 40 kDa putative 
AAACCAGAAAACCCTCCAAATCTCACCGGTCGGAGATTCCTTCTCTTCCGACTGATAATG 
GCGTCTTCTTCATCAACCTCTACCGGTGACGGATACAATGAACCATGGGTGGAGAAATAC 
AGGCCGAGCAAAGTAGTCGATATCGTTGGAAACGAAGACGCCGTCTCCAGACTTCAAGTC 
ATTGCTCGCGACGGCAACATGCCTAATCTTATCCTTTCCGTAAGATTTTACTCTTCTGTT 
GACACTCTTTGATTTAAACCCTCCTCGAATTTGCTAAAAAGTTTTAGGTTTGATGAAAAC 
TTGATCAATTAGGGCATTTTGGGTTTGTTTACTGTGTAGATTTCATGATAAAGCTTAGAT 
TTTGAGGGTTTTTAATCAATTTCTATTGTCTGCCAAAGTTAATGAAGGTTTGATTTTTAG 
AAAATCTCTGTGTTTAGTATTACTTGTGGAGATTTGATATATGATTTTGTGTTGTTTGGT 
TGTATATCCTTAGGGTCCTCCTGGAACAGGTAAAACCACAAGCATTTTGGCTCTTGCTCA 
TGAGCTCCTTGGCACGAATTACAAGGAGGCTGTTCTGGAGTTGAATGCATCTGATGATAG 
GTATGTGATGCCAATCTTTTACCTATGGGATGTTGTTCTATCTTCAATCGTTGTTTGGTT 
AGACATCTTCAATGTTCTGTTATGTTTGTAGGGGTATTGATGTTGTAAGGAACAAAATTA 
AGATGTTTGCGCAGAAGAAAGTAACACTTCCTCCAGGGCGTCATAAGGTTGTTATCCTAG 
ATGAAGCTGACAGGTTAGTGACTTTTACTTGAGTATTCCTTCTCAAGTTGAATTGTTCCA 
GTTAAGTGTTTTTTTTTCTGACTTTCTGTTTTCGGTTTCTAAAAAACTAGTATGACATCT 
GGAGCACAACAAGCATTGAGGAGAACGATTGAAATCTATTCGAACTCTACGCGGTTTGCA 
CTTGCTTGTAATACATCAGCCAAGATTATTGAGCCCATTCAGAGTAGATGTGCCTTAGTT 
CGATTCTCTAGATTATCTGATCAGCAGATACTAGGCCGTCTCTTGGTGGTGGTTGCAGCA 
GAGAAAGTACGGATTTGCCACTTTTCTTTCATTCGACATGTTTACTTACTGCAATTTTGA 
AAATTTTCTAATTGCTTATGTTTTCAATCTCTCAAGGTTCCGTATGTGCCTGAAGGCCTT 
GAGGCGATAATCTTTACAGCTGATGGTGACATGAGGCAAGCTCTGAACAACTTGCAAGCC 
ACATTCAGCGGGTTTTCGTTTGTCAACCAAGAAAACGTCTTCAAGGTTTGAAACAAAACC 
TTAATTCACTTTGGCTTATAAAACACATTGGTTTCATATCATCAATCAAAGATCTCTTCA 
CTTAGGTCTGTGACCAGCCTCACCCGCTTCATGTCAAGAACATTGTTCGCAATGTGTTGG 
AAAGTAAGTTTGACATCGCCTGTGACGGCTTAAAGCAGCTCTATGATTTGGGCTACTCTC 
CAACCGACATTATCACAACGCTTTTCCGTATAATAAAGAATTACGATATGGCTGAGTATC 
TGAAACTTGAGTTCATGAAGGTATACATCTGATTCTCCTTGACAGCTCAAAACATCCAAA 
CTTTCGTCTAACACCAATGCTTTTCTTCAGGAAACTGGATTTGCGCATATGAGAATCTGT 
GATGGAGTTGGATCTTATCTTCAGCTATGTGGTCTTCTGGCTAAGTTATCCATTGTTCGT 
GAAACAGCGAAAGCACCTTAAGTTAGGTAACTTCCACTCATCTCTAGTGATGAACTGGTG 
GCCGGTCTATGTTTAAACCAAGTTGGTTAAATCTCGTTGTTTGAGAATTCGGATAGATGT 
TGGAACTTCCATGCTGTATTGCTCTGTTTTCTAGATTTGAATTGCTTGTGAATGTTTCTG 
AATATTAAGCTTAATCCTAACCAGTTTGGTATACCAACACATTTT
>AT1G15920.2 |  CCR4-NOT transcription complex protein putative 
TTTTGGTGCAGAAACAAGAAAACTTGTGGCGAAGAGCTAATAAATAGATTCAGAGGAGAA 
ATAGAGAGAGACAGAGAGCGAGGGACAAAAAAAAATCGATTGATAATTTTTTTCGGCAGA 
GTCGAGAAAATTTTGATATATTAATATCCGTAATTCCTTAAAAAGCCTCCTCTTCGTCTT 
CTTCTTCTTCTCCTCCCCAGTTTCGCATCATTCTCTTCGATAACCGCCACATCCTCTGAA 
ACCCTAATCTGGAGAATCGCCGCCTTCTCCAGAAAATATCTATTTCTATACCTTGTTCGT 
TTGATTTCCAGGTTCGAATCACCGCCTCCTCGTTTCTCCATTTCCGTGTTTGTTTGTTTT 
GGTTTCGTTTGAATCTTTCTGCTAGATATATTCGTTGTCTTTGGGATTTTGATTGTTCTT 
GGCATTTTGAAATTGCTTTGCAGATACTGATGAAACCGGATCGGATCTTTCTCTAGATCC 
