>AT5G47430.1 |  zinc ion binding 
ATAAACACGGATACGAGAGAAAGAGAGCTCTTGTGTCCAAACCCTAGATTTCAAGATCGA 
TCTATCTTCTTTCTCGTGAAGACACCGCTCTCTACTCGATTCCTATGATTACTCTCTAGA 
TCCTTTTCAATTTCCCCCCGAAAGGTTTCTCGATTTTGATCCCCCAAATCGGAGCTTGGA 
GCTACCGGATCTTATGGAGTGAAGCCCGATCATCCGTTTCTTTGTTACAAGTTGTCGTTT 
TGTAGCTGCGAAGATTCCTCGGAGAAGGAGATTTGGAGACATCACCGGCGCCATTCTCAG 
CTCGGCGATCACACGGACGTTCTCGTTCCTTGAATCTGCAGGAACTTTTCCAGGATTCGT 
TGATTTGGATTGATTTTGCTACACGCGTGGAGTTTCCTTCTGTGAAGTCGAATCAGCGAA 
GTAAAAATTGAATCTTTAGGGTTTTCTTAGTTTGTATTTACCTTTTTGTTTTGGAAATCA 
AATCTCTGGCCTCGTTTTTTTTTTTTAATAATCCGGAGGCCTTGATTAGGGTTTTCAAAA 
TCTAGTAGCTTTGTGTCATGATCTTTATAAGATAAGTAATAGATATATGTATTTTTTTGC 
TTTTTATATCAGATACAAATTTTCAATGGCAATTTATTACAAGTTTAAGAGTGCAAGGGA 
TTATGATACCATTGCCATGGATGGTCCTTTTATATCCGTCGGTATTCTCAAAGACAAAAT 
TTTCGAAACTAAGCATTTGGGCACTGGTAAAGACCTTGATATTGTCGTCTCCAATGCCCA 
AACTAACGAAGGTTTGTCTTCTATGTCAAATGTTGTGCTGCGCTTTTCGTATTATTAGAC 
TGTTTGCTTGCAGCTGTGATACAATGAACTTTATTTTATGTTATGATTGTTTACTAGCTG 
AGCTTTGTCTTATTTTTTTTTTACTTTTGTGAACTATTAGGAAATGGTTTGTTGGAATAT 
GATTCTTGAATTTCTCAGGAAGCTTTAGTGTACTGTGTCTCGTGCCAATATGATTGCAAT 
CTGTGGCCTTTATATGTTCTCTGTTTTGAATTTTCAGAGTATCTGGATGAAGCAATGTTA 
ATCCCAAAGAATACATCTGTCCTTATTCGTCGGGTTCCTGGACGTCCTCGCATCACAGTT 
ATTACCACACAAGAGTACTTTCTCAGATCTTTAGTTTCTATATTCTTTGTCTACTTATTT 
AGCTATTAAACTTAAATAGACATGATATTAAAAGCATTGCATTTTACTGGTGCATCGTTT 
TAGCTAAACATAAGTTAATTGTCTGACTATCGGATTTAAGAAACTTCGGGATCCTCAATG 
ATGCAAATATCTTAACTTTGCAGGCCTAGAATCCAGAATAAAGTGGAAGACGTTCAGGCT 
GAAACCACCAATTTTCCTGTTGCTGATCCATCTGCTGCTGAATTTGTAAGTTGATTATAG 
TGAACTTTTCTCGGCTTCTGTTGGCATTGACTGCACCTAATTTTCTTCTACTACAAAAGT 
ACTAATGTCATCCGTATTCACCTCTTAGCCTGAAGATGAGTATGACGAGTTTGGGACTGA 
TCTTTATTCCATTCCTGATACCCAAGATGCCCAGCATATTATTCCACGTCCTCATCTTGC 
AACCGCAGACGACAAAGTAGATGAAGAAAGCAAAATTCAGGCGCTGATTGACACTCCAGC 
ACTTGACTGGCAACAACGGTAAGCAATCTTCCAGAAATGGTGCAGGTGAAACTGTTGGAT 
TTTGTGAGAAGGTTTAACAGACCTCTTATATTTATTCAATGTAACAGACAAGGTCAAGAT 
ACTTTTGGAGCTGGTAGAGGTTATGGGAGGGGTATGCCTGGAAGGATGAATGGACGTGGT 
TTTGGTAACTTATACTTACTTTTATTCTTTGATTTTGGTTGAATTCTGGAATGTCAAAAT 
ACAGTATACAAAACATTTACTTCTGTCAAAATATTTTATATTTTTGTTCTATTTGCTCAA 
GTTGTAAGATACTTAGTTTGGTTTTGCTGGCTGGATAGGAATGGAAAGGAAAACGCCACC 
TCCAGGTTATGTGTGCCATCGTTGCAATATCCCTGGTATGTCAGCTCTGAAAATCTTTAT 
TTTTCTCTCACTTTTGTAGATGGATATATAATAGATAAGAAGTGTTGAGAGCATTTTCTT 
TGCTGTCTCAGGACATTTTATTCAGCATTGCCCCACAAATGGAGACCCTAACTATGATGT 
TAAGAGAGTTAAGCCACCTACTGGTATCCCCAAGTCCATGTTGATGGCGACCCCAGATGG 
TTCTTATTCCTTGCCAAGTGGCGCAGTTGCAGTTCTGAAACCAAATGAGTAAGTTGTACT 
GAATTAGTTTGGGAATGTTGCTATTGGGTACTTCTTCACATATATTGATTATAGTTTAAA 
TGTTTGTTGTGTCTTCAACAAATTCAGGGATGCTTTTGAGAAGGAAATGGAGGGATTGCC 
ATCAACAACACGTTCTGTAGGAGAACTTCCACCTGAGCTAAAATGCCCATTATGCAAAGA 
AGTGATGAAAGATGCTGCGCTTACAAGCAAATGTTGTTACAAGAGCTTCTGTGACAAGTG 
TAAGTTCTTTTAATGCATTCTGCTGTTCCACAAAAACCTTTTCTGACCGTTGTCAGTTCC 
AGTTCTACATTATTATCCTTTTTCACTGATTCAGGTATCAGAGATCACATTATTTCAAAG 
TCAATGTGTGTTTGTGGAAGATCAGATGTACTTGCTGACGACCTTCTACCAAACAAGACC 
CTCAGGGATACCATAAACCGTATTTTGGAAGCTGGAAACGATAGCACTGAGAATGTGGGC 
AGCGTTGGCCATATCCCAGGTCCGTCATTATTTTAAATTCATGTGTTTTTAAACTTTGTT 
TGATTAGTCCTCACTACTGAATTATCATGGACAATATAGATTTGGAGTCTGCACGCTGTC 
CACCTCCCAAGGCTCTATCTCCTACTACATCTGTTGCATCTAAAGGCGAGAAGAAACCAG 
TACTTAGTAACAATAATGATGCTTCAACTTTAAAGGCGCCAATGGAAGTTGCAGAGATCA 
CAAGTGCCCCTCGTGCATCTGCAGAAGTGAATGTAGAAAAGCCAGTTGATGCATGTGAAA 
GCACTCAAGGGTCCGTGATTGTGAAAGAAGCAACAGTGTCAAAGTTGAATACGCAAGCCC 
CCAAGGAAGAAATGCAGCAGCAGGTTGCTGCTGGAGAGCCAGGTAAAATAAAGATGTACT 
AATATTAGCTTCACTGGACATTGCGAATGATTGGTGACTGATAGTCCAGTTCAGATTTCC 
CTACTGAGATTAATCAAGCTGGACCTCACATGAACCTTTTTTTTTTCAATTACTGAGGAA 
CCCTTGTTGTCATTCATCAATGTAATACGTACTTATTGTCTCTATACAGGAAAAAAGAAG 
AAAAAGAAACCAAGAGTGCCTGGGAATGGTAAAAGCTTTCTTTGCTACGCTGAAGGCAAT 
ACATTGTCAGTTTCGAAGTCTATGTGAATCGAATGGGAGGTCTAAAAGATGGTTTGTTTA 
TGTGATTTATTGCAGACATGCAATGGAATCCTGTGCCAGATCTAGCAGGCCCTGACTATA 
TGATGCAAATGGGACCAGGTCCGCAGTACTTCAACGGCATGCAACCTGGCTTCAATGGCG 
TACAACCAGGCTTCAACGGTGTTCAACCTGGCTTCAATGGCTTTCACCCTGGCTTCAATG 
GATTTGGAGGCCCGTTTCCAGGCGCAATGCCTCCATTTATGGGTTACGGATTAAACCCAA 
TGGACATGGGATTTGGTGGGGGTATGAATATGATGCATCCAGATCCATTCATGGCACAAG 
GATTTGGGTTCCCTAATATACCACCACCCCATAGGTAAAACACTCACTCTATCAAAGAAG 
AGCAATAAAGCTTTCTCAACAAGTCTCATGATGGAACTTTCTGTGCATGCGCAGGGACCT 
AGCTGAAATGGGAAACCGAATGAATCTCCAACGTGCTATGATGGGCAGAGATGAAGCCGA 
AGCCCGAAACGCTGAGATGTTAAGAAAACGTGAAAACGAGAGACGACCTGAAGGGTAAAA 
AGAAAACACTCACTCTATTTTTACTACAGATTCAAACAAGGATATGCTAAAACCTAAACA 
TTGGTTGTTGTTTGGTTGTATATACAGTGGGAAGATGTTTAGGGATGGAGAGAATAGCAG 
AATGATGATGAACAACGGTACTTCAGCCTCTGCATCATCCATCAACCCTAATAAATCTGT 
ATGTCTCCTTTTGTTTGACTCATCTTCCCCTCTCGCTCTCTCTTTCTTCTTTTCTTTGTT 
CACCTGTGCTTCGCTCTCTCCCATTTACTTTTGGTTATATGTTATTATTATATCAGAAAA 
TGGCTCCAAATTCTCTTCCCTGATTCCCTCATTTTGCTTATTTTGAAAACCCAAAAAAAA 
AAAAAAAAAAACTTGAAGAAAACTAGGGGAAAATATATTGGTTTCTAACGTAATTTTCTG 
AAATATAAAATTGGGGTTTATCAGAAACTAAGGGCTGTGAATAAAAAGGAAAAGAAATAG 
AAGGGTAGATGGCTAAAAAGCCTAAAATGCAAAATAGTAGGCGTAGGAACCGAAAGGTGA 
CGACGGTAACTGGGCTATTGAGCCCATTTCCTTTTTATTTGTGGGCCGAATTCAATACAT 
ATTTTATTATAATAATTTGGGCTAACAATTGTTTTACAGAGACAAGCACCTCCACCACCA 
ATCCACGATTACGATCGCCGGAGACGACCGGAGAAGAGACTATCCCCAGAGCATCCGCCT 
ACGCGTAAAAACATTTCCCCGTCTCGCGACTCCAAGAGAAAATCCGAGCGTTATCCTGAT 
GAACGAGATCGGCAACGCGACCGTGAGAGGTCACGTCACCAAGACGTAGATCGTGAACAC 
GACCGTACTCGCGACCGTCGCGATGAAGACAGAAGCCGAGATCATCGCCACCACCGTGGT 
GAAACCGAACGCAGCCAACATCACCACCGCAAGAGATCGGAACCGCCTTCATCGGAGCCA 
CCAGTCCCTGCTACTAAAGCAGAGATCGAGAATAATCTTAAGTCTAGCGTATTCGCTCGG 
ATAAGTTTTCCGGAGGAAGAAACATCTTCTGGTAAACGAAGAAAGGTGCCTTCCTCTTCT 
TCTACTTCTGTTACGGATCCATCTGCTTCCGCCTCTGCCGCAGCCGCCGTGGGAACATCA 
GTTCACCGACACAGTAGTCGGAAGGAAATAGAAGTAGCAGATTATGAATCTAGTGATGAA 
GATAGGCATTTCAAGAGGAAGCCGTCAAGGTACGCGCGATCACCACCGGTGGTGGTTAGT 
GATGTGAGTGAAGATAAACTCCGATACTCAAAACGTGGAAAGGGGGAGAGATCTCGAGCT 
TGACATGGATTTTCAAACATGTTTTTTTTTTTTTTTGTATAATCAAAAACAGAGAATGAG 
AATCTTCTTGTTTTGCTGTAACGAACAAAGAGAGAGAGTTCTTTTGTCATCGAATTCTTT 
TTTAATTTTTGTAGTGGAATTCGATTTCGTAACTACTTTATTCTTAATCTATGAGACCAG 
CGAATTTACAG
>AT5G47430.1 |  zinc ion binding 
ATAAACACGGATACGAGAGAAAGAGAGCTCTTGTGTCCAAACCCTAGATTTCAAGATCGA 
TCTATCTTCTTTCTCGTGAAGACACCGCTCTCTACTCGATTCCTATGATTACTCTCTAGA 
TCCTTTTCAATTTCCCCCCGAAAGGTTTCTCGATTTTGATCCCCCAAATCGGAGCTTGGA 
GCTACCGGATCTTATGGAGTGAAGCCCGATCATCCGTTTCTTTGTTACAAGTTGTCGTTT 
TGTAGCTGCGAAGATTCCTCGGAGAAGGAGATTTGGAGACATCACCGGCGCCATTCTCAG 
CTCGGCGATCACACGGACGTTCTCGTTCCTTGAATCTGCAGGAACTTTTCCAGGATTCGT 
TGATTTGGATTGATTTTGCTACACGCGTGGAGTTTCCTTCTGTGAAGTCGAATCAGCGAA 
GTAAAAATTGAATCTTTAGGGTTTTCTTAGTTTGTATTTACCTTTTTGTTTTGGAAATCA 
AATCTCTGGCCTCGTTTTTTTTTTTTAATAATCCGGAGGCCTTGATTAGGGTTTTCAAAA 
TCTAGTAGCTTTGTGTCATGATCTTTATAAGATAAGTAATAGATATATGTATTTTTTTGC 
TTTTTATATCAGATACAAATTTTCAATGGCAATTTATTACAAGTTTAAGAGTGCAAGGGA 
TTATGATACCATTGCCATGGATGGTCCTTTTATATCCGTCGGTATTCTCAAAGACAAAAT 
TTTCGAAACTAAGCATTTGGGCACTGGTAAAGACCTTGATATTGTCGTCTCCAATGCCCA 
AACTAACGAAGGTTTGTCTTCTATGTCAAATGTTGTGCTGCGCTTTTCGTATTATTAGAC 
TGTTTGCTTGCAGCTGTGATACAATGAACTTTATTTTATGTTATGATTGTTTACTAGCTG 
AGCTTTGTCTTATTTTTTTTTTACTTTTGTGAACTATTAGGAAATGGTTTGTTGGAATAT 
GATTCTTGAATTTCTCAGGAAGCTTTAGTGTACTGTGTCTCGTGCCAATATGATTGCAAT 
CTGTGGCCTTTATATGTTCTCTGTTTTGAATTTTCAGAGTATCTGGATGAAGCAATGTTA 
ATCCCAAAGAATACATCTGTCCTTATTCGTCGGGTTCCTGGACGTCCTCGCATCACAGTT 
ATTACCACACAAGAGTACTTTCTCAGATCTTTAGTTTCTATATTCTTTGTCTACTTATTT 
AGCTATTAAACTTAAATAGACATGATATTAAAAGCATTGCATTTTACTGGTGCATCGTTT 
TAGCTAAACATAAGTTAATTGTCTGACTATCGGATTTAAGAAACTTCGGGATCCTCAATG 
ATGCAAATATCTTAACTTTGCAGGCCTAGAATCCAGAATAAAGTGGAAGACGTTCAGGCT 
GAAACCACCAATTTTCCTGTTGCTGATCCATCTGCTGCTGAATTTGTAAGTTGATTATAG 
TGAACTTTTCTCGGCTTCTGTTGGCATTGACTGCACCTAATTTTCTTCTACTACAAAAGT 
ACTAATGTCATCCGTATTCACCTCTTAGCCTGAAGATGAGTATGACGAGTTTGGGACTGA 
TCTTTATTCCATTCCTGATACCCAAGATGCCCAGCATATTATTCCACGTCCTCATCTTGC 
AACCGCAGACGACAAAGTAGATGAAGAAAGCAAAATTCAGGCGCTGATTGACACTCCAGC 
ACTTGACTGGCAACAACGGTAAGCAATCTTCCAGAAATGGTGCAGGTGAAACTGTTGGAT 
TTTGTGAGAAGGTTTAACAGACCTCTTATATTTATTCAATGTAACAGACAAGGTCAAGAT 
ACTTTTGGAGCTGGTAGAGGTTATGGGAGGGGTATGCCTGGAAGGATGAATGGACGTGGT 
TTTGGTAACTTATACTTACTTTTATTCTTTGATTTTGGTTGAATTCTGGAATGTCAAAAT 
ACAGTATACAAAACATTTACTTCTGTCAAAATATTTTATATTTTTGTTCTATTTGCTCAA 
GTTGTAAGATACTTAGTTTGGTTTTGCTGGCTGGATAGGAATGGAAAGGAAAACGCCACC 
TCCAGGTTATGTGTGCCATCGTTGCAATATCCCTGGTATGTCAGCTCTGAAAATCTTTAT 
TTTTCTCTCACTTTTGTAGATGGATATATAATAGATAAGAAGTGTTGAGAGCATTTTCTT 
TGCTGTCTCAGGACATTTTATTCAGCATTGCCCCACAAATGGAGACCCTAACTATGATGT 
TAAGAGAGTTAAGCCACCTACTGGTATCCCCAAGTCCATGTTGATGGCGACCCCAGATGG 
TTCTTATTCCTTGCCAAGTGGCGCAGTTGCAGTTCTGAAACCAAATGAGTAAGTTGTACT 
GAATTAGTTTGGGAATGTTGCTATTGGGTACTTCTTCACATATATTGATTATAGTTTAAA 
TGTTTGTTGTGTCTTCAACAAATTCAGGGATGCTTTTGAGAAGGAAATGGAGGGATTGCC 
ATCAACAACACGTTCTGTAGGAGAACTTCCACCTGAGCTAAAATGCCCATTATGCAAAGA 
AGTGATGAAAGATGCTGCGCTTACAAGCAAATGTTGTTACAAGAGCTTCTGTGACAAGTG 
TAAGTTCTTTTAATGCATTCTGCTGTTCCACAAAAACCTTTTCTGACCGTTGTCAGTTCC 
AGTTCTACATTATTATCCTTTTTCACTGATTCAGGTATCAGAGATCACATTATTTCAAAG 
TCAATGTGTGTTTGTGGAAGATCAGATGTACTTGCTGACGACCTTCTACCAAACAAGACC 
CTCAGGGATACCATAAACCGTATTTTGGAAGCTGGAAACGATAGCACTGAGAATGTGGGC 
AGCGTTGGCCATATCCCAGGTCCGTCATTATTTTAAATTCATGTGTTTTTAAACTTTGTT 
TGATTAGTCCTCACTACTGAATTATCATGGACAATATAGATTTGGAGTCTGCACGCTGTC 
CACCTCCCAAGGCTCTATCTCCTACTACATCTGTTGCATCTAAAGGCGAGAAGAAACCAG 
TACTTAGTAACAATAATGATGCTTCAACTTTAAAGGCGCCAATGGAAGTTGCAGAGATCA 
CAAGTGCCCCTCGTGCATCTGCAGAAGTGAATGTAGAAAAGCCAGTTGATGCATGTGAAA 
GCACTCAAGGGTCCGTGATTGTGAAAGAAGCAACAGTGTCAAAGTTGAATACGCAAGCCC 
CCAAGGAAGAAATGCAGCAGCAGGTTGCTGCTGGAGAGCCAGGTAAAATAAAGATGTACT 
AATATTAGCTTCACTGGACATTGCGAATGATTGGTGACTGATAGTCCAGTTCAGATTTCC 
CTACTGAGATTAATCAAGCTGGACCTCACATGAACCTTTTTTTTTTCAATTACTGAGGAA 