GTTCTAGGTTTATCGATTTCTTTCTATCAATCTCTCGCATCCGGATGCTTTTTGCAAGTT 
CTTGAAGCGGATTCATCATAAATCGACAGAGAAATGTCGCAGGCTCCGAATCCAGAAGAA 
GAAGACGACACGATTGAAATCCGCGAGGTCTGGAACCATAACCTTGAACAAGAGATGGCT 
CTGATTGAACAATCCATCGACGATTTCCCTTACGTAGCCATGGACACAGAGTTCCCAGGA 
ATCGTTTGCAAGACAGTAACGGCGAATCCAAACCCAAACCCATACTCTATACACTACGAA 
TACAACTACGATACCTTGAAGGCGAACGTGAATATGCTCAAGTTGATTCAGCTCGGTCTC 
ACCTTATCAGATGAGAAAGGAAACTTACCAACCTGTGGAACCAACAAGCAATGCATCTGG 
CAATTCAATTTCAGAGAATTCAATGTCATATCCGACATGTTCGCCTTGGATTCCATCGAA 
CTCCTCCGTAAGTCAGCCATCGATTTGGAGAAGAACAACGAATGCGGTGTAGACGCAAAG 
AGATTCGCAGAGCTTCTAATGGGTTCAGGAGTAGTGCTAAACGATAAGATACATTGGGTG 
ACATTCCATTGCGGATACGATTTTGGGTACTTGCTGAAACTCTTGTCAGGGAAAGAATTG 
CCGGAGGAGATATCGGACTTCTTTGATCAGATGGAGAAGTTTTTCCCGGTAGTGTATGAT 
ATCAAATACTTGATGGGATTCTGTACTAACCTCTATGGAGGTCTGGAGAAAATAGCGGAG 
TTACTTGGTGTTAAACGAGTTGGGATTTCTCACCAGGCTGGATCAGATAGCTTGTTAACG 
TTGCGTACTTTCATCAAGATGAAAGAGTTCTTCTTCACTGGTTCCTTGCTCAAGTATTCT 
GGTTTTTTGTTTGGATTAGATAATCCTCGGTTGCTCACTGGATCCAAAAATTAAAATTGA 
AAAAAAAAATAAAAAAAATGAAAAAATTTAAAACTGTTTTTTGGTGTCTTTTTGGTTAGG 
CTGCTTTTAGGCTATGTGGAATTACAAAATAGGTGTTAAGAGCGTATATGATGCACAAGA 
ATTTAGTCACTAAAAAGGTTATTCCATGATCTTATTAGGTGAAGAAGAATTGTAGAAATG 
AAATCATGTATTTAACATTTGGTTTAGTGAGTTTGATTGTTATGGTGAAATGATTCTGCA 
GTTTTCTTATTATCGATGATACCATTTCGTGGAATTGCGTTTTATATTTCGCAAAACTAT 
TGACAATAACAAACAAATTTC
>AT1G15920.2 |  CCR4-NOT transcription complex protein putative 
TTTTGGTGCAGAAACAAGAAAACTTGTGGCGAAGAGCTAATAAATAGATTCAGAGGAGAA 
ATAGAGAGAGACAGAGAGCGAGGGACAAAAAAAAATCGATTGATAATTTTTTTCGGCAGA 
GTCGAGAAAATTTTGATATATTAATATCCGTAATTCCTTAAAAAGCCTCCTCTTCGTCTT 
CTTCTTCTTCTCCTCCCCAGTTTCGCATCATTCTCTTCGATAACCGCCACATCCTCTGAA 
ACCCTAATCTGGAGAATCGCCGCCTTCTCCAGAAAATATCTATTTCTATACCTTGTTCGT 
TTGATTTCCAGGTTCGAATCACCGCCTCCTCGTTTCTCCATTTCCGTGTTTGTTTGTTTT 
GGTTTCGTTTGAATCTTTCTGCTAGATATATTCGTTGTCTTTGGGATTTTGATTGTTCTT 
GGCATTTTGAAATTGCTTTGCAGATACTGATGAAACCGGATCGGATCTTTCTCTAGATCC 
GTTCTAGGTTTATCGATTTCTTTCTATCAATCTCTCGCATCCGGATGCTTTTTGCAAGTT 
CTTGAAGCGGATTCATCATAAATCGACAGAGAAATGTCGCAGGCTCCGAATCCAGAAGAA 
GAAGACGACACGATTGAAATCCGCGAGGTCTGGAACCATAACCTTGAACAAGAGATGGCT 
CTGATTGAACAATCCATCGACGATTTCCCTTACGTAGCCATGGACACAGAGTTCCCAGGA 
ATCGTTTGCAAGACAGTAACGGCGAATCCAAACCCAAACCCATACTCTATACACTACGAA 
TACAACTACGATACCTTGAAGGCGAACGTGAATATGCTCAAGTTGATTCAGCTCGGTCTC 
ACCTTATCAGATGAGAAAGGAAACTTACCAACCTGTGGAACCAACAAGCAATGCATCTGG 
CAATTCAATTTCAGAGAATTCAATGTCATATCCGACATGTTCGCCTTGGATTCCATCGAA 
CTCCTCCGTAAGTCAGCCATCGATTTGGAGAAGAACAACGAATGCGGTGTAGACGCAAAG 
AGATTCGCAGAGCTTCTAATGGGTTCAGGAGTAGTGCTAAACGATAAGATACATTGGGTG 
ACATTCCATTGCGGATACGATTTTGGGTACTTGCTGAAACTCTTGTCAGGGAAAGAATTG 