CCCTTGTTGTCATTCATCAATGTAATACGTACTTATTGTCTCTATACAGGAAAAAAGAAG 
AAAAAGAAACCAAGAGTGCCTGGGAATGGTAAAAGCTTTCTTTGCTACGCTGAAGGCAAT 
ACATTGTCAGTTTCGAAGTCTATGTGAATCGAATGGGAGGTCTAAAAGATGGTTTGTTTA 
TGTGATTTATTGCAGACATGCAATGGAATCCTGTGCCAGATCTAGCAGGCCCTGACTATA 
TGATGCAAATGGGACCAGGTCCGCAGTACTTCAACGGCATGCAACCTGGCTTCAATGGCG 
TACAACCAGGCTTCAACGGTGTTCAACCTGGCTTCAATGGCTTTCACCCTGGCTTCAATG 
GATTTGGAGGCCCGTTTCCAGGCGCAATGCCTCCATTTATGGGTTACGGATTAAACCCAA 
TGGACATGGGATTTGGTGGGGGTATGAATATGATGCATCCAGATCCATTCATGGCACAAG 
GATTTGGGTTCCCTAATATACCACCACCCCATAGGTAAAACACTCACTCTATCAAAGAAG 
AGCAATAAAGCTTTCTCAACAAGTCTCATGATGGAACTTTCTGTGCATGCGCAGGGACCT 
AGCTGAAATGGGAAACCGAATGAATCTCCAACGTGCTATGATGGGCAGAGATGAAGCCGA 
AGCCCGAAACGCTGAGATGTTAAGAAAACGTGAAAACGAGAGACGACCTGAAGGGTAAAA 
AGAAAACACTCACTCTATTTTTACTACAGATTCAAACAAGGATATGCTAAAACCTAAACA 
TTGGTTGTTGTTTGGTTGTATATACAGTGGGAAGATGTTTAGGGATGGAGAGAATAGCAG 
AATGATGATGAACAACGGTACTTCAGCCTCTGCATCATCCATCAACCCTAATAAATCTGT 
ATGTCTCCTTTTGTTTGACTCATCTTCCCCTCTCGCTCTCTCTTTCTTCTTTTCTTTGTT 
CACCTGTGCTTCGCTCTCTCCCATTTACTTTTGGTTATATGTTATTATTATATCAGAAAA 
TGGCTCCAAATTCTCTTCCCTGATTCCCTCATTTTGCTTATTTTGAAAACCCAAAAAAAA 
AAAAAAAAAAACTTGAAGAAAACTAGGGGAAAATATATTGGTTTCTAACGTAATTTTCTG 
AAATATAAAATTGGGGTTTATCAGAAACTAAGGGCTGTGAATAAAAAGGAAAAGAAATAG 
AAGGGTAGATGGCTAAAAAGCCTAAAATGCAAAATAGTAGGCGTAGGAACCGAAAGGTGA 
CGACGGTAACTGGGCTATTGAGCCCATTTCCTTTTTATTTGTGGGCCGAATTCAATACAT 
ATTTTATTATAATAATTTGGGCTAACAATTGTTTTACAGAGACAAGCACCTCCACCACCA 
ATCCACGATTACGATCGCCGGAGACGACCGGAGAAGAGACTATCCCCAGAGCATCCGCCT 
ACGCGTAAAAACATTTCCCCGTCTCGCGACTCCAAGAGAAAATCCGAGCGTTATCCTGAT 
GAACGAGATCGGCAACGCGACCGTGAGAGGTCACGTCACCAAGACGTAGATCGTGAACAC 
GACCGTACTCGCGACCGTCGCGATGAAGACAGAAGCCGAGATCATCGCCACCACCGTGGT 
GAAACCGAACGCAGCCAACATCACCACCGCAAGAGATCGGAACCGCCTTCATCGGAGCCA 
CCAGTCCCTGCTACTAAAGCAGAGATCGAGAATAATCTTAAGTCTAGCGTATTCGCTCGG 
ATAAGTTTTCCGGAGGAAGAAACATCTTCTGGTAAACGAAGAAAGGTGCCTTCCTCTTCT 
TCTACTTCTGTTACGGATCCATCTGCTTCCGCCTCTGCCGCAGCCGCCGTGGGAACATCA 
GTTCACCGACACAGTAGTCGGAAGGAAATAGAAGTAGCAGATTATGAATCTAGTGATGAA 
GATAGGCATTTCAAGAGGAAGCCGTCAAGGTACGCGCGATCACCACCGGTGGTGGTTAGT 
GATGTGAGTGAAGATAAACTCCGATACTCAAAACGTGGAAAGGGGGAGAGATCTCGAGCT 
TGACATGGATTTTCAAACATGTTTTTTTTTTTTTTTGTATAATCAAAAACAGAGAATGAG 
AATCTTCTTGTTTTGCTGTAACGAACAAAGAGAGAGAGTTCTTTTGTCATCGAATTCTTT 
TTTAATTTTTGTAGTGGAATTCGATTTCGTAACTACTTTATTCTTAATCTATGAGACCAG 
CGAATTTACAG
>AT5G47430.2 |  zinc ion binding 
ATAAACACGGATACGAGAGAAAGAGAGCTCTTGTGTCCAAACCCTAGATTTCAAGATCGA 
TCTATCTTCTTTCTCGTGAAGACACCGCTCTCTACTCGATTCCTATGATTACTCTCTAGA 
TCCTTTTCAATTTCCCCCCGAAAGGTTTCTCGATTTTGATCCCCCAAATCGGAGCTTGGA 
GCTACCGGATCTTATGGAGTGAAGCCCGATCATCCGTTTCTTTGTTACAAGTTGTCGTTT 
TGTAGCTGCGAAGATTCCTCGGAGAAGGAGATTTGGAGACATCACCGGCGCCATTCTCAG 
CTCGGCGATCACACGGACGTTCTCGTTCCTTGAATCTGCAGGAACTTTTCCAGGATTCGT 
TGATTTGGATTGATTTTGCTACACGCGTGGAGTTTCCTTCTGTGAAGTCGAATCAGCGAA 
GTAAAAATTGAATCTTTAGGGTTTTCTTAGTTTGTATTTACCTTTTTGTTTTGGAAATCA 
AATCTCTGGCCTCGTTTTTTTTTTTTAATAATCCGGAGGCCTTGATTAGGGTTTTCAAAA 
TCTAGTAGCTTTGTGTCATGATCTTTATAAGATAAGTAATAGATATATGTATTTTTTTGC 
TTTTTATATCAGATACAAATTTTCAATGGCAATTTATTACAAGTTTAAGAGTGCAAGGGA 
TTATGATACCATTGCCATGGATGGTCCTTTTATATCCGTCGGTATTCTCAAAGACAAAAT 
TTTCGAAACTAAGCATTTGGGCACTGGTAAAGACCTTGATATTGTCGTCTCCAATGCCCA 
AACTAACGAAGGTTTGTCTTCTATGTCAAATGTTGTGCTGCGCTTTTCGTATTATTAGAC 
TGTTTGCTTGCAGCTGTGATACAATGAACTTTATTTTATGTTATGATTGTTTACTAGCTG 
AGCTTTGTCTTATTTTTTTTTTACTTTTGTGAACTATTAGGAAATGGTTTGTTGGAATAT 
GATTCTTGAATTTCTCAGGAAGCTTTAGTGTACTGTGTCTCGTGCCAATATGATTGCAAT 
CTGTGGCCTTTATATGTTCTCTGTTTTGAATTTTCAGAGTATCTGGATGAAGCAATGTTA 
ATCCCAAAGAATACATCTGTCCTTATTCGTCGGGTTCCTGGACGTCCTCGCATCACAGTT 
ATTACCACACAAGAGTACTTTCTCAGATCTTTAGTTTCTATATTCTTTGTCTACTTATTT 
AGCTATTAAACTTAAATAGACATGATATTAAAAGCATTGCATTTTACTGGTGCATCGTTT 
TAGCTAAACATAAGTTAATTGTCTGACTATCGGATTTAAGAAACTTCGGGATCCTCAATG 
ATGCAAATATCTTAACTTTGCAGGCCTAGAATCCAGAATAAAGTGGAAGACGTTCAGGCT 
GAAACCACCAATTTTCCTGTTGCTGATCCATCTGCTGCTGAATTTGTAAGTTGATTATAG 
TGAACTTTTCTCGGCTTCTGTTGGCATTGACTGCACCTAATTTTCTTCTACTACAAAAGT 
ACTAATGTCATCCGTATTCACCTCTTAGCCTGAAGATGAGTATGACGAGTTTGGGACTGA 
TCTTTATTCCATTCCTGATACCCAAGATGCCCAGCATATTATTCCACGTCCTCATCTTGC 
AACCGCAGACGACAAAGTAGATGAAGAAAGCAAAATTCAGGCGCTGATTGACACTCCAGC 
ACTTGACTGGCAACAACGGTAAGCAATCTTCCAGAAATGGTGCAGGTGAAACTGTTGGAT 
TTTGTGAGAAGGTTTAACAGACCTCTTATATTTATTCAATGTAACAGACAAGGTCAAGAT 
ACTTTTGGAGCTGGTAGAGGTTATGGGAGGGGTATGCCTGGAAGGATGAATGGACGTGGT 
TTTGGTAACTTATACTTACTTTTATTCTTTGATTTTGGTTGAATTCTGGAATGTCAAAAT 
ACAGTATACAAAACATTTACTTCTGTCAAAATATTTTATATTTTTGTTCTATTTGCTCAA 
GTTGTAAGATACTTAGTTTGGTTTTGCTGGCTGGATAGGAATGGAAAGGAAAACGCCACC 
TCCAGGTTATGTGTGCCATCGTTGCAATATCCCTGGTATGTCAGCTCTGAAAATCTTTAT 
TTTTCTCTCACTTTTGTAGATGGATATATAATAGATAAGAAGTGTTGAGAGCATTTTCTT 
TGCTGTCTCAGGACATTTTATTCAGCATTGCCCCACAAATGGAGACCCTAACTATGATGT 
TAAGAGAGTTAAGCCACCTACTGGTATCCCCAAGTCCATGTTGATGGCGACCCCAGATGG 
TTCTTATTCCTTGCCAAGTGGCGCAGTTGCAGTTCTGAAACCAAATGAGTAAGTTGTACT 
GAATTAGTTTGGGAATGTTGCTATTGGGTACTTCTTCACATATATTGATTATAGTTTAAA 
TGTTTGTTGTGTCTTCAACAAATTCAGGGATGCTTTTGAGAAGGAAATGGAGGGATTGCC 
ATCAACAACACGTTCTGTAGGAGAACTTCCACCTGAGCTAAAATGCCCATTATGCAAAGA 
AGTGATGAAAGATGCTGCGCTTACAAGCAAATGTTGTTACAAGAGCTTCTGTGACAAGTG 
TAAGTTCTTTTAATGCATTCTGCTGTTCCACAAAAACCTTTTCTGACCGTTGTCAGTTCC 
AGTTCTACATTATTATCCTTTTTCACTGATTCAGGTATCAGAGATCACATTATTTCAAAG 
TCAATGTGTGTTTGTGGAAGATCAGATGTACTTGCTGACGACCTTCTACCAAACAAGACC 
CTCAGGGATACCATAAACCGTATTTTGGAAGCTGGAAACGATAGCACTGAGAATGTGGGC 
AGCGTTGGCCATATCCCAGGTCCGTCATTATTTTAAATTCATGTGTTTTTAAACTTTGTT 
TGATTAGTCCTCACTACTGAATTATCATGGACAATATAGATTTGGAGTCTGCACGCTGTC 
CACCTCCCAAGGCTCTATCTCCTACTACATCTGTTGCATCTAAAGGCGAGAAGAAACCAG 
TACTTAGTAACAATAATGATGCTTCAACTTTAAAGGCGCCAATGGAAGTTGCAGAGATCA 
CAAGTGCCCCTCGTGCATCTGCAGAAGTGAATGTAGAAAAGCCAGTTGATGCATGTGAAA 
GCACTCAAGGGTCCGTGATTGTGAAAGAAGCAACAGTGTCAAAGTTGAATACGCAAGCCC 
CCAAGGAAGAAATGCAGCAGCAGGTTGCTGCTGGAGAGCCAGGTAAAATAAAGATGTACT 
AATATTAGCTTCACTGGACATTGCGAATGATTGGTGACTGATAGTCCAGTTCAGATTTCC 
CTACTGAGATTAATCAAGCTGGACCTCACATGAACCTTTTTTTTTTCAATTACTGAGGAA 
CCCTTGTTGTCATTCATCAATGTAATACGTACTTATTGTCTCTATACAGGAAAAAAGAAG 
AAAAAGAAACCAAGAGTGCCTGGGAATGGTAAAAGCTTTCTTTGCTACGCTGAAGGCAAT 
ACATTGTCAGTTTCGAAGTCTATGTGAATCGAATGGGAGGTCTAAAAGATGGTTTGTTTA 
TGTGATTTATTGCAGACATGCAATGGAATCCTGTGCCAGATCTAGCAGGCCCTGACTATA 
TGATGCAAATGGGACCAGGTCCGCAGTACTTCAACGGCATGCAACCTGGCTTCAATGGCG 
TACAACCAGGCTTCAACGGTGTTCAACCTGGCTTCAATGGCTTTCACCCTGGCTTCAATG 
GATTTGGAGGCCCGTTTCCAGGCGCAATGCCTCCATTTATGGGTTACGGATTAAACCCAA 
TGGACATGGGATTTGGTGGGGGTATGAATATGATGCATCCAGATCCATTCATGGCACAAG 
GATTTGGGTTCCCTAATATACCACCACCCCATAGGTAAAACACTCACTCTATCAAAGAAG 
AGCAATAAAGCTTTCTCAACAAGTCTCATGATGGAACTTTCTGTGCATGCGCAGGGACCT 
AGCTGAAATGGGAAACCGAATGAATCTCCAACGTGCTATGATGGGCAGAGATGAAGCCGA 
AGCCCGAAACGCTGAGATGTTAAGAAAACGTGAAAACGAGAGACGACCTGAAGGGTAAAA 
AGAAAACACTCACTCTATTTTTACTACAGATTCAAACAAGGATATGCTAAAACCTAAACA 
TTGGTTGTTGTTTGGTTGTATATACAGTGGGAAGATGTTTAGGGATGGAGAGAATAGCAG 
AATGATGATGAACAACGGTACTTCAGCCTCTGCATCATCCATCAACCCTAATAAATCTGT 
ATGTCTCCTTTTGTTTGACTCATCTTCCCCTCTCGCTCTCTCTTTCTTCTTTTCTTTGTT 
CACCTGTGCTTCGCTCTCTCCCATTTACTTTTGGTTATATGTTATTATTATATCAGAAAA 
TGGCTCCAAATTCTCTTCCCTGATTCCCTCATTTTGCTTATTTTGAAAACCCAAAAAAAA 
AAAAAAAAAAACTTGAAGAAAACTAGGGGAAAATATATTGGTTTCTAACGTAATTTTCTG 
AAATATAAAATTGGGGTTTATCAGAAACTAAGGGCTGTGAATAAAAAGGAAAAGAAATAG 
AAGGGTAGATGGCTAAAAAGCCTAAAATGCAAAATAGTAGGCGTAGGAACCGAAAGGTGA 
CGACGGTAACTGGGCTATTGAGCCCATTTCCTTTTTATTTGTGGGCCGAATTCAATACAT 
ATTTTATTATAATAATTTGGGCTAACAATTGTTTTACAGAGACAAGCACCTCCACCACCA 
ATCCACGATTACGATCGCCGGAGACGACCGGAGAAGAGACTATCCCCAGAGCATCCGCCT 
ACGCGTAAAAACATTTCCCCGTCTCGCGACTCCAAGAGAAAATCCGAGCGTTATCCTGAT 
GAACGAGATCGGCAACGCGACCGTGAGAGGTCACGTCACCAAGACGTAGATCGTGAACAC 
GACCGTACTCGCGACCGTCGCGATGAAGACAGAAGCCGAGATCATCGCCACCACCGTGGT 
GAAACCGAACGCAGCCAACATCACCACCGCAAGAGATCGGAACCGCCTTCATCGGAGCCA 
CCAGTCCCTGCTACTAAAGCAGAGATCGAGAATAATCTTAAGTCTAGCGTATTCGCTCGG 
ATAAGTTTTCCGGAGGAAGAAACATCTTCTGGTAAACGAAGAAAGGTGCCTTCCTCTTCT 
TCTACTTCTGTTACGGATCCATCTGCTTCCGCCTCTGCCGCAGCCGCCGTGGGAACATCA 
GTTCACCGACACAGTAGTCGGAAGGAAATAGAAGTAGCAGATTATGAATCTAGTGATGAA 
GATAGGCATTTCAAGAGGAAGCCGTCAAGGTACGCGCGATCACCACCGGTGGTGGTTAGT 
GATGTGAGTGAAGATAAACTCCGATACTCAAAACGTGGAAAGGGGGAGAGATCTCGAGCT 
TGACATGGATTTTCAAACATGTTTTTTTTTTTTTTTGTATAATCAAAAACAGAGAATGAG 
AATCTTCTTGTTTTGCTGTAACGAACAAAGAGAGAGAGTTCTTTTGTCATCGAATTCTTT 
TTTAATTTTTGTAGTGGAATTCGATTTCGTAACTACTTTATTCTTAATCTATGAGACCAG 
CGAATTTACAG
>AT5G47430.2 |  zinc ion binding 
ATAAACACGGATACGAGAGAAAGAGAGCTCTTGTGTCCAAACCCTAGATTTCAAGATCGA 
TCTATCTTCTTTCTCGTGAAGACACCGCTCTCTACTCGATTCCTATGATTACTCTCTAGA 
TCCTTTTCAATTTCCCCCCGAAAGGTTTCTCGATTTTGATCCCCCAAATCGGAGCTTGGA 
GCTACCGGATCTTATGGAGTGAAGCCCGATCATCCGTTTCTTTGTTACAAGTTGTCGTTT 
TGTAGCTGCGAAGATTCCTCGGAGAAGGAGATTTGGAGACATCACCGGCGCCATTCTCAG 
CTCGGCGATCACACGGACGTTCTCGTTCCTTGAATCTGCAGGAACTTTTCCAGGATTCGT 
TGATTTGGATTGATTTTGCTACACGCGTGGAGTTTCCTTCTGTGAAGTCGAATCAGCGAA 
GTAAAAATTGAATCTTTAGGGTTTTCTTAGTTTGTATTTACCTTTTTGTTTTGGAAATCA 
AATCTCTGGCCTCGTTTTTTTTTTTTAATAATCCGGAGGCCTTGATTAGGGTTTTCAAAA 
TCTAGTAGCTTTGTGTCATGATCTTTATAAGATAAGTAATAGATATATGTATTTTTTTGC 
TTTTTATATCAGATACAAATTTTCAATGGCAATTTATTACAAGTTTAAGAGTGCAAGGGA 
TTATGATACCATTGCCATGGATGGTCCTTTTATATCCGTCGGTATTCTCAAAGACAAAAT 
TTTCGAAACTAAGCATTTGGGCACTGGTAAAGACCTTGATATTGTCGTCTCCAATGCCCA 
AACTAACGAAGGTTTGTCTTCTATGTCAAATGTTGTGCTGCGCTTTTCGTATTATTAGAC 
TGTTTGCTTGCAGCTGTGATACAATGAACTTTATTTTATGTTATGATTGTTTACTAGCTG 
AGCTTTGTCTTATTTTTTTTTTACTTTTGTGAACTATTAGGAAATGGTTTGTTGGAATAT 
GATTCTTGAATTTCTCAGGAAGCTTTAGTGTACTGTGTCTCGTGCCAATATGATTGCAAT 
CTGTGGCCTTTATATGTTCTCTGTTTTGAATTTTCAGAGTATCTGGATGAAGCAATGTTA 