CCGGAGGAGATATCGGACTTCTTTGATCAGATGGAGAAGTTTTTCCCGGTAGTGTATGAT 
ATCAAATACTTGATGGGATTCTGTACTAACCTCTATGGAGGTCTGGAGAAAATAGCGGAG 
TTACTTGGTGTTAAACGAGTTGGGATTTCTCACCAGGCTGGATCAGATAGCTTGTTAACG 
TTGCGTACTTTCATCAAGATGAAAGAGTTCTTCTTCACTGGTTCCTTGCTCAAGTATTCT 
GGTTTTTTGTTTGGATTAGATAATCCTCGGTTGCTCACTGGATCCAAAAATTAAAATTGA 
AAAAAAAAATAAAAAAAATGAAAAAATTTAAAACTGTTTTTTGGTGTCTTTTTGGTTAGG 
CTGCTTTTAGGCTATGTGGAATTACAAAATAGGTGTTAAGAGCGTATATGATGCACAAGA 
ATTTAGTCACTAAAAAGGTTATTCCATGATCTTATTAGGTGAAGAAGAATTGTAGAAATG 
AAATCATGTATTTAACATTTGGTTTAGTGAGTTTGATTGTTATGGTGAAATGATTCTGCA 
GTTTTCTTATTATCGATGATACCATTTCGTGGAATTGCGTTTTATATTTCGCAAAACTAT 
TGACAATAACAAACAAATTTC
>AT1G15920.1 |  CCR4-NOT transcription complex protein putative 
CTCTTCGTCTTCTTCTTCTTCTCCTCCCCAGTTTCGCATCATTCTCTTCGATAACCGCCA 
CATCCTCTGAAACCCTAATCTGGAGAATCGCCGCCTTCTCCAGAAAATATCTATTTCTAT 
ACCTTGTTCGTTTGATTTCCAGGTTCGAATCACCGCCTCCTCGTTTCTCCATTTCCGTGT 
TTGTTTGTTTTGGTTTCGTTTGAATCTTTCTGCTAGATATATTCGTTGTCTTTGGGATTT 
TGATTGTTCTTGGCATTTTGAAATTGCTTTGCAGATACTGATGAAACCGGATCGGATCTT 
TCTCTAGATCCGTTCTAGGTTTATCGATTTCTTTCTATCAATCTCTCGCATCCGGATGCT 
TTTTGCAAGTTCTTGAAGCGGATTCATCATAAATCGACAGAGAAATGTCGCAGGCTCCGA 
ATCCAGAAGAAGAAGACGACACGATTGAAATCCGCGAGGTCTGGAACCATAACCTTGAAC 
AAGAGATGGCTCTGATTGAACAATCCATCGACGATTTCCCTTACGTAGCCATGGACACAG 
AGTTCCCAGGAATCGTTTGCAAGACAGTAACGGCGAATCCAAACCCAAACCCATACTCTA 
TACACTACGAATACAACTACGATACCTTGAAGGCGAACGTGAATATGCTCAAGTTGATTC 
AGCTCGGTCTCACCTTATCAGATGAGAAAGGAAACTTACCAACCTGTGGAACCAACAAGC 
AATGCATCTGGCAATTCAATTTCAGAGAATTCAATGTCATATCCGACATGTTCGCCTTGG 
ATTCCATCGAACTCCTCCGTAAGTCAGCCATCGATTTGGAGAAGAACAACGAATGCGGTG 
TAGACGCAAAGAGATTCGCAGAGCTTCTAATGGGTTCAGGAGTAGTGCTAAACGATAAGA 
TACATTGGGTGACATTCCATTGCGGATACGATTTTGGGTACTTGCTGAAACTCTTGTCAG 
GGAAAGAATTGCCGGAGGAGATATCGGACTTCTTTGATCAGATGGAGAAGTTTTTCCCGG 
TAGTGTATGATATCAAATACTTGATGGGATTCTGTACTAACCTCTATGGAGGTCTGGAGA 
AAATAGCGGAGTTACTTGGTGTTAAACGAGTTGGGATTTCTCACCAGGCTGGATCAGATA 
GCTTGTTAACGTTGCGTACTTTCATCAAGATGAAAGAGTTCTTCTTCACTGGTTCCTTGC 
TCAAGTATTCTGGTTTTTTGTTTGGATTAGATAATCCTCGGTTGCTCACTGGATCCAAAA 
ATTAAAATTG
>AT1G15920.1 |  CCR4-NOT transcription complex protein putative 
CTCTTCGTCTTCTTCTTCTTCTCCTCCCCAGTTTCGCATCATTCTCTTCGATAACCGCCA 
CATCCTCTGAAACCCTAATCTGGAGAATCGCCGCCTTCTCCAGAAAATATCTATTTCTAT 
ACCTTGTTCGTTTGATTTCCAGGTTCGAATCACCGCCTCCTCGTTTCTCCATTTCCGTGT 
TTGTTTGTTTTGGTTTCGTTTGAATCTTTCTGCTAGATATATTCGTTGTCTTTGGGATTT 
TGATTGTTCTTGGCATTTTGAAATTGCTTTGCAGATACTGATGAAACCGGATCGGATCTT 
TCTCTAGATCCGTTCTAGGTTTATCGATTTCTTTCTATCAATCTCTCGCATCCGGATGCT 
TTTTGCAAGTTCTTGAAGCGGATTCATCATAAATCGACAGAGAAATGTCGCAGGCTCCGA 
ATCCAGAAGAAGAAGACGACACGATTGAAATCCGCGAGGTCTGGAACCATAACCTTGAAC 
AAGAGATGGCTCTGATTGAACAATCCATCGACGATTTCCCTTACGTAGCCATGGACACAG 
AGTTCCCAGGAATCGTTTGCAAGACAGTAACGGCGAATCCAAACCCAAACCCATACTCTA 
TACACTACGAATACAACTACGATACCTTGAAGGCGAACGTGAATATGCTCAAGTTGATTC 
AGCTCGGTCTCACCTTATCAGATGAGAAAGGAAACTTACCAACCTGTGGAACCAACAAGC 
AATGCATCTGGCAATTCAATTTCAGAGAATTCAATGTCATATCCGACATGTTCGCCTTGG 
ATTCCATCGAACTCCTCCGTAAGTCAGCCATCGATTTGGAGAAGAACAACGAATGCGGTG 
TAGACGCAAAGAGATTCGCAGAGCTTCTAATGGGTTCAGGAGTAGTGCTAAACGATAAGA 
TACATTGGGTGACATTCCATTGCGGATACGATTTTGGGTACTTGCTGAAACTCTTGTCAG 
GGAAAGAATTGCCGGAGGAGATATCGGACTTCTTTGATCAGATGGAGAAGTTTTTCCCGG 
TAGTGTATGATATCAAATACTTGATGGGATTCTGTACTAACCTCTATGGAGGTCTGGAGA 
AAATAGCGGAGTTACTTGGTGTTAAACGAGTTGGGATTTCTCACCAGGCTGGATCAGATA 
GCTTGTTAACGTTGCGTACTTTCATCAAGATGAAAGAGTTCTTCTTCACTGGTTCCTTGC 
TCAAGTATTCTGGTTTTTTGTTTGGATTAGATAATCCTCGGTTGCTCACTGGATCCAAAA 
ATTAAAATTG
>AT2G31320.1 |  PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2) DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding 
GGTAGAAACACAATCTGGAAAAGCGTCGCCGAGAAGCTTTACTCTCACCTGAAACATTCC 
TCAATCCGTCGTCATCATAATCATCTTCGATAGAGAAGCCATACGTATAAATAGTACTCT 
CGCATTGTGTAATTGTCTCTTACCGGAGAAATGGCAAGCCCACATAAGCCGTGGAGGGCG 
GAGTATGCAAAGTCGTCGAGGTCTTCATGTAAAACTTGCAAGTCCGTCATTAACAAGGAG 
AACTTTCGTCTTGGAAAGTTGGTTCAATCTACTCACTTCGATGGCATCATGCCCGTATGA 
CTCTCTTTTCTCTCCCAGAATTTGGAACTGTCTCTGTACTATACTCTCGTGCTTGTTAGT 
GTGCGTTCTAATGTTTCTTTCTGATTTTGAGGACAAAATTGATTCTTTTAGAATTATTGT 
CAGACAAATTGGGTTTATTTGGTTGAAATTGGTTATTTTTGAGGGTTCAATCCTGTTCTC 
TCTGCTTCCACTGTTCTACATTCCTTGCAAATTTGTGTGTGTGTGTGTGTCAAGCTTGTT 
TTCTATCTCAAAATTGGAACTTTTTTAACTTCTTAAATAGATGTTAACCTTCCTCACATT 
ATGTTCTTTCCTCCTTTTGTGCCTAATCGAATGTGATAAAAGAGCATTTGAAGCTTAAAT 
TTGAGTCACTTGTGTGTTTATTTAGTACTTGATGATTGCCAAAAGGTTCGTGCTTTTCTG 
CAATGACGTATGTGAACTCCTATTATTCCCTTTGGAACTCTGACGTTATTCTGTTTGGAT 
GATCATAATCGTTTGTTTAGCTGTGTTTTGATATCTTTATGCCGCCAATGCTATGATTGC 
AATCAGCTGTGTTTTTCATGAGCTTTTATGCTTGTTGTTTAATGGAATGGCAGTGGTCAT 
TCTTCTCTTCTTCTTTTCACTATGTAGTTCCTTCTTCATGCTGCTTCACTTCACCATGTT 
AATTATATGTTGCTTTTAGCTCCAGTTGACATGAAGTTTTCCTAGCTGACTATCCTCTTT 
GTACTTTTATTTTTCTCACACAGATGTGGAACCATGCTTCTTGTATACTAAAGAAGACGA 
AGCAGATAAAATCGTATGTAAAACCAATGTCACTTTGAACAAATATTTAAAGTGTTTGGC 
TATTAACTCGTTTTTGTCTCTTGATTTTGCTAGAGTTGATGATGTTGAAGGCATAGAATC 
ACTTCGTTGGGAAGATCAGCAAAAGATTAGAAAATATGTCGAATCTGGAGCAGGGAGTAA 
CACAAGCACAAGCACAGGCACAAGCACGAGCAGTACCGCTAATAATGCCAAACTAGAATA 
TGGGATTGAAGTGTCACAAACTTCTCGTGCCGGTTGCAGAAAGTGTAGCGAAAAGATCTT 
GAAAGGAGAGGTAAATTGTTGTTCTACTTCATCTGTCATGGTTGTAGCGTTTTATATGAA 
CTGGTTCGATATGCATTAGGGTTTTGTTTTGCATTTTTGTTTTCCAGGTACGTATATTCT 
CCAAGCCTGAAGGCCCGGGTAACAAAGGTTTGATGTGGCATCACGCTAAATGTTTCCTTG 
AAATGTCTTCCTCTACTGAACTGGAAAGTTTGTCTGGATGGAGAAGTATACCAGACTCAG 