ATCCCAAAGAATACATCTGTCCTTATTCGTCGGGTTCCTGGACGTCCTCGCATCACAGTT 
ATTACCACACAAGAGTACTTTCTCAGATCTTTAGTTTCTATATTCTTTGTCTACTTATTT 
AGCTATTAAACTTAAATAGACATGATATTAAAAGCATTGCATTTTACTGGTGCATCGTTT 
TAGCTAAACATAAGTTAATTGTCTGACTATCGGATTTAAGAAACTTCGGGATCCTCAATG 
ATGCAAATATCTTAACTTTGCAGGCCTAGAATCCAGAATAAAGTGGAAGACGTTCAGGCT 
GAAACCACCAATTTTCCTGTTGCTGATCCATCTGCTGCTGAATTTGTAAGTTGATTATAG 
TGAACTTTTCTCGGCTTCTGTTGGCATTGACTGCACCTAATTTTCTTCTACTACAAAAGT 
ACTAATGTCATCCGTATTCACCTCTTAGCCTGAAGATGAGTATGACGAGTTTGGGACTGA 
TCTTTATTCCATTCCTGATACCCAAGATGCCCAGCATATTATTCCACGTCCTCATCTTGC 
AACCGCAGACGACAAAGTAGATGAAGAAAGCAAAATTCAGGCGCTGATTGACACTCCAGC 
ACTTGACTGGCAACAACGGTAAGCAATCTTCCAGAAATGGTGCAGGTGAAACTGTTGGAT 
TTTGTGAGAAGGTTTAACAGACCTCTTATATTTATTCAATGTAACAGACAAGGTCAAGAT 
ACTTTTGGAGCTGGTAGAGGTTATGGGAGGGGTATGCCTGGAAGGATGAATGGACGTGGT 
TTTGGTAACTTATACTTACTTTTATTCTTTGATTTTGGTTGAATTCTGGAATGTCAAAAT 
ACAGTATACAAAACATTTACTTCTGTCAAAATATTTTATATTTTTGTTCTATTTGCTCAA 
GTTGTAAGATACTTAGTTTGGTTTTGCTGGCTGGATAGGAATGGAAAGGAAAACGCCACC 
TCCAGGTTATGTGTGCCATCGTTGCAATATCCCTGGTATGTCAGCTCTGAAAATCTTTAT 
TTTTCTCTCACTTTTGTAGATGGATATATAATAGATAAGAAGTGTTGAGAGCATTTTCTT 
TGCTGTCTCAGGACATTTTATTCAGCATTGCCCCACAAATGGAGACCCTAACTATGATGT 
TAAGAGAGTTAAGCCACCTACTGGTATCCCCAAGTCCATGTTGATGGCGACCCCAGATGG 
TTCTTATTCCTTGCCAAGTGGCGCAGTTGCAGTTCTGAAACCAAATGAGTAAGTTGTACT 
GAATTAGTTTGGGAATGTTGCTATTGGGTACTTCTTCACATATATTGATTATAGTTTAAA 
TGTTTGTTGTGTCTTCAACAAATTCAGGGATGCTTTTGAGAAGGAAATGGAGGGATTGCC 
ATCAACAACACGTTCTGTAGGAGAACTTCCACCTGAGCTAAAATGCCCATTATGCAAAGA 
AGTGATGAAAGATGCTGCGCTTACAAGCAAATGTTGTTACAAGAGCTTCTGTGACAAGTG 
TAAGTTCTTTTAATGCATTCTGCTGTTCCACAAAAACCTTTTCTGACCGTTGTCAGTTCC 
AGTTCTACATTATTATCCTTTTTCACTGATTCAGGTATCAGAGATCACATTATTTCAAAG 
TCAATGTGTGTTTGTGGAAGATCAGATGTACTTGCTGACGACCTTCTACCAAACAAGACC 
CTCAGGGATACCATAAACCGTATTTTGGAAGCTGGAAACGATAGCACTGAGAATGTGGGC 
AGCGTTGGCCATATCCCAGGTCCGTCATTATTTTAAATTCATGTGTTTTTAAACTTTGTT 
TGATTAGTCCTCACTACTGAATTATCATGGACAATATAGATTTGGAGTCTGCACGCTGTC 
CACCTCCCAAGGCTCTATCTCCTACTACATCTGTTGCATCTAAAGGCGAGAAGAAACCAG 
TACTTAGTAACAATAATGATGCTTCAACTTTAAAGGCGCCAATGGAAGTTGCAGAGATCA 
CAAGTGCCCCTCGTGCATCTGCAGAAGTGAATGTAGAAAAGCCAGTTGATGCATGTGAAA 
GCACTCAAGGGTCCGTGATTGTGAAAGAAGCAACAGTGTCAAAGTTGAATACGCAAGCCC 
CCAAGGAAGAAATGCAGCAGCAGGTTGCTGCTGGAGAGCCAGGTAAAATAAAGATGTACT 
AATATTAGCTTCACTGGACATTGCGAATGATTGGTGACTGATAGTCCAGTTCAGATTTCC 
CTACTGAGATTAATCAAGCTGGACCTCACATGAACCTTTTTTTTTTCAATTACTGAGGAA 
CCCTTGTTGTCATTCATCAATGTAATACGTACTTATTGTCTCTATACAGGAAAAAAGAAG 
AAAAAGAAACCAAGAGTGCCTGGGAATGGTAAAAGCTTTCTTTGCTACGCTGAAGGCAAT 
ACATTGTCAGTTTCGAAGTCTATGTGAATCGAATGGGAGGTCTAAAAGATGGTTTGTTTA 
TGTGATTTATTGCAGACATGCAATGGAATCCTGTGCCAGATCTAGCAGGCCCTGACTATA 
TGATGCAAATGGGACCAGGTCCGCAGTACTTCAACGGCATGCAACCTGGCTTCAATGGCG 
TACAACCAGGCTTCAACGGTGTTCAACCTGGCTTCAATGGCTTTCACCCTGGCTTCAATG 
GATTTGGAGGCCCGTTTCCAGGCGCAATGCCTCCATTTATGGGTTACGGATTAAACCCAA 
TGGACATGGGATTTGGTGGGGGTATGAATATGATGCATCCAGATCCATTCATGGCACAAG 
GATTTGGGTTCCCTAATATACCACCACCCCATAGGTAAAACACTCACTCTATCAAAGAAG 
AGCAATAAAGCTTTCTCAACAAGTCTCATGATGGAACTTTCTGTGCATGCGCAGGGACCT 
AGCTGAAATGGGAAACCGAATGAATCTCCAACGTGCTATGATGGGCAGAGATGAAGCCGA 
AGCCCGAAACGCTGAGATGTTAAGAAAACGTGAAAACGAGAGACGACCTGAAGGGTAAAA 
AGAAAACACTCACTCTATTTTTACTACAGATTCAAACAAGGATATGCTAAAACCTAAACA 
TTGGTTGTTGTTTGGTTGTATATACAGTGGGAAGATGTTTAGGGATGGAGAGAATAGCAG 
AATGATGATGAACAACGGTACTTCAGCCTCTGCATCATCCATCAACCCTAATAAATCTGT 
ATGTCTCCTTTTGTTTGACTCATCTTCCCCTCTCGCTCTCTCTTTCTTCTTTTCTTTGTT 
CACCTGTGCTTCGCTCTCTCCCATTTACTTTTGGTTATATGTTATTATTATATCAGAAAA 
TGGCTCCAAATTCTCTTCCCTGATTCCCTCATTTTGCTTATTTTGAAAACCCAAAAAAAA 
AAAAAAAAAAACTTGAAGAAAACTAGGGGAAAATATATTGGTTTCTAACGTAATTTTCTG 
AAATATAAAATTGGGGTTTATCAGAAACTAAGGGCTGTGAATAAAAAGGAAAAGAAATAG 
AAGGGTAGATGGCTAAAAAGCCTAAAATGCAAAATAGTAGGCGTAGGAACCGAAAGGTGA 
CGACGGTAACTGGGCTATTGAGCCCATTTCCTTTTTATTTGTGGGCCGAATTCAATACAT 
ATTTTATTATAATAATTTGGGCTAACAATTGTTTTACAGAGACAAGCACCTCCACCACCA 
ATCCACGATTACGATCGCCGGAGACGACCGGAGAAGAGACTATCCCCAGAGCATCCGCCT 
ACGCGTAAAAACATTTCCCCGTCTCGCGACTCCAAGAGAAAATCCGAGCGTTATCCTGAT 
GAACGAGATCGGCAACGCGACCGTGAGAGGTCACGTCACCAAGACGTAGATCGTGAACAC 
GACCGTACTCGCGACCGTCGCGATGAAGACAGAAGCCGAGATCATCGCCACCACCGTGGT 
GAAACCGAACGCAGCCAACATCACCACCGCAAGAGATCGGAACCGCCTTCATCGGAGCCA 
CCAGTCCCTGCTACTAAAGCAGAGATCGAGAATAATCTTAAGTCTAGCGTATTCGCTCGG 
ATAAGTTTTCCGGAGGAAGAAACATCTTCTGGTAAACGAAGAAAGGTGCCTTCCTCTTCT 
TCTACTTCTGTTACGGATCCATCTGCTTCCGCCTCTGCCGCAGCCGCCGTGGGAACATCA 
GTTCACCGACACAGTAGTCGGAAGGAAATAGAAGTAGCAGATTATGAATCTAGTGATGAA 
GATAGGCATTTCAAGAGGAAGCCGTCAAGGTACGCGCGATCACCACCGGTGGTGGTTAGT 
GATGTGAGTGAAGATAAACTCCGATACTCAAAACGTGGAAAGGGGGAGAGATCTCGAGCT 
TGACATGGATTTTCAAACATGTTTTTTTTTTTTTTTGTATAATCAAAAACAGAGAATGAG 
AATCTTCTTGTTTTGCTGTAACGAACAAAGAGAGAGAGTTCTTTTGTCATCGAATTCTTT 
TTTAATTTTTGTAGTGGAATTCGATTTCGTAACTACTTTATTCTTAATCTATGAGACCAG 
CGAATTTACAG
>AT1G73820.1 |  Ssu72-like family protein 
GTGAAACCGTCACAGTCGCCGGGAAAAAATCACAGATTTCTTCGACGCCGCCGATGAGGT 
TCCGGTACGCAATGGTTTGTTCGTCGAATCAGAACCGGAGCATGGAAGCTCACGCTCTTC 
TTAAGAGACAAGGACTCGACGTTGCTTCGTACGGGACTGGGTCACATGTAAAACTACCTG 
GACCATCTCTGAGAGAGCCAAACGTTTACGACTTTGGAACTCCTTACAAGCAGATGTTCG 
ATGAGCTCAGGCGCAAAGATCCTGAACTGTATCCTCTTAATCCGTTCCTTTCTTTTGTTG 
CTTACGGATCATGATTTTTCGAATCCCTAAGTTTGCTTTGGTCACTGAATCAGTCTCAGT 
CTCCTTCTAATTCGATAATTTGCTTACTTTCTTAGTCTCCTTGAAATTGTTTCCTAATTC 
ACATTTAAGTTTCTTGGTTTGATTTAAGGTATTGATTCTGGGAAAAAGTATGTTTTCTTC 
TCTCCAAATGACTGAAGAAAAAGTGTGTGCGTTTTAGTAAATATACGAAATTTCTTGCTT 
GTAGCTATTGTGAAGCATGTTCATTGGGTTGTATAGGGAGATTTGTAAGCTTGAAGTTTG 
ATGCACTTAACTGTTTTCATCAGATACAAGCGGAATGGTATTTTGCAGATGATTAAGAGG 
AATTTATCCGTGAAACTTGCTCCTCAAAGATGGCAAGATAATGCTGGTGATGGTGTGTTT 
GATGTGGTTATGACTTTTGAAGAAAAGGTTTTCGATTCAGTCCTTGAAGGTAATTGAAAA 
ATCCTCCCTATTTTACAGTTAGATACTTTGTTTGAAAATTGCTTCATCCTGATTGCTCAC 
TACGTACATATTGATCACAAACTCTTATAACATTGGAAGAAAAAAATCCTGGTATCAGTA 
GATTTGTTCATCAACTTATCCCATTTGAAGAAAATCGAAATGTTGACACTTTGATCTTCT 
ACATGCATTGTTTCCGAACAATCTTCTCATTTGGTAAATTATGTTAAACTAGTTAGGTTA 
GATGTTTACATATGTGAATTGATGAAGTCTAAGTCATGTGAAACTCAAAAGTTCTGCTTA 
GTGATTGCCGTTTCCTGTAACTTAGTTTACTTTTTTACCTTGCTGTAATTGTTAGCTGAA 
AACCCGATTGCAATCATGGTTTGATAGAACTGTCGGTTTTCTTGCTGCGTGAAACATTCC 
TGTGTCTTAATATCTTTATCTCATCAAGTTAGATTTGTCCCCAATCTGCAGATCTCAACA 
ACAGAGAACAATCACTTACGAAAACAATACTTGTGATGAACTTGGAGGTTAAAGATAACC 
ACGAAGAAGCAGCTATAGGTGGCCGACTTGCCTTGGAACTCTGTCAAGAGATTGAAGGGA 
ATGAAACATGGGAAGATACGATCGATGACATTGTTGCGGGTTTTGAAAAACAACACAGGC 
GGAAACTGGTCTACAGCATCTCATTCTACTGAAGATACCATCATCAGTCGCATTAACGGT 
CAGATTATGTAGAGTGTTCTTCTGTGACCCCAGTCTTGAGATGTTGAACAAATTATTTTT 
AGTTCATCGGTTTTATATGTTTTAGGGTTAAATACTTGAGAGTGTAGAAGAAATTGCATG 
TTAGAAACTGAGAATTCGTCTTCCAAACACATTCTCTTGTGTTGTTTCTCATTACTTGAA 
AGTTGAAACAGAGCCTTGTC
>AT1G74060.1 |  60S ribosomal protein L6 (RPL6B) 
ACTACCCAATTTATTCTCGGCCGGAAAGTCTCTTCTTGATTATCGTCCAGGGATTGCAAC 
AGAGAGAAAGTAACGATGCCGGCGAAACAGAGGACAGCTAAGGTCAACAGGAATCCTGAT 
CTGATCAGGGGAGTTGGTAAATACTCAAGGTCTCAGATGTACCATAAGAGAGGTTTGTGG 
GCAATCAAGGCCAAAAATGGAGGCGTTTTCCCCCGCCACGACGCTAAATCTAAGGTTGAT 
GCTCCGGTGGAGAAGCCACCGAAGTTCTATCCAGCTGAAGACGTGAAGAAACCTCTCCCC 
AACAGGCGCACGGCAAAACCAGCCAAGCTCAGGTACTTAGCTGATACACTGTCTCATTGT 
CTTGGAGTCTGAAATCTAGCTCAATGCAATAGTTGTTTTCTTTGGTTCTTAAGGAGTGCT 
TTGTATGCATTTAAATCTTTGAATCTCCCGAAATTTTTTGACTAGCTTAGTGTTTTGAAA 
TCGTTAATTAGTCATTGTGGTCTGTTCTATTTGGTTTGTGAATTTATCTTGATTTCTGTG 
GAAAGTTTGCCTCTTTTGCTTGTATTTTGTGTTACATTGTTCGGAATTTGTTATGTTGTA 
ATCCGATATTCATATTTCTCTATTGCAGAGCTAGCATCACTCCAGGGACAGTGCTTATCA 
TCCTTGCTGGTAGATTTAAGGGCAAGAGAGTTGTCTTCCTTAAGCAGCTTGCCTCCGGTT 
TGCTTCTTGTGACTGGTGAGTTTTATGCTAATCTACTTTCTTTATTTGCCACATTCTTTA 
TTCGAAATGCAGAACGCCCATTCACTAAACTTGCTTTCTGTATTCTGTATAAAGTTGACA 
TTCCTGTTTTGTTATTGACCTTAGGACCATTCAAGATCAATGGTGTTCCTCTGAGACGTG 
TTAACCAGGCCTATGTCATTGGTACTTCCACAAAGGTTGACATTTCTGGAGTTACCCTCG 
ACAAATTCGATGATAAGTACTTCGGCAAGGTTGCTGAGAAGAAAAAGAAGAAGACTGAAG 
GAGAGTTCTTCGAGGCTGAGAAAGAGGTATCCCAAACATTCTTCTTGTCTTTCTCTAAGA 
GTCATTTGGTTCTCATTTTGTAATAGACGATTAAAGTTCTCTCCTTTATACACTACCCAA 
ATTAAAAGCTATGCGTGACCTCCATATACTTTTTTTCCTTCCGCAGGAGAAGAAAGAGAT 
TCCACAGGGAAAGAAAGATGACCAGAAAGCCGTGGACGCAGCTTTGATCAAAGCTATTGA 
AGCAGTTCCAGAGTTGAAGACTTACCTCGGAGCAAGGTTTTCATTGAAACAAGGAATGAA 
GCCCCATGAGCTTGTTTTCTAGATTTCATTACTTTTTTTCTGAGGTTTCTAGTGTATCTG 
TCTCCTGAAGTTTTACACTCCAACTGGTTGGTTCTGTTCTCGTCCACTGACCAGAGACAT 
AAAATCTTGGCTGCTGCTATCTGGATTTCTGTCTTATATGGATAATTTATCAATCCTGTT 
TTTGAAGGAGAACTTTTCACAAGATTCTAGTAATGCTTAAGT
>AT1G17980.2 |  nucleotidyltransferase family protein 
TCTCATTCTTTGCGACGGTGACCCGACAAGATTATTGCCGGGAAACAGACCGAGAAGATT 
AAGCGTAAGATTCTCAACGAATGTTGGAGAAGGAATCTGATTTGACTGCAACGGAGAAAC 
CAAATAACAAGCACGCGGCTGATTCGTTTTCCAGCGAGGATTTGGTCTCACGCGGAGAAA 
CCAAATAACAAGCACGCGGAGATCAATTATTTTTATTTTCGTAGAATCTGATTGAAATAT 
TAAGAAAAAAGAGAAAAAAGAGAGGAAAAGAGCAAAGTAAGTAGGATAGATGGCTAGTGT 
CCAGCAAAATGGGCAACGGTTTGGCGTTTCAGAACCTATCTCTATGGGAGGACCAACGGA 
GTTTGATGTGATCAAGACAAGAGAGCTCGAGAAGGTTTTACTGATATCTTAATGCTTTTT 
TCTTGTAATGCTTTATTGTTTTAGTTTTAAAGTTTACTCATGATATACTTCTTAGTTTTA 
TACTGATTGATAGTATATTGAGTTGTGTTATTTGGTTGTTCAGCACTTGCAAGATGTTGG 
ATTGTACGAGAGCAAGGAGGAAGCTGTTAGAAGGGAGGAGGTTCTGGGGATACTAGATCA 
GGTTTTGTAGTACTTTTGAATCCTAAGAACTTGTGCTTATGGAGTTTTCATCGATGTTAG 
TAACGAACTCTTGATAAATCTTCGTTGTTGATGTGTCCAGATTGTAAAAACATGGATTAA 
AACAATCAGCCGCGCCAAAGGGTTGAATGATCAGCTGCTTCATGAGGCGAATGCAAAGAT 
ATTTACTTTCGGTTCTTATCGACTAGGGGTAATGATTAAGATCTATAGAAGATTTAGCTT 
TGTTTTAGTCATTCTTCTTGTATTGCGAAGTAGAGGGAAAGGGAACAATGTGAATTGGTG 
GAAACTGTGTTTTGTTTCTGTTGTCTTGTCTTGTGAGACGTCCCTGAGTGGGAAGTGGAA 
TCACTCGTCTTTACATGCTCTTTGCATTCATTTAAACATATTGAGGTCTCAATGTTATAT 
ATGTCACTTGAATCATATCTAACTGAGCTTTTCAGTCATTTTAATTATTGGTAAATCTTA 
GACACAATAGGGGGCTATTTATGGTTGCAATTGGTTCTTGGAGAGAATTCAGAGTCCTAA 