ACCAAGAAGCTCTTCTTCCCTTAGTGAAGAAAGCTCTGCCGGCAGCCAAAACTGGTAAGA 
GTCTTAAGGTGTACGGTAATATATTGATTTCCTTGTTACAGGATCCTGATTTGCAGTACT 
TTAGTCTGATCTTTCCGTTAATTTATTTTGGCCCAACTGGGACAGAGACAGCAGAAGCAC 
GTCAAACAAATTCAAGAGCAGGCACAAAACGAAAAAATGATTCTGTTGATAACGAGAAGT 
CGAAACTAGCAAAAAGTAGTTTTGACATGTCTACAAGTGGTGCTTTACAACCTTGTAGCA 
AAGAAAAGGAAATGGAGGCCCAAACTAAGGAATTGTGGGACCTGAAGGATGATCTGAAAA 
AATATGTAACATCAGCTGAGTTGCGGGAAATGCTTGAAGTAAATGAACAAAGTACAAGAG 
GATCTGAACTTGATCTGCGTGATAAATGGTAAATTACTTTGCGAATCTGTCTGGAAGTTA 
ATTGCTTGTCTTTTGTTCTATTTCTGTTACTGTTGTGTGGATCTTCTTAAAGGTAATTTG 
GATTAGAGAAACCGATGCATAATCATATGCCTAACCTCTCTATTTGTTTCTATTTAGTGC 
TGATGGCATGATGTTTGGCCCACTCGCTCTCTGCCCAATGTGCTCTGGGCATCTTTCTTT 
CTCCGGAGGACTTTACCGATGCCATGGATACATCTCAGAATGGAGCAAATGTTCTCATTC 
CACTTTGGATCCAGACCGCATCAAAGGGAAGTGGAAAATCCCTGACGAAACAGAAAATCA 
ATTCCTTCTGAAGGTAAACCAGTCTTTTTGTAGAGTTGATATTGGTATGGGTTAGGTTAG 
ATGTGGTATATATTACTCATGAAGTTAATATTTATATTTTGATTACTTGCAGTGGAATAA 
GTCTCAAAAGAGTGTGAAGCCAAAACGTATTCTGCGTCCTGTATTGTCTGGCGAGACATC 
TCAGGGTCAAGGTTCTAAAGATGCAACTGACTCCTCAAGGAGTGAAAGGCTAGCAGATCT 
TAAAGTTTCAATTGCTGGAAATACTAAGGAAAGGGTATGTTCTTCTGTCAAAAATTATAT 
TGTAGACTATCTTTGCACTTCATTGCTTGATGGGATCATTTTGCAGCAACCATGGAAGAA 
GAGAATTGAGGAAGCTGGTGCAGAGTTTCATGCTAATGTTAAAAAAGGTATGGATAACTC 
GAGTGTCTATTTTTGATTATTGTGACACTAGTTTTAGCTTTTGAATATCTCTGTTTCACA 
AATTTGTAGGTACAAGCTGTTTGGTTGTTTGTGGACTGACAGATATCAGAGACGCTGAAA 
TGAGAAAGGCAAGGTAGAATATTGCCTTCATTGTGCTGATACTCTTTAACTTTGTCACAC 
TATTTTTTCTCACTTTGAACGCTGGAGTTGATAAATGTGTGGCAGGAGGATGAAAGTGGC 
AATCGTGAGAGAGGATTATTTGGTTGATTGTTTTAAAAAACAGAGGAAACTTCCATTTGA 
CAAGTACAAAATTGAAGACACTAGTGAGAGCCTTGTCACTGTTAAAGTAAAAGGACGAAG 
CGCTGTGCATGAAGCGTCTGGCCTCCAAGAGCACTGTCACATTCTTGAAGATGGGAACAG 
TATCTATAACACAACTCTGAGCATGTCTGATCTCTCTACCGGTATCAATAGTTATTACAT 
ACTCCAGATAATCCAAGAAGATAAAGGTTCAGATTGTTACGTATTTCGTAAATGGGGCCG 
AGTTGGAAATGAAAAGATTGGTGGTAACAAAGTGGAGGAAATGTCAAAGTCTGATGCGGT 
TCACGAATTCAAACGTCTATTTCTTGAAAAAACCGGAAACACATGGGAATCTTGGGAACA 
AAAAACGAATTTCCAGAAACAACCTGGAAAATTTCTCCCGTTGGACATTGTAAGCATCCA 
TATGACTATATCTTTGTCTCTTAAGATTCTCTTATGTATCGTTCAATAAACTCTTTTGTA 
TCGTTTGTTTTAGGATTATGGAGTTAATAAGCAAGTAGCCAAAAAAGAGCCATTTCAGAC 
CAGTAGCAACCTTGCTCCATCATTAATAGAATTGATGAAGATGCTTTTTGATGTGGAAAC 
TTACAGGTTAGAAACTTATTTGCCATTGTCTTCTTCTCCTCTTCTCTCCCTAGAAACTGT 
ATGAAGTAACCTAATAATTACTTCCGCAGATCTGCAATGATGGAGTTCGAGATAAATATG 
TCAGAGATGCCACTTGGGAAGCTCAGCAAACATAATATACAGAAGGGTAACTCCTACTTC 
TCTAGTTTACTTTTTTATATGATAAAAATAATAAAATGTTAATTCTACATTACATTCTAT 
TATGTTTTTTCTTGTTTGTTCTTCTAAAGGTTTTGAGGCATTGACGGAGATACAGAGGCT 
ATTGACTGAAAGCGACCCCCAGCCTACTATGAAAGAAAGCTTGCTTGTTGATGCTAGTAA 
CAGATTTTTTACCATGATCCCTTCTATTCATCCTCATATTATCCGAGATGAAGATGACTT 
TAAGTCAAAGGTACTTGCCATAGAACATGAACCATGGTGTTGTTTTTTAATTCCTAGCCT 
CTTTTTCTGTGTTACAAAGAGGTATTGTATCTGTGTGTCACAGGTGAAAATGCTCGAGGC 
TCTGCAGGATATCGAAATAGCTTCAAGAATAGTTGGCTTTGATGTTGATAGCACCGAATC 
TCTTGATGATAAGTATAAGAAGCTGCATTGCGATATCTCACCACTTCCTCATGATAGCGA 
AGATTATCGATTAATCGAGAAGTATCTTAACACAACTCATGCCCCAACGCATACAGTGAG 
TTCAAGCTCTGTTTATCCCTTTTCATGTTTTGTTTATCATAATTTTCTAATTCAATTTCT 
GGTCACTGGATTTGTCAGGAGTGGAGTCTTGAGCTAGAGGAAGTTTTTGCTCTTGAAAGA 
GAAGGAGAGTTTGATAAATATGCTCCCCACAGAGAAAAACTTGGCAATAAGATGCTCCTA 
TGGCATGGTAAGCCAACTGCAACCAGCCACATTTACATGCTTTGGGAAACAGATACAAGA 
AATTTCATTGTTTGGTTGATTCTATATATTTGGCTGGTTGATCATCAAAACCCTTGGTTT 
AACCAAAATAAATCTGCTTTCAGGTTCTCGATTAACGAATTTTGTTGGAATATTGAACCA 
AGGACTGAGAATTGCACCTCCAGAAGCTCCTGCTACTGGTTACATGGTCAGTACTCTATC 
TGTGTCTTATTTGTGGGGATCTTATCAATTGAGAGTTCTTCACTATCTAGTTAACTTGTT 
AGAGAATCTGAACTTTTTTTAAACCCCATGTTTCAGTTTGGAAAAGGGATATACTTTGCT 
GACCTTGTCAGTAAAAGTGCTCAGTACTGCTACACTTGTAAGAAAAATCCGGTGGGTCTA 
ATGCTTCTGAGTGAAGTTGCATTGGGAGAAATACATGAGCTAACAAAAGCTAAGGTGAGC 
CCATATTACAGTTTTTCAGGTTATGCTACTAACCATTTGGTTCTTATCTTGAAAACTATA 
TGAACAACTTAAGATATTACTTACCTTCATATATGACTTTCTCTTATGTCCTCAATTCTT 
TAGTATATGGATAAACCTCCGAGAGGGAAACACTCGACCAAAGGGCTCGGCAAGAAAGTG 
CCTCAAGATTCCGAGTTTGCCAAGTGGAGAGGTGATGTGACTGTTCCCTGTGGAAAACCT 
GTTTCATCAAAGGTCAAGGCTTCTGAGCTTATGTACAATGAGTATATCGTCTACGATACA 
GCCCAGGTAACTTGTGTTTCCAAAATAATCTTCCTTGTTCCTTACAACAATGGGATATTG 
CGCACACACTAAAGTCCTCTTTTGTTCTTATCGGGTACTTGGGAATGAGAACTGAATTCC 
CTAGAAAGCTCATGCTTTAGAATACGGCTTTAGCTATTAGTTTTGCAACATATTCTGTGT 
TTGATTCTTTTATGGTGTGTACATGTCTGACAAAGATTGCTTTGTCTCTGAACAGGTGAA 
GTTGCAGTTCTTGTTGAAAGTAAGGTTTAAGCACAAGAGATGAGCCTGAACCAAACAAGA 
AGACGTCACTTCTGTTAACTAAATGTTTTTTTGGGAAATCGAATCCAACACGAAGACTTA 
ACTTTTGTAACTAAATGTCTTTTGATAAATCGAATCCAACATGTAGTCACAGATTTAACT 
CTCTGGCGTTGTAGATGTTTCTGGTTTTAAAACAGCGTACACTACATTTTGTTATGCTTT 
TTCTCAGTAATGACACTTCTTAAGACTT
>AT4G15770.1 |  RNA binding / protein binding 
AGAAACAGAGAGCTTCTCTTCTTTCTCCATTATTCATCACTTTCTTCCCCGAAGATGCGT 
CCTTTAGACGAGACCGAGACAACCGTCGTCTTCGAGAAGCTCTTCAAATTCGTCGGCAAC 
AACCTCAAGAAGATCGTCGAGAACCCATCAGACGAAGGACCCGAATCTACACCCGGCAGC 
TACTGCTTCCGCCTCCAGAAAAACAGAGTCTACTACGTCAGCGAAGCCCTCGTGAAGCGA 
GCCACAAACATCTCCAGGAAAAACCTAGTCTCCTTCGGAACCTGCATCGGGAAATACACT 
CACGCCGGTAGTTTCCATCTGACGATTATGTCACTCAATATCTTGGCGGCGAATGCTAAA 
CACAAGGTATGGCTTAAACCCACTTCGGAGATGTCGTTTCTTTATGGGAACCATGTCTTG 
AAAGGTGGATTAGGGAGGATTACTGATAGTATTGTTCCTGGAGATGGTGTTGTTGTGTTC 
TCGATGTCTGATGTTCCGTTAGGGTTTGGGATTGCTGCGAAGAGTACACAGGATTGTAGG 
AAATTGGATCCTAATGGTATTGTTGTGCTTCATCAGGCTGATATTGGAGAGTATTTGAGG 
GGTGAAGATGACCTTTGAAAGTTTAAAGGTTTTGTCTTTGTTGTGTCTTAGTTTGATTCT 