AGAGTTCCTTCTCTCCGATTTCTAGCATATTGAGTGCTCCTATAACAGTTCGTTTTACTT 
CTTCAAATAGGTACATGGACCTGGTGCTGATATAGACACTTTATGTGTGGGACCTAGACA 
TGCAACTAGAGAAGTACTATAACCTCTTGCATCTATATGTTGGCTGATTATTTCTTCTGT 
CAATTTATTGTGTTCAATATTCATCTTTATATTTTCCATTAGGGTGATTTCTTTGGTGAG 
CTACAAAGAATGCTGTCAGAAATGCCGGAAGTAACTGAACTGCACCCTGTGCCTGATGCT 
CATGTTCCATTGATGGGATTCAAACTTAATGGAGTTTCTATAGATCTCCTTTATGCACAA 
CTTCCACTCTGGGTTATACCTGAGGTAATTTCTTGTCCACAATGAGGTGATTGTTAGTGA 
GGACTAGGAAATTCGTAGATAAGTATGTTTTAACTTATCGAATTGAACCTCACTAAACTC 
ATCCTTACTGATTACAATCAATTAGTTTCACTCTATTACACAGTTTACATTATGTTCATG 
AATTTAAATGAATGTTATGAGTGGATCTCGTAGAAAATAGGTAATCTGAACCTGGAGCTC 
TGGTCCTGTTCCTCTTATGGAGGCTTAAATGTGTTCCCTGCCTGATGTTAATGGTGCAGG 
ACTTAGATTTATCACAGGACTCCATTCTACAGAATGCTGATGAGCAAACTGTTCGAAGTC 
TCAACGGTTGTAGAGTTACTGACCAAATCTTGCGTCTGGTTCCAAACATTCAGGTTTCGT 
GCTCACTGACCATAAATCTCTTATCTTCTAAAATTTAATTACTCATCCATATGATTTGCT 
TAGCCTGAGTACATGTTTTTTTCTTTGTTTCTGAGCAGAATTTCAGAACAACATTAAGAT 
GCATGAGATTTTGGGCCAAACGACGTGGAGTATACTCTAATGTATGGAGAATTCTTCTAT 
AATGCTCTTCTATTTTTTATGTGACTATCATGTTGCTTAAGTAAAGTATCTTTCTGACAA 
TTGCTAGGTCTCGGGATTTCTTGGTGGTATAAACTGGGCATTGCTTGTAGCTCGGATATG 
TCAACTTTATCCTAACGCCCTCCCTAATATTTTAGTGTCTCGGTTCTTTAGGGTCTTCTA 
TCAATGGAATTGGCCGAACGCCATTTTTCTTTGTTCTCCGGATGAAGGATCCCTTGGTCT 
TCAAGTTTGGGATCCTAGAATAAACCCAAAGGATCGGTTGCATATAATGCCCATCATTAC 
TCCTGCTTATCCTTGTATGAACTCTAGTTACAATGTCTCTGAAAGTACATTGCGGATTAT 
GAAAGGAGAGTTTCAGAGAGGAAACGAAATATGTGAGGTAAGATTTCGATAAGTCCAAAT 
AGTTGGCTTCTATGCAGATTCATGGACTTATTACAACGGCTTGATGTCTTGCAGGCTATG 
GAATCAAACAAAGCTGACTGGGATACCCTTTTTGAGCCATTTGCATTCTTTGAAGCGTAT 
AAAAACTATCTACAGATAGACATTTCTGCTGCAAATGTCGATGATCTAAGAAAATGGAAA 
GGCTGGGTTGAGTCACGCCTCCGCCAGCTCACACTGAAGGTGAAAAGCCATGTTTACTTT 
AACTTGAATAGTTTCTCTTGATTTTGCTTTGCTAATGATTTGTCTTGGATGTTTGCATTG 
TAATCTTAGATCGAGAGACATTTTAAAATGCTTCATTGCCACCCTCATCCCCATGATTTT 
CAAGACACATCCCGGCCACTCCATTGCTCTTACTTCATGGGTCTGCAACGTAAACAAGGA 
GTTCCAGCAGCAGAAGGCGAGCAATTCGATATCAGAAGAACCGTTGAGGAGTTTAAACAC 
ACTGTCAACGCTTACACATTGTGGATTCCAGGGATGGAGATTAGTGTTGGCCATATAAAA 
CGGAGAAGCTTACCTAATTTTGTGTTTCCTGGTGGAGTTAGACCTTCACATACCTCTAAA 
GGAACATGGGACAGCAATCGCCGTTCAGAGCACAGAAATTCTTCTACATCAAGTGCACCA 
GCTGCTACTACCACTACTACCGAAATGAGTTCTGAAAGTAAAGCTGGTTCTAACAGTCCA 
GTTGATGGGAAGAAGAGAAAATGGGGAGATAGTGAAACACTCACCGATCAGCCAAGGAAC 
TCTAAACACATTGCTGTTTCAGTGCCTGTAGAGAATTGTGAAGGCGGGAGTCCAAATCCA 
TCTGTTGGATCAATTTGTTCAAGTCCTATGAAAGATTATTGTACAAACGGTAAATCTGAG 
CCTATTAGTAAGGATCCACCAGAAAATGTTGTTGCTTTCAGTAAGGATCCACCAGAGAGT 
CTTCCGATAGAAAAGATAGCCACTCCTCAAGCTCATGAAACTGAGGAGCTTGAAGAAAGT 
TTTGATTTTGGAAACCAAGTGATTGAGCAGATATCTCATAAAGTTGCAGTCCTGTCTGCT 
ACTGCAACTATACCTCCATTCGAAGCTACTTCAAATGGCTCTCCTTTCCCTTATGAAGCA 
GTGGAAGAACTTGAGGTTTCTTATTTTTCTTATCAATTTTCGATACATAAATTGTTCTCT 
TGATCTTATTCCTCCTGTCTGATTTCTCTTTTGTTGAAAGGTTCTTCCCACGCGACAGCC 
CGATGCGGCACATAGACCTTCAGTACAACAGCGAAAACCGATAATCAAGTAAGTGATTTT 
GTGTCTATGTTTACTCTTAACGTTTGAATATACATTTTTGGATTTTGACAAAGATTGTTT 
GTTTTTGTTTGTCTGATTATTCGCAGATTGAGCTTCACGTCTCTAGGCAAAACCAATGGC 
AAGTAATAATGGCTTTTCCCTACATTGCCAAGAATCTCAGAGCACTTACGGAAATTCGAG 
ATGTTAAGTTGAGGGGTTCTTGTTACTTTATGTCTTATATTTATATGCTTTTCTTAGATG 
TTGCATGATCTCATGTAAAACTCGTTTGGATAAGATTAATGTAATGTGTTCTTGTCTATG 
GATCCCAAACACTTTTTCTGTCATAAATAAAAGTCTGGGTTGAGTTTACTTC
>AT1G17980.2 |  nucleotidyltransferase family protein 
TCTCATTCTTTGCGACGGTGACCCGACAAGATTATTGCCGGGAAACAGACCGAGAAGATT 
AAGCGTAAGATTCTCAACGAATGTTGGAGAAGGAATCTGATTTGACTGCAACGGAGAAAC 
CAAATAACAAGCACGCGGCTGATTCGTTTTCCAGCGAGGATTTGGTCTCACGCGGAGAAA 
CCAAATAACAAGCACGCGGAGATCAATTATTTTTATTTTCGTAGAATCTGATTGAAATAT 
TAAGAAAAAAGAGAAAAAAGAGAGGAAAAGAGCAAAGTAAGTAGGATAGATGGCTAGTGT 
CCAGCAAAATGGGCAACGGTTTGGCGTTTCAGAACCTATCTCTATGGGAGGACCAACGGA 
GTTTGATGTGATCAAGACAAGAGAGCTCGAGAAGGTTTTACTGATATCTTAATGCTTTTT 
TCTTGTAATGCTTTATTGTTTTAGTTTTAAAGTTTACTCATGATATACTTCTTAGTTTTA 
TACTGATTGATAGTATATTGAGTTGTGTTATTTGGTTGTTCAGCACTTGCAAGATGTTGG 
ATTGTACGAGAGCAAGGAGGAAGCTGTTAGAAGGGAGGAGGTTCTGGGGATACTAGATCA 
GGTTTTGTAGTACTTTTGAATCCTAAGAACTTGTGCTTATGGAGTTTTCATCGATGTTAG 
TAACGAACTCTTGATAAATCTTCGTTGTTGATGTGTCCAGATTGTAAAAACATGGATTAA 
AACAATCAGCCGCGCCAAAGGGTTGAATGATCAGCTGCTTCATGAGGCGAATGCAAAGAT 
ATTTACTTTCGGTTCTTATCGACTAGGGGTAATGATTAAGATCTATAGAAGATTTAGCTT 
TGTTTTAGTCATTCTTCTTGTATTGCGAAGTAGAGGGAAAGGGAACAATGTGAATTGGTG 
GAAACTGTGTTTTGTTTCTGTTGTCTTGTCTTGTGAGACGTCCCTGAGTGGGAAGTGGAA 
TCACTCGTCTTTACATGCTCTTTGCATTCATTTAAACATATTGAGGTCTCAATGTTATAT 
ATGTCACTTGAATCATATCTAACTGAGCTTTTCAGTCATTTTAATTATTGGTAAATCTTA 
GACACAATAGGGGGCTATTTATGGTTGCAATTGGTTCTTGGAGAGAATTCAGAGTCCTAA 
AGAGTTCCTTCTCTCCGATTTCTAGCATATTGAGTGCTCCTATAACAGTTCGTTTTACTT 
CTTCAAATAGGTACATGGACCTGGTGCTGATATAGACACTTTATGTGTGGGACCTAGACA 
TGCAACTAGAGAAGTACTATAACCTCTTGCATCTATATGTTGGCTGATTATTTCTTCTGT 
CAATTTATTGTGTTCAATATTCATCTTTATATTTTCCATTAGGGTGATTTCTTTGGTGAG 
CTACAAAGAATGCTGTCAGAAATGCCGGAAGTAACTGAACTGCACCCTGTGCCTGATGCT 
CATGTTCCATTGATGGGATTCAAACTTAATGGAGTTTCTATAGATCTCCTTTATGCACAA 
CTTCCACTCTGGGTTATACCTGAGGTAATTTCTTGTCCACAATGAGGTGATTGTTAGTGA 
GGACTAGGAAATTCGTAGATAAGTATGTTTTAACTTATCGAATTGAACCTCACTAAACTC 
ATCCTTACTGATTACAATCAATTAGTTTCACTCTATTACACAGTTTACATTATGTTCATG 
AATTTAAATGAATGTTATGAGTGGATCTCGTAGAAAATAGGTAATCTGAACCTGGAGCTC 
TGGTCCTGTTCCTCTTATGGAGGCTTAAATGTGTTCCCTGCCTGATGTTAATGGTGCAGG 
ACTTAGATTTATCACAGGACTCCATTCTACAGAATGCTGATGAGCAAACTGTTCGAAGTC 
TCAACGGTTGTAGAGTTACTGACCAAATCTTGCGTCTGGTTCCAAACATTCAGGTTTCGT 
GCTCACTGACCATAAATCTCTTATCTTCTAAAATTTAATTACTCATCCATATGATTTGCT 
TAGCCTGAGTACATGTTTTTTTCTTTGTTTCTGAGCAGAATTTCAGAACAACATTAAGAT 
GCATGAGATTTTGGGCCAAACGACGTGGAGTATACTCTAATGTATGGAGAATTCTTCTAT 
AATGCTCTTCTATTTTTTATGTGACTATCATGTTGCTTAAGTAAAGTATCTTTCTGACAA 
TTGCTAGGTCTCGGGATTTCTTGGTGGTATAAACTGGGCATTGCTTGTAGCTCGGATATG 
TCAACTTTATCCTAACGCCCTCCCTAATATTTTAGTGTCTCGGTTCTTTAGGGTCTTCTA 
TCAATGGAATTGGCCGAACGCCATTTTTCTTTGTTCTCCGGATGAAGGATCCCTTGGTCT 
TCAAGTTTGGGATCCTAGAATAAACCCAAAGGATCGGTTGCATATAATGCCCATCATTAC 
TCCTGCTTATCCTTGTATGAACTCTAGTTACAATGTCTCTGAAAGTACATTGCGGATTAT 
GAAAGGAGAGTTTCAGAGAGGAAACGAAATATGTGAGGTAAGATTTCGATAAGTCCAAAT 
AGTTGGCTTCTATGCAGATTCATGGACTTATTACAACGGCTTGATGTCTTGCAGGCTATG 
GAATCAAACAAAGCTGACTGGGATACCCTTTTTGAGCCATTTGCATTCTTTGAAGCGTAT 
AAAAACTATCTACAGATAGACATTTCTGCTGCAAATGTCGATGATCTAAGAAAATGGAAA 
GGCTGGGTTGAGTCACGCCTCCGCCAGCTCACACTGAAGGTGAAAAGCCATGTTTACTTT 
AACTTGAATAGTTTCTCTTGATTTTGCTTTGCTAATGATTTGTCTTGGATGTTTGCATTG 
TAATCTTAGATCGAGAGACATTTTAAAATGCTTCATTGCCACCCTCATCCCCATGATTTT 
CAAGACACATCCCGGCCACTCCATTGCTCTTACTTCATGGGTCTGCAACGTAAACAAGGA 
GTTCCAGCAGCAGAAGGCGAGCAATTCGATATCAGAAGAACCGTTGAGGAGTTTAAACAC 
ACTGTCAACGCTTACACATTGTGGATTCCAGGGATGGAGATTAGTGTTGGCCATATAAAA 
CGGAGAAGCTTACCTAATTTTGTGTTTCCTGGTGGAGTTAGACCTTCACATACCTCTAAA 
GGAACATGGGACAGCAATCGCCGTTCAGAGCACAGAAATTCTTCTACATCAAGTGCACCA 
GCTGCTACTACCACTACTACCGAAATGAGTTCTGAAAGTAAAGCTGGTTCTAACAGTCCA 
GTTGATGGGAAGAAGAGAAAATGGGGAGATAGTGAAACACTCACCGATCAGCCAAGGAAC 
TCTAAACACATTGCTGTTTCAGTGCCTGTAGAGAATTGTGAAGGCGGGAGTCCAAATCCA 
TCTGTTGGATCAATTTGTTCAAGTCCTATGAAAGATTATTGTACAAACGGTAAATCTGAG 
CCTATTAGTAAGGATCCACCAGAAAATGTTGTTGCTTTCAGTAAGGATCCACCAGAGAGT 
CTTCCGATAGAAAAGATAGCCACTCCTCAAGCTCATGAAACTGAGGAGCTTGAAGAAAGT 
TTTGATTTTGGAAACCAAGTGATTGAGCAGATATCTCATAAAGTTGCAGTCCTGTCTGCT 
ACTGCAACTATACCTCCATTCGAAGCTACTTCAAATGGCTCTCCTTTCCCTTATGAAGCA 
GTGGAAGAACTTGAGGTTTCTTATTTTTCTTATCAATTTTCGATACATAAATTGTTCTCT 
TGATCTTATTCCTCCTGTCTGATTTCTCTTTTGTTGAAAGGTTCTTCCCACGCGACAGCC 
CGATGCGGCACATAGACCTTCAGTACAACAGCGAAAACCGATAATCAAGTAAGTGATTTT 
GTGTCTATGTTTACTCTTAACGTTTGAATATACATTTTTGGATTTTGACAAAGATTGTTT 
GTTTTTGTTTGTCTGATTATTCGCAGATTGAGCTTCACGTCTCTAGGCAAAACCAATGGC 
AAGTAATAATGGCTTTTCCCTACATTGCCAAGAATCTCAGAGCACTTACGGAAATTCGAG 
ATGTTAAGTTGAGGGGTTCTTGTTACTTTATGTCTTATATTTATATGCTTTTCTTAGATG 
TTGCATGATCTCATGTAAAACTCGTTTGGATAAGATTAATGTAATGTGTTCTTGTCTATG 
GATCCCAAACACTTTTTCTGTCATAAATAAAAGTCTGGGTTGAGTTTACTTC
>AT1G17980.1 |  nucleotidyltransferase family protein 
ATCTCATTCTTTGCGACGGTGACCCGACAAGATTATTGCCGGGAAACAGACCGAGAAGAT 
TAAGCGTAAGATTCTCAACGAATGTTGGAGAAGGAATCTGATTTGACTGCAACGGAGAAA 
CCAAATAACAAGCACGCGGCTGATTCGTTTTCCAGCGAGGATTTGGTCTCACGCGGAGAA 
ACCAAATAACAAGCACGCGGAGATCAATTATTTTTATTTTCGTAGAATCTGATTGAAATA 
TTAAGAAAAAAGAGAAAAAAGAGAGGAAAAGAGCAAAGTAAGTAGGATAGATGGCTAGTG 
TCCAGCAAAATGGGCAACGGTTTGGCGTTTCAGAACCTATCTCTATGGGAGGACCAACGG 
AGTTTGATGTGATCAAGACAAGAGAGCTCGAGAAGGTTTTACTGATATCTTAATGCTTTT 
TTCTTGTAATGCTTTATTGTTTTAGTTTTAAAGTTTACTCATGATATACTTCTTAGTTTT 
ATACTGATTGATAGTATATTGAGTTGTGTTATTTGGTTGTTCAGCACTTGCAAGATGTTG 
GATTGTACGAGAGCAAGGAGGAAGCTGTTAGAAGGGAGGAGGTTCTGGGGATACTAGATC 
AGGTTTTGTAGTACTTTTGAATCCTAAGAACTTGTGCTTATGGAGTTTTCATCGATGTTA 
GTAACGAACTCTTGATAAATCTTCGTTGTTGATGTGTCCAGATTGTAAAAACATGGATTA 
AAACAATCAGCCGCGCCAAAGGGTTGAATGATCAGCTGCTTCATGAGGCGAATGCAAAGA 
TATTTACTTTCGGTTCTTATCGACTAGGGGTAATGATTAAGATCTATAGAAGATTTAGCT 
TTGTTTTAGTCATTCTTCTTGTATTGCGAAGTAGAGGGAAAGGGAACAATGTGAATTGGT 
GGAAACTGTGTTTTGTTTCTGTTGTCTTGTCTTGTGAGACGTCCCTGAGTGGGAAGTGGA 
ATCACTCGTCTTTACATGCTCTTTGCATTCATTTAAACATATTGAGGTCTCAATGTTATA 
TATGTCACTTGAATCATATCTAACTGAGCTTTTCAGTCATTTTAATTATTGGTAAATCTT 
AGACACAATAGGGGGCTATTTATGGTTGCAATTGGTTCTTGGAGAGAATTCAGAGTCCTA 
AAGAGTTCCTTCTCTCCGATTTCTAGCATATTGAGTGCTCCTATAACAGTTCGTTTTACT 
TCTTCAAATAGGTACATGGACCTGGTGCTGATATAGACACTTTATGTGTGGGACCTAGAC 
ATGCAACTAGAGAAGTACTATAACCTCTTGCATCTATATGTTGGCTGATTATTTCTTCTG 
TCAATTTATTGTGTTCAATATTCATCTTTATATTTTCCATTAGGGTGATTTCTTTGGTGA 
GCTACAAAGAATGCTGTCAGAAATGCCGGAAGTAACTGAACTGCACCCTGTGCCTGATGC 
TCATGTTCCATTGATGGGATTCAAACTTAATGGAGTTTCTATAGATCTCCTTTATGCACA 
ACTTCCACTCTGGGTTATACCTGAGGTAATTTCTTGTCCACAATGAGGTGATTGTTAGTG 
AGGACTAGGAAATTCGTAGATAAGTATGTTTTAACTTATCGAATTGAACCTCACTAAACT 
CATCCTTACTGATTACAATCAATTAGTTTCACTCTATTACACAGTTTACATTATGTTCAT 
GAATTTAAATGAATGTTATGAGTGGATCTCGTAGAAAATAGGTAATCTGAACCTGGAGCT 
CTGGTCCTGTTCCTCTTATGGAGGCTTAAATGTGTTCCCTGCCTGATGTTAATGGTGCAG 
GACTTAGATTTATCACAGGACTCCATTCTACAGAATGCTGATGAGCAAACTGTTCGAAGT 
CTCAACGGTTGTAGAGTTACTGACCAAATCTTGCGTCTGGTTCCAAACATTCAGGTTTCG 
TGCTCACTGACCATAAATCTCTTATCTTCTAAAATTTAATTACTCATCCATATGATTTGC 
TTAGCCTGAGTACATGTTTTTTTCTTTGTTTCTGAGCAGAATTTCAGAACAACATTAAGA 
TGCATGAGATTTTGGGCCAAACGACGTGGAGTATACTCTAATGTATGGAGAATTCTTCTA 
TAATGCTCTTCTATTTTTTATGTGACTATCATGTTGCTTAAGTAAAGTATCTTTCTGACA 
ATTGCTAGGTCTCGGGATTTCTTGGTGGTATAAACTGGGCATTGCTTGTAGCTCGGATAT 
GTCAACTTTATCCTAACGCCCTCCCTAATATTTTAGTGTCTCGGTTCTTTAGGGTCTTCT 
ATCAATGGAATTGGCCGAACGCCATTTTTCTTTGTTCTCCGGATGAAGGATCCCTTGGTC 
TTCAAGTTTGGGATCCTAGAATAAACCCAAAGGATCGGTTGCATATAATGCCCATCATTA 
CTCCTGCTTATCCTTGTATGAACTCTAGTTACAATGTCTCTGAAAGTACATTGCGGATTA 
TGAAAGGAGAGTTTCAGAGAGGAAACGAAATATGTGAGGTAAGATTTCGATAAGTCCAAA 
TAGTTGGCTTCTATGCAGATTCATGGACTTATTACAACGGCTTGATGTCTTGCAGGCTAT 
GGAATCAAACAAAGCTGACTGGGATACCCTTTTTGAGCCATTTGCATTCTTTGAAGCGTA 
TAAAAACTATCTACAGATAGACATTTCTGCTGCAAATGTCGATGATCTAAGAAAATGGAA 
AGGCTGGGTTGAGTCACGCCTCCGCCAGCTCACACTGAAGGTGAAAAGCCATGTTTACTT 
TAACTTGAATAGTTTCTCTTGATTTTGCTTTGCTAATGATTTGTCTTGGATGTTTGCATT 
GTAATCTTAGATCGAGAGACATTTTAAAATGCTTCATTGCCACCCTCATCCCCATGATTT 
TCAAGACACATCCCGGCCACTCCATTGCTCTTACTTCATGGGTCTGCAACGTAAACAAGG 
AGTTCCAGCAGCAGAAGGCGAGCAATTCGATATCAGAAGAACCGTTGAGGAGTTTAAACA 
CACTGTCAACGCTTACACATTGTGGATTCCAGGGATGGAGATTAGTGTTGGCCATATAAA 
ACGGAGAAGCTTACCTAATTTTGTGTTTCCTGGTGGAGTTAGACCTTCACATACCTCTAA 
AGGAACATGGGACAGCAATCGCCGTTCAGAGCACAGAAATTCTTCTACATCAAGTGCACC 
AGCTGCTACTACCACTACTACCGAAATGAGTTCTGAAAGTAAAGCTGGTTCTAACAGTCC 
AGTTGATGGGAAGAAGAGAAAATGGGGAGATAGTGAAACACTCACCGATCAGCCAAGGAA 
CTCTAAACACATTGCTGTTTCAGTGCCTGTAGAGAATTGTGAAGGCGGGAGTCCAAATCC 
ATCTGTTGGATCAATTTGTTCAAGTCCTATGAAAGATTATTGTACAAACGGTAAATCTGA 
GCCTATTAGTAAGGATCCACCAGAAAATGTTGTTGCTTTCAGTAAGGATCCACCAGAGAG 
TCTTCCGATAGAAAAGATAGCCACTCCTCAAGCTCATGAAACTGAGGAGCTTGAAGAAAG 
TTTTGATTTTGGAAACCAAGTGATTGAGCAGATATCTCATAAAGTTGCAGTCCTGTCTGC 
TACTGCAACTATACCTCCATTCGAAGCTACTTCAAATGGCTCTCCTTTCCCTTATGAAGC 
AGTGGAAGAACTTGAGGTTTCTTATTTTTCTTATCAATTTTCGATACATAAATTGTTCTC 
TTGATCTTATTCCTCCTGTCTGATTTCTCTTTTGTTGAAAGGTTCTTCCCACGCGACAGC 
CCGATGCGGCACATAGACCTTCAGTACAACAGCGAAAACCGATAATCAAGTAAGTGATTT 
TGTGTCTATGTTTACTCTTAACGTTTGAATATACATTTTTGGATTTTGACAAAGATTGTT 
TGTTTTTGTTTGTCTGATTATTCGCAGATTGAGCTTCACGTCTCTAGGCAAAACCAATGG 
CAAGTAATAATGGCTTTTCCCTACATTGCCAAGAATCTCAGAGCACTTACGGAAATTCGA 
GATGTTAAGTTGAGGGGTTCTTGTTACTTTATGTCTTATATTTATATGCTTTTCTTAGAT 
GTTGCATGATCTCATGTAAAACTCGTTTGGATAAGATTAATGTAATGTGTTCTTGTCTAT 
GGATCCCAAACACTTTTTCTGTCATAAATAAAAGTCTGGGTTGAGTTTACTTCACATATA 
TA
>AT1G17980.1 |  nucleotidyltransferase family protein 
ATCTCATTCTTTGCGACGGTGACCCGACAAGATTATTGCCGGGAAACAGACCGAGAAGAT 
TAAGCGTAAGATTCTCAACGAATGTTGGAGAAGGAATCTGATTTGACTGCAACGGAGAAA 
CCAAATAACAAGCACGCGGCTGATTCGTTTTCCAGCGAGGATTTGGTCTCACGCGGAGAA 
ACCAAATAACAAGCACGCGGAGATCAATTATTTTTATTTTCGTAGAATCTGATTGAAATA 
TTAAGAAAAAAGAGAAAAAAGAGAGGAAAAGAGCAAAGTAAGTAGGATAGATGGCTAGTG 
TCCAGCAAAATGGGCAACGGTTTGGCGTTTCAGAACCTATCTCTATGGGAGGACCAACGG 
AGTTTGATGTGATCAAGACAAGAGAGCTCGAGAAGGTTTTACTGATATCTTAATGCTTTT 
TTCTTGTAATGCTTTATTGTTTTAGTTTTAAAGTTTACTCATGATATACTTCTTAGTTTT 
ATACTGATTGATAGTATATTGAGTTGTGTTATTTGGTTGTTCAGCACTTGCAAGATGTTG 
GATTGTACGAGAGCAAGGAGGAAGCTGTTAGAAGGGAGGAGGTTCTGGGGATACTAGATC 
AGGTTTTGTAGTACTTTTGAATCCTAAGAACTTGTGCTTATGGAGTTTTCATCGATGTTA 
GTAACGAACTCTTGATAAATCTTCGTTGTTGATGTGTCCAGATTGTAAAAACATGGATTA 
AAACAATCAGCCGCGCCAAAGGGTTGAATGATCAGCTGCTTCATGAGGCGAATGCAAAGA 
TATTTACTTTCGGTTCTTATCGACTAGGGGTAATGATTAAGATCTATAGAAGATTTAGCT 
TTGTTTTAGTCATTCTTCTTGTATTGCGAAGTAGAGGGAAAGGGAACAATGTGAATTGGT 
GGAAACTGTGTTTTGTTTCTGTTGTCTTGTCTTGTGAGACGTCCCTGAGTGGGAAGTGGA 
ATCACTCGTCTTTACATGCTCTTTGCATTCATTTAAACATATTGAGGTCTCAATGTTATA 
TATGTCACTTGAATCATATCTAACTGAGCTTTTCAGTCATTTTAATTATTGGTAAATCTT 
AGACACAATAGGGGGCTATTTATGGTTGCAATTGGTTCTTGGAGAGAATTCAGAGTCCTA 
AAGAGTTCCTTCTCTCCGATTTCTAGCATATTGAGTGCTCCTATAACAGTTCGTTTTACT 
TCTTCAAATAGGTACATGGACCTGGTGCTGATATAGACACTTTATGTGTGGGACCTAGAC 
ATGCAACTAGAGAAGTACTATAACCTCTTGCATCTATATGTTGGCTGATTATTTCTTCTG 
TCAATTTATTGTGTTCAATATTCATCTTTATATTTTCCATTAGGGTGATTTCTTTGGTGA 
GCTACAAAGAATGCTGTCAGAAATGCCGGAAGTAACTGAACTGCACCCTGTGCCTGATGC 
TCATGTTCCATTGATGGGATTCAAACTTAATGGAGTTTCTATAGATCTCCTTTATGCACA 
ACTTCCACTCTGGGTTATACCTGAGGTAATTTCTTGTCCACAATGAGGTGATTGTTAGTG 
AGGACTAGGAAATTCGTAGATAAGTATGTTTTAACTTATCGAATTGAACCTCACTAAACT 
CATCCTTACTGATTACAATCAATTAGTTTCACTCTATTACACAGTTTACATTATGTTCAT 
GAATTTAAATGAATGTTATGAGTGGATCTCGTAGAAAATAGGTAATCTGAACCTGGAGCT 
CTGGTCCTGTTCCTCTTATGGAGGCTTAAATGTGTTCCCTGCCTGATGTTAATGGTGCAG 
GACTTAGATTTATCACAGGACTCCATTCTACAGAATGCTGATGAGCAAACTGTTCGAAGT 
CTCAACGGTTGTAGAGTTACTGACCAAATCTTGCGTCTGGTTCCAAACATTCAGGTTTCG 
TGCTCACTGACCATAAATCTCTTATCTTCTAAAATTTAATTACTCATCCATATGATTTGC 
TTAGCCTGAGTACATGTTTTTTTCTTTGTTTCTGAGCAGAATTTCAGAACAACATTAAGA 
TGCATGAGATTTTGGGCCAAACGACGTGGAGTATACTCTAATGTATGGAGAATTCTTCTA 
TAATGCTCTTCTATTTTTTATGTGACTATCATGTTGCTTAAGTAAAGTATCTTTCTGACA 
ATTGCTAGGTCTCGGGATTTCTTGGTGGTATAAACTGGGCATTGCTTGTAGCTCGGATAT 
GTCAACTTTATCCTAACGCCCTCCCTAATATTTTAGTGTCTCGGTTCTTTAGGGTCTTCT 
ATCAATGGAATTGGCCGAACGCCATTTTTCTTTGTTCTCCGGATGAAGGATCCCTTGGTC 
TTCAAGTTTGGGATCCTAGAATAAACCCAAAGGATCGGTTGCATATAATGCCCATCATTA 
CTCCTGCTTATCCTTGTATGAACTCTAGTTACAATGTCTCTGAAAGTACATTGCGGATTA 
TGAAAGGAGAGTTTCAGAGAGGAAACGAAATATGTGAGGTAAGATTTCGATAAGTCCAAA 
TAGTTGGCTTCTATGCAGATTCATGGACTTATTACAACGGCTTGATGTCTTGCAGGCTAT 
GGAATCAAACAAAGCTGACTGGGATACCCTTTTTGAGCCATTTGCATTCTTTGAAGCGTA 
TAAAAACTATCTACAGATAGACATTTCTGCTGCAAATGTCGATGATCTAAGAAAATGGAA 
AGGCTGGGTTGAGTCACGCCTCCGCCAGCTCACACTGAAGGTGAAAAGCCATGTTTACTT 
TAACTTGAATAGTTTCTCTTGATTTTGCTTTGCTAATGATTTGTCTTGGATGTTTGCATT 
GTAATCTTAGATCGAGAGACATTTTAAAATGCTTCATTGCCACCCTCATCCCCATGATTT 
TCAAGACACATCCCGGCCACTCCATTGCTCTTACTTCATGGGTCTGCAACGTAAACAAGG 
AGTTCCAGCAGCAGAAGGCGAGCAATTCGATATCAGAAGAACCGTTGAGGAGTTTAAACA 
CACTGTCAACGCTTACACATTGTGGATTCCAGGGATGGAGATTAGTGTTGGCCATATAAA 
ACGGAGAAGCTTACCTAATTTTGTGTTTCCTGGTGGAGTTAGACCTTCACATACCTCTAA 
AGGAACATGGGACAGCAATCGCCGTTCAGAGCACAGAAATTCTTCTACATCAAGTGCACC 
AGCTGCTACTACCACTACTACCGAAATGAGTTCTGAAAGTAAAGCTGGTTCTAACAGTCC 
AGTTGATGGGAAGAAGAGAAAATGGGGAGATAGTGAAACACTCACCGATCAGCCAAGGAA 
CTCTAAACACATTGCTGTTTCAGTGCCTGTAGAGAATTGTGAAGGCGGGAGTCCAAATCC 
ATCTGTTGGATCAATTTGTTCAAGTCCTATGAAAGATTATTGTACAAACGGTAAATCTGA 
GCCTATTAGTAAGGATCCACCAGAAAATGTTGTTGCTTTCAGTAAGGATCCACCAGAGAG 
TCTTCCGATAGAAAAGATAGCCACTCCTCAAGCTCATGAAACTGAGGAGCTTGAAGAAAG 
TTTTGATTTTGGAAACCAAGTGATTGAGCAGATATCTCATAAAGTTGCAGTCCTGTCTGC 
TACTGCAACTATACCTCCATTCGAAGCTACTTCAAATGGCTCTCCTTTCCCTTATGAAGC 
AGTGGAAGAACTTGAGGTTTCTTATTTTTCTTATCAATTTTCGATACATAAATTGTTCTC 
TTGATCTTATTCCTCCTGTCTGATTTCTCTTTTGTTGAAAGGTTCTTCCCACGCGACAGC 
CCGATGCGGCACATAGACCTTCAGTACAACAGCGAAAACCGATAATCAAGTAAGTGATTT 
TGTGTCTATGTTTACTCTTAACGTTTGAATATACATTTTTGGATTTTGACAAAGATTGTT 
TGTTTTTGTTTGTCTGATTATTCGCAGATTGAGCTTCACGTCTCTAGGCAAAACCAATGG 
CAAGTAATAATGGCTTTTCCCTACATTGCCAAGAATCTCAGAGCACTTACGGAAATTCGA 
GATGTTAAGTTGAGGGGTTCTTGTTACTTTATGTCTTATATTTATATGCTTTTCTTAGAT 
GTTGCATGATCTCATGTAAAACTCGTTTGGATAAGATTAATGTAATGTGTTCTTGTCTAT 
GGATCCCAAACACTTTTTCTGTCATAAATAAAAGTCTGGGTTGAGTTTACTTCACATATA 
TA
>AT5G23880.1 |  CPSF100 (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 100) DNA binding / protein binding 
TAGTTCATCGGAGAAATTTTAGGGTTTATATCGGCGAACGGAAAAGATGGGTACTTCGGT 
GCAAGTGACTCCTCTCTGCGGAGTTTACAACGAGAATCCTCTCTCCTACTTAGTCTCCAT 
TGATGGTTTCAACTTCCTCATCGACTGTGGTTGGAACGATCTCTTCGACACATCGCTCCT 
CGAACCTCTCTCCAGGTTTCTCTATCCTTATTATCTACATTTCCAGAATTCACCAATCTA 
ATTTGTTTTGAATTCGATTCTTCTGGTTTACAGGGTTGCTTCTACTATAGATGCAGTTTT 
GCTTTCTCATCCAGATACACTTCACATTGGTGCTCTTCCTTATGCTATGAAGCAGCTTGG 
ACTCTCCGCTCCTGTTTATGCTACTGAGCCTGTTCATAGATTAGGTCTCCTTACAATGTA 
TGATCAGTTTTTGTCCAGGAAGGTGAGATTTTGTTAACTACTGGAGTGGTTATTTTTGCG 
CAATTGTCTGCATTGTAACACGATGATCTTACTGTTGCAGCAAGTATCCGACTTTGATCT 
GTTTACACTGGATGACATAGATTCTGCTTTCCAGAATGTGATCAGATTGACTTACTCTCA 
AAATTACCATCTTTCTGGTATGTGGTTTTAGTGATTTCTAGGCTCTATAGCAAACTAGAA 
ACAATTGACACTTATCTCAAGCAAGTTTGATCTGCATTATCTATGATCTCATATCGGGAA 
GGAGTTCTTTGACACACATTGAGTATTTGGTTGTTGAAACCTAAGTTATGACTTCAAAGA 
TTGTTAGGATGTCTCAAGGTTTTATCGTTGCCCTATCAGGAAAGGGAGAGGGTATTGTAA 
TTGCTCCTCATGTTGCTGGACACATGCTGGGAGGTAGCATCTGGAGGATAACAAAGGATG 
GGGAGGATGTTATATATGCTGTTGACTACAATCATCGGAAAGAAAGGTACATATGTTCAG 
ATTTTATCTTATTTGAAGTTCGAGTAATGTTCATAACAGTAAGTAAAGATGTGGACTCGT 
GATACTGAATTGTATATCTTAATTCAGGCATTTGAATGGAACTGTTTTACAGTCTTTTGT 
TCGGCCTGCTGTTCTGATAACCGATGCATATCATGCTCTTTATACCAATCAAACCGCAAG 
ACAGCAAAGGGACAAAGAATTTCTAGGTTAGCTTGTAGCCCAATATGTGTTGTGTATCTT 
CTATAGTATTTAAAACAGCCCGCTTCTAACTGCCAGAAACATGTGTGCATGTCCCCATTT 
ATCATTCAGATACCATTTCAAAACATCTTGAAGTTGGAGGAAATGTTCTATTGCCAGTAG 
ACACTGCGGGTCGTGTCCTGGAACTTCTCTTGATACTTGAACAGGTAATAGAACCGCTTT 
GAATGTATCATGCTCTTAGTTAATGTTCAGCTGTTTTTTAAAGACTGGATATTGATCAAA 
CCTGCAGCATTGGTCACAAAGAGGTTTCAGCTTTCCCATTTATTTTCTCACGTACGTGTC 
ATCTAGCACAATTGACTATGTTAAGAGTTTCCTCGAGTGGATGAGTGACTCCATTTCAAA 
GTCCTTTGAGACTTCACGTGATAATGCCTTTCTATTGAGGTAGATTTTCTTATAAGAATG 
CCTTATTTGTGCCGTCGTTTGTTTAGAATACAGAAGACATCACATGAAATTTAAACACAT 
GCAGGCATGTCACTCTGTTGATAAACAAGACTGATCTGGATAATGCTCCACCTGGTCCAA 
AGGTTGTTTATAAAATTATAAGTAACTCATTAGTGTTTGTTAGTACATAGAACGTGGTGG 
ATTTATTATTATTTCCTGTCTTTTCAGCTGATAATAGAACTAGATTTTTTCCTATTATAT 
GTTGTAGTGACTAAATCTCATAATATAGGTTGTTCTTGCTTCCATGGCTAGTCTCGAAGC 
CGGTTTTGCTCGAGAGATATTCGTGGAGTGGGCAAATGATCCCAGAAATTTAGTCCTCTT 
TACTGAAACAGGCCAGGTATGTTTTTAGAACCCACATACGTTGAGGAACGAAAATTTATT 
AGCATTGCTATAAAGACCTGATGGTAGATTCTTTTCCTAGTGCTGATCAGCTAGTTAAGT 