GCTTGTTGCTTTGAGTTTTAAAGTATGTAGCTGTTACAAGTTTCGTGGAACTTGGTTCTG 
GATCTATGAAAGTCTCGATTTTTATAAATCTGTTTTTGAGGTGTTTTGTGAGACTCTTGA 
GTATGTAAAAGCTAAAAAATTTACATTCATATGCGAATTTTCAAATCTGTAACCTGATGA 
TCAAGATTTGTATTGGAGACAGGTTGAGTTT
>AT5G64550.1 |  loricrin-related 
ATCTCCTCTTCTCTTTTTTCTCTCTTTTTTTGTAGCCCCGCTAATATTTCGACACCTGTT 
TCAGTCTCTTTTTTTGTTTCATTCTTCTTCTTCTTCGTATTCCTCGATGTTTTAGACGAA 
GCAGGGACTCTCAGTTTACGAGTTACGGAATCTCTCTCTGTCTCAGATCCATCAGGTTTT 
TTCTTATTCCTTCTTTAGTACTGTTTTTTTGTATCTTGTTATTACTGATTGATCGTGTTA 
TATTAATGAATGCATGGTTTGTTTTTGTTTCGTTTTCTGAAATTTGTTCAGCTTATTTCT 
CTAATTGTCTCTTGCTCTTTTTAGGGTTTATCTTTTTTTTTTTTTTAAAACCTTCATGAT 
GTTAACTTTTTAGAGTACGCATGATGATTTCTCTAATGATTGTTTGATTAACTCTGATTA 
TAACTTTGATTAATTTTTTTGTTGTGAATTTAGATCTTCTTCCTCAAAGTTAGAAACTTG 
TGAGATATAGAGATTCAGAATCTTTGTTGATTCCATTTTTGTTTAATAGTAACAATTAGT 
ATTTCCTTAGATCTTGTTTATTGAGTTTGGATCTTTATTTTACAACCTAAAATCGTGAGA 
CATTGCTTCTTGTTATCACTTATCACTTATCAAACACAAAGTTGACTTTCCATGTTATAT 
AAGAAGTTTTCAAAGTCTTAACATTATTCTGATTTTGCTTGAATTATTTTGAGTAACAAA 
AATTATTTAGTTTTTTTTTTTTTAATACTGTGTACTAATCTGTAAACCAATCTTATCTTA 
TCCTTTCTTTCATTCTGTTGTTTTGGGAAATTTCTAATTTTTCGAGCATAGAAAGATGTG 
TCCTTCACGTTTCACTTTTACCTAAGGCTAAAATGTTGCCACCATTAGTCATTTTGGTTG 
GTACTTGGTCCTTTTCAGACACAGTTGTAGCCAATTATTGGTCTCTGTACTTTGAATCTC 
TTAACATCACAAGCCGCAACTTGTAATTACACTATTGACTCAAATGCTTTTCTTGATTAT 
TAGTCTCGTGTCATTGTAATGTTATTGATCTTCTTGCTTAAGCTTTCTACTAACAAGATT 
TTGTAACTGCTGCAGAATAGTTTCTTGCGCAAACCCATTCTTGAAGATGGACAGGGCAGA 
TACATGGGGATTTGTCAGCGGTGGGAGATGTTTATATCTCAAGTTGCTTTTATGTTTATA 
GCTCTACAAGGTGGTGTTCTAAGTATTTATTGTTTTGGTCATTCTATCTCCTCCGCTGCA 
TTGTTCTGTCTCTTCTCTTCATATGGATTTGAACGAGAGTGTTGTTCACTTTTCTCGTGG 
CAATGGTATTGCAAAGCTTGACAATTTCGGCGATACTGCTCTTAGCTTGAAATGTCTTGG 
AAGCAGTGCAGGGAGATTGATTGGGAGCTCTCACCATAACCATAAGCTTTGTTCTGATGT 
TTCTAATTGTCCTGATGGTGGTTGCCGGTTGGTTCTCGGTTTGGGTCCAACACCGCCTTC 
GTATTATTACAATGTCAGGGTCAATGATAATAACAACAAAGGCTCTGCTTCTTCTGGGAG 
TGTTCAGGAACTCTCATCAGGAGGTAACTCAATCCTGCAACTTGGTCCTCCTGCTGTGAC 
CATGGATACTTTCAGCGGACTTGAGGGTTCTCTGTTGACATATGCGGATACTAATGTGTC 
CCAAGCTGCTGTTGATGAGGGTTCTACCTCAGCAAGGCGATCAGGTGGCTATATGCCATC 
GCTTCTTTTCGCTCCAAGGACGGAGAATGTTAGAAAACCTTCAAGGATGCAAGAGTGTAG 
TACTAATTGTGGAACTGATGCTTATAATTCACAGCTGAGCCATGAGTCAGAGTTCTCTGT 
AAGCGCTTTCTCTGACAGGTCGGCCTCTGCCACGTCTTCTCAGCAAAGGATGAGCAACCC 
GAAGAAGTGCAAGTTTATGGGATGTGTTAAAGGAGCTAGAGGAGCTTCGGGGCTCTGCAT 
TGGCCATGGAGGTGGCCAGAGATGCCAAAAGCTAGGTTGCAACAAAGGTGCTGAGAGCAA 
AACTACTTTCTGCAAAGCCCATGGCGGAGGAAAGAGATGCCAACACTTGGGATGCACAAA 
GAGTGCTGAAGGCAAAACCGATCTCTGCATATCACATGGTGGTGGAAGACGGTGTGGATT 
CCCTGAGGGATGTGCTAAGGCTGCACGTGGCAAATCTGGGCTCTGCATCAAGCACGGTGG 
TGGTAAAAGGTGTAGGATTGAAAGCTGTACACGAAGTGCTGAGGGACAAGCTGGACTCTG 