GGATATATGAGAATCTTTTTTGTCTTCTGATCTGAATAAGAGTTCCCCCATTTATGTGTG 
GATATTTACCCCCAATATGTACACAATAGGCAGAGATTGAGTACCTTAAAGCAGCATTAT 
AATTACCACCAAAGCCTGGCTTGCTCCTTTAGGATAATCTCCAGAGCTTTCAGTCTTGAA 
TTTATCAATTAGTTACATCCAGTACAAAATAAAGGGTCTTAGTAGACTATCATATTAATG 
GAATTGACACCACTATGCACAAACTGTCTAATTGGCCATATCATTCATCTCAAATGAACA 
TAATTTTTTTTTGTAACCGCGTACTTTGTTTATTTTTCTTCTAGCGAGACATCATCCTGT 
TCCCTGAAATATCATACTTTTAATTAAAATTCAATCTAGACAAAAATAAATTTATTCAAA 
TAAATAGTTTGGAAACAAATGGAAGCTTTGGTTAATTATTCACGCTTTTCTCAGTTCTGT 
GTGACTATGCTTTCTTGTCCATGTCAATCTATCCAGAAAACAGAGCATTACGGAATTATT 
AAGTTTGAAATACCAGTAACACCGTAAATCCAAGTGAAATTATCGAAGTTCTTCATCCAA 
TTTGTTACCTTTGCCATTGGTCGTGTTCCTTAGTTGCGATGGCGATTATACTTTCCATGT 
GTCCATTCATAGTTCACGTGATCTAAGATTTGCAAGATGTTTCGGTTTGTAGTCAATCAC 
ATAAAACTAAACTGCTGTTAGTTTGATTTTTAATTGTCATTTGCTTCTATTTGCAGTTTG 
GCACTTTAGCTCGTATGCTTCAGTCAGCCCCACCTCCAAAATTTGTTAAAGTCACCATGT 
CTAAGAGGGTTCCTTTGGCTGGGGAAGAGTTAATTGCATATGAGGAAGAGCAAAACAGAC 
TGAAAAGGGAAGAAGCTTTGCGAGCTAGCCTCGTTAAAGAGGAGGAAACAAAAGCTTCCC 
ATGGATCCGATGATAATTCAAGTGAACCTATGATCATAGATACCAAGACTACTCACGATG 
GTAAATTTTTTCTTATTTTATATAACATTTTATTACCCTTGAATATTCTGTGGCCTGTAA 
CTTCTTATTTTTCATGTAAACTTTAACTTAATTGAAGTATCTAGTACTGAAAATGGCTAT 
GCACATAGTACCCTCTGTAATGTACTGGTTAGTTGGTTTTAGGAGGCATTTATGTGGTTA 
TCTTGAGTGACCTAGAAGCTACATTTAGAAGTCTCACAATACATTTCTGGGTAATTTGTT 
TAGTTTTTCACAGTCCCACAATATGTGTCTGTTTCAATTAGACCTCTGGCTACCGTTGTT 
GATTGCTCTTCTTTCCACTACATAGTGGTCTGCAACTGACCTTTTACATTTCTGACTACT 
CTTGCAGTTATTGGTTCTCACGGGCCTGCATATAAAGATATATTGATTGATGGATTTGTT 
CCCCCATCCAGCAGCGTAGCTCCAATGTTCCCATATTATGATAACACATCTGAATGGGAC 
GACTTTGGGGAGATTATTAATCCAGATGACTATGTGATCAAGGATGAAGACATGGACCGA 
GGAGCAATGCATGTACGTTCCTTGAATTCTGGTCTTGGTCTTGGTCTTTCTTAGCTCTTG 
TTATATTTGCAAATTAGACCTCTTAATTTCCATGATGTTTGCATAGTGGTGGTTCCTTTT 
ACGATTTTTGTATCAAGAAGAACAAAGATGTAAGAAATCTGCATGATATGCTCTGAGGAT 
TTGGGATACAGATAGGAAATCTTTTGCCATAAAGTTGCTTAGGCTCTTGATTTGGTATGA 
GTGCAGTTCTTCAAATGAGTGCACTGGTTCTACAGTTCCATCTTTATATTTTCCTTAACA 
ACTGATTGCTTACTAGTAAAGGTTTAGGGTCATTCTATGTAGAGTCTTGTGTTGCTTATT 
AAATTTGTGATATAATTTTCCATTTCAGAACGGAGGTGATGTGGACGGAAGGCTTGATGA 
GGCAACTGCTAGTCTCATGCTTGATACAAGACCTTCGAAAGTCATGTCCAATGAGCTCAT 
TGTAAGTAGACTCTAATTATATCCAAAGAACAATACATTGATAGAGATTTTGTCTCAGTT 
AATGTCCTCATTTGTTCTCCCTTTCTAGAATCTCTGATTATTGTTATAGACTGCTTATCA 
ATGATAGGCACAAGGAGTAGTCTTCTCACTTAGAAATAGAGAGATAGGAATTCTCATTGA 
CATGGCGTTGTGCCTGTCAAATTTATCTTCATCTGATGATATGCATACAAGAAATTTATT 
AATTGATCTTCTAATTAGTTATCACGGGAGACCTTGCTAATCAGATCTTTAGCACGATAA 
TTCAACTTACAGATATTTTGTTGTTTGGATTAATCGGTCTAATTTTCTTCTTGTTATTGA 
ACAACTTTTGTGTTCTTACTTTTACCCACTTGATCTTATGTCATGTAGAAGTTTCAGAAG 
GTTATTCTCAGAACGTAGGCCTTGCCTGCTAAACAAAACAATATGGCTCTTTAGTCTTCT 
TCTGTCTATACCTAACTGCTGTCTAATTTCCCTGATAAATGATTTAGTTTGTTCTTATGC 
TTTTGCACAGGTGACTGTTAGTTGTTCACTTGTTAAAATGGACTATGAAGGTCGGTCAGA 
TGGCCGCTCAATCAAGTCAATGATTGCGCATGTTTCTCCTTTAAAACTTGTACGTTTCTC 
TCTCGTCTTATATATATATAGTGTTAAGCACTGAACTGGAAACTTGCGGTGATCTAATAC 
TATATATCATGTGAAGGTTTTGGTGCACGCGATAGCTGAGGCTACAGAGCATTTGAAGCA 
ACACTGCTTGAACAACATCTGTCCACACGTGTATGCTCCTCAAATAGAGGAAACGGTCGA 
TGTGACTTCTGATTTATGTGCTTACAAGGTAGAAATTACTTAGAATTAGGAAGATCCTTT 
TTAACTCATGGGTTTTGAGTTGTGTGATTGAATTAACCCTGTATGGTGATACATCAGGTC 
CAACTTTCTGAAAAGCTGATGAGCAATGTGATCTTCAAGAAGGTACCTTTTATTTCCGTG 
ACTATTTTTTTCTTCTTTTCCGATTTGCAACCAATGTCTCTGAAGAATGATGAAATAATA 
TCAGCTGGGAGATTCAGAAGTAGCTTGGGTGGATTCCGAAGTAGGGAAGACAGAGAGGGA 
CATGAGGTCTCTACTACCGATGCCAGGTGCTGCTTCGCCACACAAACCTGTTCTAGTAGG 
TGATCTGAAAATCGCAGACTTCAAGCAGTTTCTGTCGAGCAAGGGTGTTCAGGTAGAATT 
TGCAGGTGGAGGAGCTTTACGTTGTGGTGAATATGTCACTCTACGAAAGGTTGGACCGAC 
GGGTCAAAAGGTAATTCAAAGCAAATACTGCATTTCTTACAACAAATCAGAGAATGACTT 
ATATATGTTGGGGATTGTTCAGGGAGGAGCATCGGGTCCACAGCAAATTCTGATAGAAGG 
ACCGTTGTGTGAAGACTATTACAAAATCAGGGATTATCTCTATTCTCAGTTCTACCTCCT 
CTGAGCATGATATAGAAAAAAAATGAAGCTTCTTCTCATTTTCTCAACATTTTTCAACCA 
CTCAACATGTAATCTCGTATAGTTTATTGCCTTGCTTATAACCCTCAAATCTTATAGATT 
AATGTGTTAAAAATGGCAATAGCTTTTTGTAACTTTTTTGTACTTGTCATCTTAGTAGAA 
GCTTAAGTTGTCATTGGATATATTCCACTCC
>AT3G12530.1 |  PSF2 
CTTCCAGGAATCACACAAAATCTAACCAGGTAAACTCAACTTCATATCACTAATCAGGAA 
CAAATGATTCTCTCTTACTATATCCGGCGTTTCGTTTACAAGTATGTCCTCAGAATTTGC 
GAAATTTGATTGTTAGATTTGATCATCAGATGCTTTTAAAGGTTTGCTGTTTCATGATGT 
TGCTGAAATTGGAAGTTGATATGTGCTAAAAAAATAAGGAGGAACTTTCTGTAGAGTGTA 
GATAAAGTGTTTGATTAAATGTCTCTACCAAGTATAATTTTTATCACGCTTGCATTTAGG 
TCTGGAAACTGAGATTTCTTGAGATACATCAATGGCTGGCCAGACTGATCCTCATATTTC 
ACTGTTTTCTCCACAAGAGGTCTTTATTCTCCTCTTTACTTGTATGCGTTTCATGTTCTG 
TCTGCAATAGTTTAATTGATTAGCTATATTCATACCAGGTTGAGTTTATGGCAGAGGACG 
AGCTGGTCGAGATTGTTCCTAATATGAACATGGAGCAACTCAATTTCATCAGTGTAATCT 
CTCTTGTTTTATACAATCCTGTAATCATTTCCCTTGTAACCTATTTTGTTAACCATGTGA 
TTAATATGTTAATCAATGACAGGGCGATTTCGGTCGGTTCATTCCTCAGATTCCGACAAA 
GGTGCCTCTGTGGCTTGCAGTGGCACTGAAGAGGAGAGGAAAATGCACTTTCCGGCCTCC 
GGGGTGGATGTCTGTTGGTAAGACAATTTCAAATTTAGCAGATAAATTTCAAATGTTAAC 
GAACATTAGGTGCTTAAGTGTTAACTGTTTCTTGTTGCTTCTTTGTTTGTGAACTAGATA 
ATTTGACTCAGATCTTGGAAGCAGAACGTGAATCTCAGTCGACATTCCAGGCATTACCAT 
TTAGTTACGTGGAGATTGCCAGACTACTTTTTGACCAGTAGGTTCTTAGACTCTTCTTGT 
TTCTTTGCTCGCCCTTACATTTATAACATCCAAGAGTGCTGATGAGTATCGATCTCACTT 
TTGGCAGTGCACGTGACGATATTCCAGACATGTATATGGTAATTTCATACATCTTAATTT 
GTCTCCCATCCTAACTATGTGTTCGAATTAAGCTTTTATAGCCGTTTATGAATTTTGTAT 
AGGTGAGATCCCTAGTCGAGGACATCAGAGATGTACGGCTTCACAAACTTGAGACTAACT 
TAGGATCATTTCAAGGTACATCTGCAGTAAAGGTAATTGTTTTTTATTGCTACTTCTTGA 
CATTAGCTTTTTCTCATTACCTCTAAAGAGTGATTTTTAACAATAACAATATCTCTAATT 
TGAGAATGTAGATCTCTAATGTATCGGCAATGGAAGTAAACATAGTACGCCCATTTGTGA 
TAAGAGCCTTAGAAGCATTTTATAAGCATGACAAGCCAGAGGCTGATGTAGACAGAGACA 
CCAGAAGTAGTAGACAACAGCGTGAAACCAACAATGAACCAAGGGTAAGGCTCTTCAGTC 
TTCACACTTCTCACTCGATTTTTCCCCCTTTTTTTTTAAGACAAATACAAACCTCAACAC 
ATGTTTTGCAGAGACCTCTAAGGCAACGCTAGGTAGCTTCCACGCCCTTGCCTAAGTGAG 
TAGAAGTCAGGTATCTTCTGTGCCAACGTTGGTCGAACTCCCTGAGAAGTTAGAACACCA 
GCAGCATGTATCGGTATCGTTAATATATGACTTGTTTCTCCTGCATTGTGGTACATACTC 
CTTTGATATTAGCATCTTTTATGTTGTGACGAAAAGTTCACTTTAATGAACAGAAATATT 
AAGATGGCAAACGAGTTTTATGGGTGAAATGGTCACACGAAGGATCCCAT
>AT3G12530.1 |  PSF2 
CTTCCAGGAATCACACAAAATCTAACCAGGTAAACTCAACTTCATATCACTAATCAGGAA 
CAAATGATTCTCTCTTACTATATCCGGCGTTTCGTTTACAAGTATGTCCTCAGAATTTGC 
GAAATTTGATTGTTAGATTTGATCATCAGATGCTTTTAAAGGTTTGCTGTTTCATGATGT 
TGCTGAAATTGGAAGTTGATATGTGCTAAAAAAATAAGGAGGAACTTTCTGTAGAGTGTA 
GATAAAGTGTTTGATTAAATGTCTCTACCAAGTATAATTTTTATCACGCTTGCATTTAGG 
TCTGGAAACTGAGATTTCTTGAGATACATCAATGGCTGGCCAGACTGATCCTCATATTTC 
ACTGTTTTCTCCACAAGAGGTCTTTATTCTCCTCTTTACTTGTATGCGTTTCATGTTCTG 
TCTGCAATAGTTTAATTGATTAGCTATATTCATACCAGGTTGAGTTTATGGCAGAGGACG 
AGCTGGTCGAGATTGTTCCTAATATGAACATGGAGCAACTCAATTTCATCAGTGTAATCT 
CTCTTGTTTTATACAATCCTGTAATCATTTCCCTTGTAACCTATTTTGTTAACCATGTGA 
TTAATATGTTAATCAATGACAGGGCGATTTCGGTCGGTTCATTCCTCAGATTCCGACAAA 
GGTGCCTCTGTGGCTTGCAGTGGCACTGAAGAGGAGAGGAAAATGCACTTTCCGGCCTCC 
GGGGTGGATGTCTGTTGGTAAGACAATTTCAAATTTAGCAGATAAATTTCAAATGTTAAC 
GAACATTAGGTGCTTAAGTGTTAACTGTTTCTTGTTGCTTCTTTGTTTGTGAACTAGATA 
ATTTGACTCAGATCTTGGAAGCAGAACGTGAATCTCAGTCGACATTCCAGGCATTACCAT 
TTAGTTACGTGGAGATTGCCAGACTACTTTTTGACCAGTAGGTTCTTAGACTCTTCTTGT 
TTCTTTGCTCGCCCTTACATTTATAACATCCAAGAGTGCTGATGAGTATCGATCTCACTT 
TTGGCAGTGCACGTGACGATATTCCAGACATGTATATGGTAATTTCATACATCTTAATTT 
GTCTCCCATCCTAACTATGTGTTCGAATTAAGCTTTTATAGCCGTTTATGAATTTTGTAT 
AGGTGAGATCCCTAGTCGAGGACATCAGAGATGTACGGCTTCACAAACTTGAGACTAACT 
TAGGATCATTTCAAGGTACATCTGCAGTAAAGGTAATTGTTTTTTATTGCTACTTCTTGA 
CATTAGCTTTTTCTCATTACCTCTAAAGAGTGATTTTTAACAATAACAATATCTCTAATT 
TGAGAATGTAGATCTCTAATGTATCGGCAATGGAAGTAAACATAGTACGCCCATTTGTGA 
TAAGAGCCTTAGAAGCATTTTATAAGCATGACAAGCCAGAGGCTGATGTAGACAGAGACA 
CCAGAAGTAGTAGACAACAGCGTGAAACCAACAATGAACCAAGGGTAAGGCTCTTCAGTC 
TTCACACTTCTCACTCGATTTTTCCCCCTTTTTTTTTAAGACAAATACAAACCTCAACAC 
ATGTTTTGCAGAGACCTCTAAGGCAACGCTAGGTAGCTTCCACGCCCTTGCCTAAGTGAG 
TAGAAGTCAGGTATCTTCTGTGCCAACGTTGGTCGAACTCCCTGAGAAGTTAGAACACCA 
GCAGCATGTATCGGTATCGTTAATATATGACTTGTTTCTCCTGCATTGTGGTACATACTC 
CTTTGATATTAGCATCTTTTATGTTGTGACGAAAAGTTCACTTTAATGAACAGAAATATT 
AAGATGGCAAACGAGTTTTATGGGTGAAATGGTCACACGAAGGATCCCAT
>AT3G12530.2 |  PSF2 
CTTCCAGGAATCACACAAAATCTAACCAGGTAAACTCAACTTCATATCACTAATCAGGAA 
CAAATGATTCTCTCTTACTATATCCGGCGTTTCGTTTACAAGTATGTCCTCAGAATTTGC 
GAAATTTGATTGTTAGATTTGATCATCAGATGCTTTTAAAGGTTTGCTGTTTCATGATGT 
TGCTGAAATTGGAAGTTGATATGTGCTAAAAAAATAAGGAGGAACTTTCTGTAGAGTGTA 
GATAAAGTGTTTGATTAAATGTCTCTACCAAGTATAATTTTTATCACGCTTGCATTTAGG 
TCTGGAAACTGAGATTTCTTGAGATACATCAATGGCTGGCCAGACTGATCCTCATATTTC 
ACTGTTTTCTCCACAAGAGGTCTTTATTCTCCTCTTTACTTGTATGCGTTTCATGTTCTG 
TCTGCAATAGTTTAATTGATTAGCTATATTCATACCAGGTTGAGTTTATGGCAGAGGACG 
AGCTGGTCGAGATTGTTCCTAATATGAACATGGAGCAACTCAATTTCATCAGTGTAATCT 
CTCTTGTTTTATACAATCCTGTAATCATTTCCCTTGTAACCTATTTTGTTAACCATGTGA 
TTAATATGTTAATCAATGACAGGGCGATTTCGGTCGGTTCATTCCTCAGATTCCGACAAA 
GGTGCCTCTGTGGCTTGCAGTGGCACTGAAGAGGAGAGGAAAATGCACTTTCCGGCCTCC 
GGGGTGGATGTCTGTTGGTAAGACAATTTCAAATTTAGCAGATAAATTTCAAATGTTAAC 
GAACATTAGGTGCTTAAGTGTTAACTGTTTCTTGTTGCTTCTTTGTTTGTGAACTAGATA 
ATTTGACTCAGATCTTGGAAGCAGAACGTGAATCTCAGTCGACATTCCAGGCATTACCAT 
TTAGTTACGTGGAGATTGCCAGACTACTTTTTGACCAGTAGGTTCTTAGACTCTTCTTGT 
TTCTTTGCTCGCCCTTACATTTATAACATCCAAGAGTGCTGATGAGTATCGATCTCACTT 
TTGGCAGTGCACGTGACGATATTCCAGACATGTATATGGTAATTTCATACATCTTAATTT 
GTCTCCCATCCTAACTATGTGTTCGAATTAAGCTTTTATAGCCGTTTATGAATTTTGTAT 
AGGTGAGATCCCTAGTCGAGGACATCAGAGATGTACGGCTTCACAAACTTGAGACTAACT 
TAGGATCATTTCAAGGTACATCTGCAGTAAAGGTAATTGTTTTTTATTGCTACTTCTTGA 
CATTAGCTTTTTCTCATTACCTCTAAAGAGTGATTTTTAACAATAACAATATCTCTAATT 
TGAGAATGTAGATCTCTAATGTATCGGCAATGGAAGTAAACATAGTACGCCCATTTGTGA 
TAAGAGCCTTAGAAGCATTTTATAAGCATGACAAGCCAGAGGCTGATGTAGACAGAGACA 
CCAGAAGTAGTAGACAACAGCGTGAAACCAACAATGAACCAAGGGTAAGGCTCTTCAGTC 
TTCACACTTCTCACTCGATTTTTCCCCCTTTTTTTTTAAGACAAATACAAACCTCAACAC 
ATGTTTTGCAGAGACCTCTAAGGCAACGCTAGGTAGCTTCCACGCCCTTGCCTAAGTGAG 
TAGAAGTCAGGTATCTTCTGTGCCAACGTTGGTCGAACTCCCTGAGAAGTTAGAACACCA 
GCAGCATGTATCGGTATCGTTAATATATGACTTGTTTCTCCTGCATTGTGGTACATACTC 
CTTTGATATTAGCATCTTTTATGTTGTGACGAAAAGTTCACTTTAATGAACAGAAATATT 
AAGATGGCAAACGAGTTTTATGGGTGAAATGGTCACACGAAGGATCCCAT
>AT3G12530.2 |  PSF2 
CTTCCAGGAATCACACAAAATCTAACCAGGTAAACTCAACTTCATATCACTAATCAGGAA 
CAAATGATTCTCTCTTACTATATCCGGCGTTTCGTTTACAAGTATGTCCTCAGAATTTGC 
GAAATTTGATTGTTAGATTTGATCATCAGATGCTTTTAAAGGTTTGCTGTTTCATGATGT 
TGCTGAAATTGGAAGTTGATATGTGCTAAAAAAATAAGGAGGAACTTTCTGTAGAGTGTA 
GATAAAGTGTTTGATTAAATGTCTCTACCAAGTATAATTTTTATCACGCTTGCATTTAGG 
TCTGGAAACTGAGATTTCTTGAGATACATCAATGGCTGGCCAGACTGATCCTCATATTTC 
ACTGTTTTCTCCACAAGAGGTCTTTATTCTCCTCTTTACTTGTATGCGTTTCATGTTCTG 
TCTGCAATAGTTTAATTGATTAGCTATATTCATACCAGGTTGAGTTTATGGCAGAGGACG 
AGCTGGTCGAGATTGTTCCTAATATGAACATGGAGCAACTCAATTTCATCAGTGTAATCT 
CTCTTGTTTTATACAATCCTGTAATCATTTCCCTTGTAACCTATTTTGTTAACCATGTGA 
TTAATATGTTAATCAATGACAGGGCGATTTCGGTCGGTTCATTCCTCAGATTCCGACAAA 
GGTGCCTCTGTGGCTTGCAGTGGCACTGAAGAGGAGAGGAAAATGCACTTTCCGGCCTCC 
GGGGTGGATGTCTGTTGGTAAGACAATTTCAAATTTAGCAGATAAATTTCAAATGTTAAC 
GAACATTAGGTGCTTAAGTGTTAACTGTTTCTTGTTGCTTCTTTGTTTGTGAACTAGATA 
ATTTGACTCAGATCTTGGAAGCAGAACGTGAATCTCAGTCGACATTCCAGGCATTACCAT 
TTAGTTACGTGGAGATTGCCAGACTACTTTTTGACCAGTAGGTTCTTAGACTCTTCTTGT 
TTCTTTGCTCGCCCTTACATTTATAACATCCAAGAGTGCTGATGAGTATCGATCTCACTT 
TTGGCAGTGCACGTGACGATATTCCAGACATGTATATGGTAATTTCATACATCTTAATTT 
GTCTCCCATCCTAACTATGTGTTCGAATTAAGCTTTTATAGCCGTTTATGAATTTTGTAT 
AGGTGAGATCCCTAGTCGAGGACATCAGAGATGTACGGCTTCACAAACTTGAGACTAACT 
TAGGATCATTTCAAGGTACATCTGCAGTAAAGGTAATTGTTTTTTATTGCTACTTCTTGA 
CATTAGCTTTTTCTCATTACCTCTAAAGAGTGATTTTTAACAATAACAATATCTCTAATT 
TGAGAATGTAGATCTCTAATGTATCGGCAATGGAAGTAAACATAGTACGCCCATTTGTGA 
TAAGAGCCTTAGAAGCATTTTATAAGCATGACAAGCCAGAGGCTGATGTAGACAGAGACA 
CCAGAAGTAGTAGACAACAGCGTGAAACCAACAATGAACCAAGGGTAAGGCTCTTCAGTC 
TTCACACTTCTCACTCGATTTTTCCCCCTTTTTTTTTAAGACAAATACAAACCTCAACAC 
ATGTTTTGCAGAGACCTCTAAGGCAACGCTAGGTAGCTTCCACGCCCTTGCCTAAGTGAG 
TAGAAGTCAGGTATCTTCTGTGCCAACGTTGGTCGAACTCCCTGAGAAGTTAGAACACCA 
GCAGCATGTATCGGTATCGTTAATATATGACTTGTTTCTCCTGCATTGTGGTACATACTC 
CTTTGATATTAGCATCTTTTATGTTGTGACGAAAAGTTCACTTTAATGAACAGAAATATT 
AAGATGGCAAACGAGTTTTATGGGTGAAATGGTCACACGAAGGATCCCAT
>AT5G51660.1 |  CPSF160 nucleic acid binding 
TTAGAATCTCTGAATCCCAGATTCCGGTAGAGAAGATGAGTTTCGCGGCCTATAAGATGA 
TGCATTGGCCTACCGGCGTCGAGAACTGTGCTTCCGGCTATATCACCCACTCTCTCTCCG 
ATTCAACGCTACAGATTCCGATTGTTTCCGTTCATGATGATATTGAAGCTGAGTGGCCTA 
ATCCTAAACGAGGTATTGGTCCTTTGCCCAACGTCGTTATAACCGCCGCAAATATCCTTG 
AGGTGTACATCGTTAGGGCTCAAGAGGAAGGGAATACTCAGGAGCTGAGGAATCCGAAGC 
TTGCTAAGCGTGGTGGAGTTATGGATGGTGTCTATGGTGTTTCTCTCGAGCTCGTGTGCC 
ATTATAGGTACGTGTTTGTTGACAATTACCTCCTAAATTACTCCAATTTTGGTACTTTGA 
CTTTGAAGTGACGATGTGATTGGTATTGGATTGTAGGTTGCACGGTAATGTTGAGTCAAT 
TGCGGTTCTTCCTATGGGAGGTGGTAATTCTTCTAAGGGAAGAGATTCGATTATATTGAC 
ATTTCGCGACGCCAAAATTTCAGTTCTTGAGTTTGATGATTCAATTCACAGCCTTAGGAT 
GACGTAAGAGTGTTTTGCTTTTGTTGGTTTTGGTAAATAAATAAATGAATTCAGCTTTAG 
TTTCAGCTCTGTCTCCTCTCAATTGTTTCTTTTGACCTATATACGAGATGTTCTGTGTCC 
AACTATTGTTTTAACTGTTTTATACTTCTCAAAGTTTTGGTCTTTACTTACGCATTGTTA 
TTGTTTCTAGCGATGCAAGTTACGTAGTATTGGATCATATACTGAAGCGTTCTATTGTCT 
ATGTCTGATTGTTTCTTCTAGTTATCTAATTTATGTACCATTGACTCCTATACATGACTT 
CAACAAATAATAATGGATATGTGGTTCCTTTTCAGTTCGATGCATTGTTTTGAGGGTCCA 
GATTGGCTTCATCTGAAAAGAGGAAGAGAGTCTTTTCCAAGAGGCCCTTTGGTAAAAGTG 
GATCCTCAAGGCAGATGTGGCGGCGTTCTTGTTTATGGTTTGCAGATGATCATACTCAAG 
ACTTCCCAGGTTTTTGTTTTGGCATTATTAATCAACTTCATCTTAACTGTCGCTTTATCT 
GCTACAAATTTCCAACCTTCATTCTTTTCTTTTATGAACTTTATTTTGGGTTTTAGGTTG 
GTTCTGGACTAGTTGGAGATGATGATGCGTTCAGTTCTGGAGGGACAGTTTCTGCTCGAG 
TTGAATCATCTTACATAATTAACTTGCGTGATCTGGAAATGAAACACGTCAAAGATTTTG 
TTTTTCTACATGGTAGGTTTAGCAAGCAAGGTTTCTTCATAAACTTATCTCTGAATCAGT 
AGTTAATCATAAATATATTATGATGATTGTTTCTTAGCTGCTCAACTTGCATCGAATCTT 
GTGTCCTTGAATGGATCTAGCTTACTAAGTTGTTGTTTGTAGATTCAATACGACAACTGA 
TGTATTCTGGTCATGATTACAGTTTGAAACAAGAGGAAATGTATTGTTTCTTTGATTTTT 
CAATAACTAGCTGTCTGAAATTTTAGATATTCTAGTTTTCCCAGTAGGCATAAAGAATAA 
ACTAAGTGGTGCTTCTTTTGATTATGTGTTTTTGCATCCTGTGTCTTCTTCAGGTTATAT 
TGAGCCTGTAATTGTCATCCTTCAGGAAGAAGAGCATACTTGGGCTGGGCGAGTTTCATG 
GAAGCACCATACTTGCGTGCTTTCTGCCCTTAGTATCAATTCGACATTAAAACAACACCC 
AGTCATCTGGTCAGCTATTGTATGTTCGTATTTTCCTCTTTGTATCTTATAATAGATCTC 
TTCCCAAGAAATTAAATATTTGAGTTGCACTATTAACTATATTGTAAGCTAAGGGTAGAA 
ATTGAAGTCATCTAAAAGGTTATTGAATATCCACTGTTGTTACATGACTAGACTTTCCAA 
TCAGCTATGACGATGCTCTATTTTTTGTTTAGAATGCTCAAAGAGTTGATCTTTCTTTAG 
GAAAAATTTCCTAAAATAACAAGCTATTTCATGACTGAAATAGTTACTTCGGCAAACGTT 
AGTCCCTGATCATACTTATTCCCATTCTTTTGGTATTTTCCAGAATCTGCCCCATGATGC 
CTACAAACTACTTGCAGTACCATCTCCGATCGGAGGTGTTCTTGTGTTGTGTGCAAATAC 
AATCCATTATCATAGTCAGGTAGTTTTATATTACTTAGCTTTTGGTTGTTTCTTGTTTAA 
AATTCAACAATTCCAGCCACTCCACCTCAAAGTTCTACAGTTACTCACACATCTGGATAC 
CATATATATTTGTAGTCAGCCTCCTGTGCTCTGGCACTGAACAATTATGCCTCCTCAGCT 
GATAGCAGGTACAGTTTTCTCGCACCTCCCCACTCTTCAAAACCTGCTTCATGCTTATGG 
ATATAATCTTGTTACCTCAGTCTTAGTTTAGAATCCTAAAGCTTAGAATCAACTTTCAAC 
ATTTGTAAAACTCTGTTTATACTGTTAACCACATTTCTATCTCTGTGTGCGTCTGATTTC 
TTTCAGTCAAGAACTGCCTGCATCAAATTTCAGTGTGGAGCTTGATGCTGCCCATGGAAC 
CTGGATATCGAACGATGTGGCCCTATTGTCGACAAAATCTGGGGAATTGTTGCTGCTGAC 
TCTTATATATGATGGGCGGTAGTATTTTGATCTTCTTTAAAAAAAAATCTTCTGACGCTT 
GTAAAGCTGGCTGCAACTTATTTTGTTTAAAATATGTGAAACTGACTGCTACTTTCTTTT 
TTGAAGTGCTGTACAGAGACTTGATCTTTCCAAATCAAAAGCCTCTGTGCTTGCTTCGGT 
TAGTCAATATGTTCTTTCAGCATATTTGTACTTCAATTTGGATCCTGTTCGATTAGAGAT 
TCCCTATGATGATATACCAAATTTCTTGCAGGACATTACTAGTGTTGGAAATTCCCTTTT 
CTTTTTAGGTAGCCGGTTGGGAGACAGTTTACTGGTGCAATTTTCCTGTAGATCTGGGCC 
TGCAGCATCATTACCTGGCTTGAGAGATGAGGTGATAGTTTAATCTTTCTTAGGCTGGTC 
AGAGTAACTTCTTTTTAAAATTGTTAATCCAGAACTTGAAAATTTCCTAAATTTATGCAG 
GATGAAGACATTGAAGGTGAGGGTCATCAAGCAAAACGTTTGAGGATGACTTCTGATACT 
TTCCAAGATACAATTGGAAATGAGGAGCTTTCATTGTTTGGTTCAACTCCAAATAACTCT 
GATTCAGCACAGGTAACAAGTTCTGTCTTGGTTAGAGTTTCGTAGAATTTTCTGTTGAGG 
TTCAATCTTGGAAAAATTAGATGGCTCTACTATATGAATTGGGGTTCCGTTGCAGAACAT 
TCTCCATCTTCCTATCTATGTGTGCTTTCAATTGCAAACATTCAGTCTAAAAAAATTAAT 
GTTGAACGGAAAATGACTTCATTAGTTTAACTACCGAAGAAAGACTTTTCCTTTGTGCAA 
CATGTATTGTATCAATAAGAGTTAGGTAGCTTATGTTCTCCTTTCCATGAAGTTTCTCAT 
ATTTTCTTTTCCAATAAATGCAGAAATCGTTTTCATTTGCAGTGAGAGATTCACTAGTTA 
ATGTTGGCCCAGTGAAAGATTTTGCGTATGGCTTAAGGATTAATGCTGATGCAAACGCCA 
CTGGGGTTTCCAAACAGAGCAACTATGAATTGGTGAGCCGTTTGGGTAGAAGTTCTTATA 
TTATACTAGCCATGGAACTGTTTTATACAAAATATAACTTGCTTAGGGTTGTTATTTAGT 
AATGTCTAGTTTTGAAGTATTCTTTTACGTAACAATGAAATCCTTTGTTCCACAACTTTA 
TTTGTTGACATGCTTGCCTCATATTTGTCTAAAAACTGTAGCCCCCAAACTAAAAATCTG 
AATTTTGGCGTTTAGGTGTGCTGTTCTGGTCATGGGAAGAATGGTGCTTTATGTGTTCTT 
CGGCAGTCAATTAGACCGGAAATGATTACTGAGGTATGCGTATATCTCAAATTGTGTCTG 
GTATATGAGAAGATTGGGAATCGTCCATTTGTTGATCTTTTAGTTTAAAACCCTTACTCC 
CATTACTATGGCATGGAGAGGATTTCATTTAAAATTCATTAGTTTGTAGTGAGCTCTGAA 
CAGAAGGCATTGTTACGACACTCTCGCGGGTTTATATCTTTCACAATTACTATCCACCAC 
TGGGGTATTTATCTGTTTAGTATTGATATAGACAGAAAAGTGGAAATTGTTATGTGAAAA 
GTACAAGTTAGAACTTAGAGGGGGAGCTCACTGTAGAAAAATGGGGATGTATCCGATCTT 
TCCTAGTAATGCTCTGTATGTGACCTAGTCTCTTTAATCCTTAAGCACCTCTATTCCGGA 
TGTTCTTGTGGGTAGGTTGAACTTCCAGGGTGCAAAGGAATATGGACAGTTTATCACAAG 
AGCTCCCGTGGTCATAATGCTGATTCTTCTAAAATGGCTGCTGATGAAGATGAATATCAT 
GCCTATTTGATTATCAGTTTGGAGGCTCGCACAATGGTATATTTTGCTTCTGTGTGTTGG 
TTGTTTTTCATTAGATCCTTTTATTATCCATAGAAATACCTACAATGTTTGCCTTTTCAG 
GTACTTGAAACTGCTGACCTTCTCACAGAAGTCACTGAGAGTGTTGACTATTATGTTCAG 
GGAAGAACAATTGCTGCTGGAAATCTATTTGGAAGGTAATTAGCTGCCATATTATGTCTT 
TTGAGATATGCTTTTCATAGAAGTATTTTTTTCCTTTACACCCATCTATCTTATTATAAT 
CCCCATGTAAGCTCTATCCATGGCTTCTTTTCAGTCATTGAGCTGTTTCTACTACATGCA 
GCTGTAAGATATACCAATATTGTGTAATATTAACTTCCATCTTTCTTTTTCAGGCGTCGG 
GTAATCCAGGTGTTTGAGCATGGTGCCCGTATTCTGGATGGTTCTTTTATGAATCAAGAA 
TTAAGCTTTGGAGCCTCTAATTCAGAATCCAATTCCGGTTCTGAAAGTTCCACTGTGTCA 
TCTGTTTCAATCGCTGATCCATATGTTTTACTTAGAATGACAGATGACAGTATTCGTCTG 
CTTGTTGGAGGTATGTTATGGAAAGATGAACATCTTATTGCAATAGTTGATCGTTGTAAT 
CTATTATGAACTTGAGCATCTTGAAATGTTTTACTCAATCTACTATGAACTTTGAATTGC 
AGATCCTTCCACTTGCACAGTTTCCATAAGTAGCCCATCTGTACTTGAAGGCTCTAAAAG 
AAAGATATCAGCCTGTACTTTGTACCATGATAAAGGACCAGAACCATGGCTAAGGAAAGC 
TAGCACTGATGCGTGGCTTTCGTCAGGAGTTGGAGAGGCTGTTGATAGTGTTGATGGTGG 
ACCTCAAGATCAGGGTGACATATACTGTGTGGTCTGTTACGAAAGTGGTGCCCTTGAGAT 
ATTTGATGTGCCTAGTTTCAATTGTGTTTTCTCTGTTGATAAATTTGCCTCTGGAAGACG 
CCACCTCTCTGATATGCCTATTCATGAGCTAGAGTATGAACTCAACAAAAATTCCGAGGA 
TAATACTTCGTCAAAAGAGATAAAGAATACAAGGGTTGTTGAGTTAGCTATGCAAAGATG 
GTCTGGGCATCATACACGCCCATTTCTCTTTGCAGTATTGGCTGATGGGACAATTCTTTG 
TTACCATGCTTACCTATTTGATGGTGTTGATAGTACCAAAGCAGAGAATAGTTTATCTTC 
AGAAAATCCTGCTGCTTTAAATTCCTCTGGTAGTTCTAAGCTTAGGAATCTGAAATTTCT 
ACGTATCCCCTTGGACACGTCTACGAGAGAGGGGACTTCAGATGGAGTTGCATCTCAAAG 
AATTACCATGTTCAAGAATATTAGTGGCCACCAGGGATTTTTTCTTTCTGGCTCAAGGCC 
GGGGTGGTGTATGTTGTTCAGAGAGCGACTACGATTTCATTCACAGGTATGATATTCTCT 
CGTAGAGATGATTTTGTGTTCTTGTGTTTTAAAGAACTGAAGCACTGATTAGTATGAATT 
CAATCTGTTAAAATTTTTGGTTTTTCTGAATCAATTTCGTTCATTTCATGCTATCACTTT 
TCAGCTGTGCGACGGATCAATTGCGGCCTTTACTGTTCTTCACAATGTGAATTGCAATCA 
CGGGTTCATATATGTCACAGCACAGGTTTAATAATTTTTCTACACGTCATTTCTGTTGTT 
GCTTTTGCTATTCTTATTATTGTAGCATCTTGACTATCAATTTCGTTGACAAGATGGTTC 
ATATTCATTTATATCAGGGAGTTTTGAAGATTTGCCAATTACCTTCAGCATCAATCTATG 
ATAATTATTGGCCAGTGCAGAAGGTAAATTCCAGTTTTTTTAATCATCTTTGCTTACTGT 
TGATTAGATGGAAAATAATAAGTGTACAAGGACTGATCACGTTGATACCTATATTTTTGT 
CTAGATTCCTCTAAAGGCCACACCTCACCAAGTTACTTACTACGCGGAGAAGAACTTGTA 
CCCGCTGATAGTATCATATCCGGTGAGTGCATTAGCATGATAATATACTCTAAATTGGTC 
TACCTGATCCGAATTGCATCTCTTTGGTTGCCTTCAATAAATTTGGAACTCTTTTGTGGT 