TATTTCCCACGGTGGTGGACGGCGTTGTCAGTCTTCAGGCTGTACAAAAGGTGCTCAAGG 
AAGTACAAACTACTGCAAAGCTCATGGTGGTGGGAAACGCTGCATATTTGCGGGATGTAC 
AAAAGGAGCGGAAGGTAGTACTCCGCTTTGTAAAGCACATGGTGGAGGAAAACGCTGTAT 
GTTTGATGGTGGTGGTATTTGTCCTAAGAGTGTGCATGGTGGGACGAGTTTCTGTGTAGC 
TCACGGTGGTGGGAAGAGATGTGTTGTGGCCGGGTGCACTAAGAGCGCTCGTGGGAGGAC 
TGATTGTTGCGTGAAGCACGGTGGTGGGAAACGGTGTAAGTCTGATGGTTGTGAGAAGAG 
TGCGCAAGGTAGCACTGATTTCTGTAAGGCACATGGTGGTGGGAAACGTTGCTCATGGGG 
AGGAGACTGGAAATGCGAGAAATTCGCTAGAGGAAAGAGCGGTTTATGCGCTGCGCATAA 
CAGTATGTCACAAGATAAAGCTGGAAGCAAGGTTGGTTTGATTGGACCGGGACTTTTCCG 
TGGCCTTGTCTCTACTTCTTTACAAACCACAACAACTGCAACTACTACTACTACTACCAC 
TGATCATTCTCAATCTGGAGTCAGTGCGGTCTCTGATTGCATGGACTCCATTGATCGCCC 
GCTGCCACCGTTGCATCATCAACCCGAGAAAAGACAGAAGCTGATGATACCAATGCAGGT 
TCTTGTGCCTCCATCAATGAAATCCTTAAGCTTCTCAAACACCGAGAGACCCGATATCGA 
AACAAACAACAATAGTAGTGGCAGCAATGGGAGGAACATATTTGACTTTATGATTCCTGA 
GGAAAGAGTTCATGGTGGCGGGCTTATGTCTCTGCTTAATGGTAACATGAAACAAACACT 
CCGTTGATGGAATCTGAAAGCTTCCTCTCTATGTGGTAACAACAAGGCTAGAGTCTGTGT 
AAAGCTTCATGTAATATGTATAGTTTTTTGGTTTTCTTTTTGTTTCTCTTTCACTCTTGG 
GTCCTTTGTACATTTCATGGGTCTCTGTTTTTGTATGGTCTCTGGTCTTGACTTGACCAT 
CTAGTCGATGGCTTGAACCCAAGTCTTTGTTTATTTGATCATTGTTATGAATGTTGCAAT 
GTACAAGTAAAATGTGTTCTTATGTTTTGTACC
>AT2G32070.1 |  CCR4-NOT transcription complex protein putative 
ACATCCTCTGAAACCCTAGCCTGAACAACTCGCCGTCTTCTCGAGAAACATCTTTCTTAC 
TTCGCTTCATTACAAGGTTCGAATCCAGCTGTCTCTCTTAGTATTTGTCTATGTATCTGT 
CGAGTTTCTCTGTTTTCATTGATTTATGTAAAATCAGAAGGTTTTGGTTTTTGTAAGTGA 
TTCATTTGTTTTGTGTTAAATCTATTGCAGATCTGATGAAACCAGATCGGATCTTGCTCT 
AGATCCAGATGCTCCTTAACTTATTTACTCGAATTCATCATCATCGTTATCATCACCATG 
TCACTGTTTCTAAAAGACGATTCGATTCAAATCCGTGAAGTATGGAACGACAATCTCGAA 
TCAGAGATGGCTCTGATTCGAGAAGTCGTAGACGATTTCCCATTCGTAGCGATGGACACA 
GAGTTCCCAGGAATCGTGTGTAGACCAGTGGGAACATTCAAAACCAACACAGAGTACCAC 
TACGAAACTCTCAAAACAAACGTCAACATACTCAAGATGATTCAGCTTGGACTCACTTTC 
TCTGATGAGAAAGGTAACCTCCCAACTTGTGGAACAGACAACAAGTATTGCATCTGGCAG 
TTCAATTTCCGCGAATTCGACCTCGAATCCGATATCTACGCTACCGATTCGATCGAGCTT 
CTTCGTCAATCAGGCATCGATTTCGTGAAAAACAACGAATTCGGTATCGATTCGAAGCGG 
TTCGCTGAGCTTTTGATGTCTTCAGGGATTGTGTTGAATGAAAACGTTCATTGGGTTACA 
TTCCACAGCGGATACGATTTCGGTTACTTGTTGAAGCTATTGACTTGTCAGAATCTTCCC 
GAGACGCAAACAGGGTTCTTCGAGATGATCAGTGTGTATTTCCCGAGGGTTTATGATATC 
AAACACTTGATGAAGTTCTGTAATAGTCTTCATGGAGGTCTGAATAAATTGGCGGAGCTG 
CTTGATGTTGAGAGAGTTGGGATTTGTCACCAGGCCGGATCGGATAGCTTGTTAACGTCG 
TGTACATTCAGGAAGCTGCAGGAGAATTTCTTCATTGGTTCAATGGAGAAGTATTCTGGT 
GTTTTGTATGGTTTAGGTGTTGAGAATGGTCAGATTGTTCATTGATAAAAGCTTAAAGTT 
TTAAACAGGTTATGTTATTTATTTTAGATTATTACATCATAGGTTGTTTTAAGAAGTGTA 
TGATCACAAGAACTAAACTCTGATTTTGGTTTGGTATTGTGCTCTCTTACTTGTTTAAAG 
ATAGCATCTCACTTAATTTATGAAAA