TGAGATGGCAACTGTGTTGCCCCAGCTCCCCGTTTTCCTTTTTAGCTATCGTGATTTTTA 
TCCTTAATTCATATTATCAAATTTACCCTTTGCAAATTTATTCAACTGGATGCCTCTCTG 
AATTTCTTTCATGAATATCACAGATTCCTGATTTTGTTTTTTTTGGCTGCAGCAATATTA 
ATAGATCATACTTGTTTGTTTTGTTTCATAGATAAACACCTAAACTAATGCAATGTTTGC 
ATGCTTATTTAGCCATTTTCTTTTTGTTGAGAAGAAAGAAAGTTTTGTGCCAGTTATGTA 
ATACCTGTCTATATATTTGATCCGCATCATTTGATATTTGATTATTCTATCTTACTAACA 
CAAGCAATGTCATTTCTTTCTCCTTTTGAAGGTCAGCAAGCCGTTAAATCAAGTTCTTTC 
TTCACTAGTTGATCAAGAAGCTGGCCAGCAGCTTGACAACCACAATATGAGCTCAGATGA 
TCTCCAACGGACATACACCGTAGAGGAATTTGAAATTCAAATTTTGGAACCAGAAAGATC 
TGGTGGCCCCTGGGAAACTAAAGCCAAAATCCCAATGCAGACCTCAGAACATGCACTGAC 
TGTGCGAGTTGTCACGCTTCTGGTAAGTTAGCTACTAACCCGCCTAATGTCATATTTGGA 
TCAGATCTCTCTGTTTTAATTGCAATAACCAAGCCACATTCTCTTACTCCCTGGGGTGTT 
TCAGAATGCAAGCACAGGGGAGAATGAAACACTTCTTGCTGTTGGGACTGCGTATGTCCA 
AGGGGAGGATGTTGCTGCAAGGGGCCGTGTGCTTCTTTTCTCTTTTGGAAAAAATGGCGA 
CAATTCTCAAAACGTGGTATGTTTAATTGGGTTCTACAACCTGGGGAATCTTTTTCTTTC 
TTTTCATTTTCACCTTGGATGTTCGATTTATTGTGAAGCCACTTTTCTATAGGTTACTGA 
AGTCTACTCAAGGGAGCTAAAAGGTGCTATATCAGCTGTAGCCTCCATTCAGGGTCATCT 
TCTAATATCATCTGGTCCTAAAATCATCTTGCACAAATGGAATGGCACCGAATTAAATGG 
TGTTGCCTTCTTTGATGCTCCGCCGCTCTATGTAGTCAGCATGAATGTTGTACGTTTTAC 
TTCCTTGGCCAGATTGCCTAGTGCTGTGTTGGTTTTATGAGCTAACTTTACTAAACTGAC 
CTGTCTTGGCTCTGAGGACAGTTTTCTTTTACGTGATCTGGCTTTGTAAATTCTTCTTTA 
CTTGCAGGTTAAGAGTTTCATCCTTCTTGGTGATGTTCACAAAAGCATATACTTTCTTAG 
CTGGAAGGAACAAGGGTCCCAACTTAGCTTACTAGCCAAAGATTTTGAATCCCTTGATTG 
TTTTGCTACAGAGTTCTTGATTGATGGAAGTACGCTTAGCCTGGCTGTCTCCGATGAACA 
AAAGAATATCCAGGTTAGCATCCTCTTATCGCCTTTAGTGTGTACTTGATGGGGTCAGGC 
CTTACTTATATGTACCGATCCCCAACAGATATTATATTATATTCCCAAAAAGGATGTCGA 
AGTTAGCAACTTAGCACTTCTCTTATCGCATATAGTGTTTACGTGGTGAGATCAGGCCTT 
ACTTATACAGTTATATGTAGAAGATGGATTATTGTGAAAATACCTCAACTCTTAAATTGA 
CTTGGTACTGATCCCCAACAGGTATTTTATTATGCACCAAAGATGATTGAGAGCTGGAAG 
GGTCTGAAACTTCTTTCAAGGGCGGAATTTCACGTTGGTGCCCATGTGTCAAAGTTCCTA 
CGTCTGCAGATGGTTTCTTCTGGAGCAGATAAAATAAATCGATTTGCTTTGTTATTTGGT 
ACTCTAGACGGCAGTTTTGGTTGCATTGCTCCACTGGATGAGGTCACATTCCGGAGGTTA 
CAGTCTCTCCAGAAAAAGCTAGTGGATGCTGTTCCTCATGTTGCGGGTCTGAACCCACTC 
GCTTTCCGTCAATTTCGCTCAAGTGGGAAGGCTCGACGATCTGGGCCTGACAGCATAGTT 
GACTGCGAGTTACTATGCCAGTAAGTTTTCTTCCGCATTCTATATGTTCAAACGGTAGTA 
ACAGACATATGACAAAATGGACCTCAAAGTAGAGAGAGCACATAGGATAATAAACTCGAA 
AATCACACGATAGAAGGATCATAGATGCATATCCTCATGGTTTTGAAAACATTTTGCAGT 
TACGAGATGCTTCCATTGGAGGAACAGCTTGAACTTGCTCACCAGATTGGGACAACCCGA 
TATTCGATTCTCAAGGATTTAGTTGATCTCTCTGTCGGAACCAGCTTCTTGTGAAAGATC 
AAAGAAAAAGGCAGATCGTAATGCGTTGTTCACCCGCCGACAAAAATAGGCAGAGTCGCT 
TAATATGTTGTAAAAAATGCTGTAACAGTAGACAATCGTATGAACTTTGATGTTTAGTGG 
CATTTAGATTATGTTAAGATTCTTCTCCACTCT
>AT1G16980.1 |  ATTPS2 alphaalpha-trehalose-phosphate synthase (UDP-forming)/ transferase transferring glycosyl groups 
ATGGATTATGATGATGCACGTGGTGAAAGGCCAAGATTGCTTGTGGTGGCTAACAGGCTT 
CCGGTTTCTGCAAAGAGGACCGGGGAAAATTCTTGGTCTCTGGAAATGAGTCCTGGTGGT 
TTAGTCAGTGGTCTTCTAGGTGAGTCATGAGACAACAATAATAATAACAATGATTTTAGT 
AAAGACTATAATGTTTTACTGTTATGGTTTTGAAGGTATAACATCTCAATTTGATACCAA 
ATGGGTTGGATGGCCCGGAGTTGATGTGCATGATGAAATTGAAAAAAATGCACTCACTGA 
ATCTCTAGCCGAAATGGTACGAATTTGATCCCAACATGTCCATGTGTATATTGAAAGATT 
AGCGGTTAGGAATCTTATGTTAAAAGGAATCGTATAGATGCATATAATCTCGTACATAAG 
AGTTATAGATCATTCTGGAAAAAAAGGAAAAAAAGAAGAAAAAAAAGAAAAAAAAGAAAA 
AAAAAGAAGAAAAAAGAAGAAAAAAGAAGGAAAAAAAGAAGAAAAAAAAAAGGAAAAAAA 
AAGAGAGTTATAGATCATTCTTCTCATTGTTGATTAATTTTGAAATGAAAACATTTAAAT 
ATTTACATGTCTAGTACGTAATTCAAGTTTTTCTTATATCAAACATGTTCTTTGTATTTG 
CAGAAGTGTATCCCTGTGTTCCTTAATGGGGTTTTTGATCAGTACTACAATGGTTATTGC 
AATGGTATCTTGTGGCCAATTCTTCATCACATGGGACTTCCACAAGAAGATCAGCATGAC 
ACAAACCAAACTTTCGAAACACAATATGATGCATACAAGAAAGCAAATCGAATGTTTCTT 
GATGTCATAATAGACAACTATGAAGAAGGAGATATTGTTTGGTGTCATGACTATCATCTC 
ATGTTTCTTCCTCAATACCTTAAAGAGTACAACAACAAAATCAAAGTTGGATGGTTTCTC 
CATTCACCATTTCCTTCTTCTGAGGTCTACAAAACATTGCCCTCGCGGTCAGAGCTTCTT 
CGTGCGATTCTTGCAGCTGATTTACTTGGGTAAAACTCAAACTCTTAACAGTTTCATATA 
TGGTTAGGAATCATCTGATTTGGATATCAAAAAAGGTTTAAATTTATGTATTGTTTTTTT 
CCAGCTTCCATACATATGATTTTGCAAGACATTTCTTGAGTACATGCACTCGAATTCTTG 
GAGTTGAAGGAACACATGAAGGAGTTGTGTATCAAGGCAGAGTCACTCGAGTAGCTGTTG 
TATGACTTCAACATCTTAGCTTAACATTTCTCTGTAACCTAAATCATTATATAATAACCA 
CAAATATTTCTCTGTTTTTTATTTTCAGTTTCCCATTGGAATAGATCCTGATCGGTTTAT 
AAGAACATGTAAGCTCCCTGAAGTCACACAGCAAATGAATGAGCTTCAAGAGAAGTTTGC 
TGGCAAAAAGGTACCAACATTTCTCTCACAACCTTTTAGTTTGATGCTTAGTTAAAAAGA 
AGATATTTTTACATGATATTTTTTGGTGTTGACAGGTGATATTAGGTGTTGATCGTCTTG 
ATATGATCAAAGGGATCCCACAAAAGTATCTTGCATTTGAGAAGTTTCTAGAAGAAAATC 
CATATTGGCGTGATAAAGTTGTGCTAGTGCAAATTGCAGTGCCAACAAGAAATGATGTCC 
CTGAATGTAAAAAAACTTTATATACTCTTATGCTTCTTATTTTATATAGGATTTATCATC 
AGTTTTATGAGATTGTGTTTGCATACAGATCGAAAGCTCAAAAGCCAAGTCCATGGACTC 
GTTGGTCGCATAAACGGTCGTTTTGGTTCTGTCTCTTCTCTTCCAATCCATCATCTGGTT 
TGTTTGATTTCTCTATCTATATAACTCATGTTGTCATAAGTTAAATATACTATCTTCATA 
GTTTCTTGATAGATTTTTCCCTCATCTTCTCTGCTAGGATTGTTCTGTTGACTTCAACTA 
CTTATGTGCAATATACGCAATTGCAGGTAACTAATTTCCTTCATTACATATGATGATTAG 
TGAGTTGGTTATAGTTCTTTCTATAACTTGTTTGATGATGATGATCTTTTTTTTTCTCTA 
CTTTAGATGTAATGCTTGTAACATCTTTGAGAGATGGAATGAATCTTGTTAGTTATGAAT 
TTGTTGCTTGTCAAGAAGCCAAAAAGGGGGTTCTTGTTCTCAGTGAGGTAACAAAAACAA 
TTGCATTTTTTTTATGTTAACAACTTAACATAACATTTTATAATGATAATTTAGGTTATT 
GACTTTACATATGTAATTATACAGTTTGCAGGTGCTGGCCAGTCTCTTGGTGTTGGAGCT 
CTTATTGTGAATCCTTGGGATGTTACAGAAGTTTCTTCTGCCATTAAAGAAGCTCTAAAT 
ATGCCAGCTGAAGAAAGAGAAACAAGACACAGATCTAATTTTCAGTATGTGTGTACTCAT 
TCTGCTGAAAAATGGGGATTAGATTTCATGAGGTAAACCTTTTATTTTCTTCAAAACATT 
TAAGTCTCTTAAGTAAGAGCTCATTTATGCCAAGTTTTGTTTTTAATCTCTACGTAGTGA 
ACTCAATGGCATTATTCCTGAATCCGAGATGCAAATGAGGAAAATCCCACTTCAACTTCC 
AGAACAAGATGTGATTCAACAATATTCGCAATCTAACAATAGACTAATAATATTGGTAAT 
TAAGCTAGCTAGCTTGGGAGACTTTCTGAATCTTATCTAGACTTTTATGTTTTTGCATGT 
TTACTAAATTTTAATTAATAAACAATTTCAAATATGTTTCAGGGTTTCTTTGGAACACTC 
GCAGAGCCAATGAATAGTGGAACTAAGGAAATGGATCTTAAACTAAACCCAGAGCTAAAA 
GGAACACTGAAAGCATTGTGCAATGATCCAAAAACAACAGTAGTTGTATTGAGTAGAAGT 
GGCAAAAACATATTAAACAAGGTATCATCAGTGTCTTTATTATATAAGATTTATACATCT 
ATTTTGTAACTCATGTGCTGGTACTTAAAATTCAGAATTTTGGAGAGTCTAATATATGGC 
TGGCTGCGGAAAATGGAATGTTCGAAAAGCAGACAACTGGAGAATGGGTGACAAATATGC 
CTCAAAACGTGAACCTTGATTGGGTCGATGGTGTAAAGGTTAGTAATTTCTGTAAAAACT 
AGACAAACTTGTTAATCTTTCCTTTATATCTTTTATGGATTTGATTGTTTTGTATAACGT 
AGAATGTTTTTAAGTATTTCACTGATCGAACTCCAAGATCGTACTTCGAAGCAAGCGAGA 
CTTCGCTCGTATGGAATTATGAATATGCAGGTGATTTGGATTAGTTTCTTGAATTCCAGA 
CACTTTTATCTTTTTGTTAAAATTTCCATTTTCTTGACTCTTTTTGTAAGATGTTGAATT 
TGGGAGAGCACAAGCAAGAGACTTGTTACAATACCTATGGGCAGGACCAATCTCTAATGC 
ATCAGTTGATGTTGTTCGAGGAAACCATTCTGTTGAAGTCCATGCCATTGGTGAGACTAA 
GGTAAATTAAATGCTTCTGATCATTTCTTATTTTCTTCTTATATATGCAAAACTCGATAT 
ATATATTTACTGAAATTGTTATTTCAAGCCTTGTATATTCTTTCATTGTTTCTTAGGGGG 
CAGCAATTGGTCGTATTTTGGGAGAAATAGTGCACAGAAAATCTATGACCACACCGATTG 
ATTTTGTCTTTTGTAGTGGTTACTTCTTGGAGAAGGTAAAGAATATATTATTACGTATAC 
TAATCAGACTTATAGATTTTATCCGTTTGGCTTTTTTTTTTATTATGCAAATGGGTCTAT 
ATATGTTGCAGGACGAAGACATTTACACATTCTTCGAATCAAAAATCTTGTCGTCCAAGT 
CACCGAACGGTCTCGACCTCAAGAAAGAGAATTACTTCTCTGCAGCCATTGGACAAGCTC 
GCACAAAAGCTCGCTATGTCATAGACTCAGCTCACGGTGTTGTAGATTTGCTCCACAAGC 
TTGCAGTTGTTGCAGATACAACAATGACTGACTCATTTTCTGATAGCGAAATATATGAGC 
CTCGCGATGCAAATGCAAATGAAAATTCGAAACGCTGGATCAATTCTGTCAGAAGAAGGA 
AAGTGGAAATTGGAGACACTGGGCAAATCGGCATGTAA
>AT5G09880.1 |  RNA recognition motif (RRM)-containing protein 
AAATTCAATTATCTCATTAGCTTCTTCCAATTCGAAACCCTAACAAAAGCCCTAATTTAC 
GAAATACGCCGAATCGTTGACGAGAATGGAGTTTGACGAATACGAGTACCTGGAGAAGAC 
GGTTGAGGAAGGAGCTGGGTCGAATAAGAAAAAGGAAGAGAGTGGGAACGAGAGGAGCGA 
GAGGAGTTACAGAAAGAGAGAAGGAGGAGAGAGGCAGGGGGAAGAAGGAGGTGAAGAAGA 
GCGGGTTAGCAGTCGGAGTAAGAAGTCTCGCGGAGACGGCGAAGAGAACGGTGGTGGTAA 
GAGGGATCGGGAGAGAGAGAGGCATAGGAGCAGCAGAGACAAGGATAGGGAGAGGGATAA 
GGTTAGAGAAGGATCGAGAGATAAAGAGAGCGATCGAGAGAGGAGTAGCAAGGAGAGAGA 
TAGGAGCGATAGAGACAAACCCCGAGACAGAGAGAGAAGAGAGAGGGAGAAGAGGAGCAG 
CAGTAGATCTCGGAGGGAAGAGAAGGAACCCGAAGTAGTGGAAAGAGGAAGCAGGTTTGT 
TAAATTTCTCTTTCTTCTTTACATGGGCAAGTGTTTGAGGAATGATACAAAGTTCCGATG 
AGCTTTCTTTAGTCGTTTAAGAACGGTTTTAAATGATTTCACGATTGCAGAAGACACAGG 
GACAAGAAAGATGAGCCTGAAGCAGATCCAGAGAGAGATCAAAGAACTGTTTTTGCATAT 
CAGGTAAGTTCTTAAACATTTGGGTTTAATAATTAGGGGAAGACATAACCCACATTGTTA 
AGTTTACTGATTACGTTAAAGTTAAATCTTGTTTTATTATTGAACAGATGCCTCTTAAAG 
CTACGGAGAGAGATGTTTATGAGTTCTTCTCCAAAGCGGGCAAGGTCAGTTACTTTGTGC 
CTTTTCTAGTTTGTTAATTGTCTTTTTGGTTGTAGTTTTTGATGGGTTACTGTTTCTATG 
TGCTTGACCATGGCATATAATCTTTTACTGAAGATGTAGATTTTCTCAAGTATGATATAT 
GTTGGGATCTGTAGTTTTTGTCACAATAGAATAAACATTAATCGTTAGCTTGCTTCATTG 
ACTTTCTTATTTCGGCTTCAATAGGAACACTTATTTTTCTTCAGTGTTTAAATAATTTGT 
GTGGTCTGGATTGCTAGACTTCTTTTGCTTACTGCAGAGAGCTGTTTTGATCAAAAAAAA 
TTTCTATCTTTGCTCTTGTAATTTCTTTTGCGTTCTGTTTTCTCTTTGTTCTTATTGTTC 
TCGGGTCTTTATAATTTCAGGTGAGGGATGTGCGATTGATCATGGACAGAAATTCAAGAC 
GATCAAAAGGCGTCGGGTATGTTTCTTCAGTTTCTACTAAACTTAGTTTTGTGTATGTGC 
ACTTGGTACGTAAATTTTCTGCATATTCAGTTTTCTCTGCAATTTCAAGAATTCGATTCT 
GTATTCTTAGATGCACTAGCAATGCGATAATGATGAGGATGATGGCAATACCTTGCACAG 
TTGTTTAATCATTCTGCGTGGTCAAGGTAGATGTCAGAAAACCTGAATCCTATTTCAGTT 
GTTACTTTCCATTGCAAGCACTCTCAGGAAGGAGGGAATCCTATAGCCTATCAATCTTAT 
TCACATTCTTTGTTTGATACTTCCTCCTAGTCCTTGGTGCTTTCCCTGTCCTCTGTTTGG 
ATATTCACTGGTGGAGGAGCTTGCTTCTGTAGTCATTGCTGTTATAGACTTGATTATTGT 
TCTTTTATCATGATGGGCTAACATTTTCTATTACTCTAGGCCTCCAACCCACCAAAGAGA 
CTCAGCTTGAACCCCCGCACTAAAGTTTTTTGTTTCCAACTTCTCTTTGCTACTTGCTTT 
GTAAGTTTTTTTCTGATTTGTTCGTCCCATGTGTGCTTGAAGTCAAGTATATCTCTTCTT 
TTTTTGTACTTTCAGGTATATTGAGTTTTATGACGTGATGTCAGTTCCAATGGCCATAGC 
TCTGTCTGGACAACTGTTTCTTGGACAACCTGTGATGGTTAAGCCCTCTGAAGCTGAAAA 
GAATCTGGCCCAATCTAACAGCACTACGGTTGGTGGTACAGGCCCTGCAGATAGGAAACT 
CTATGTGGGTAACCTGCATTTCAACATGTCGGAACTGCAGCTTAGACAGGTGATATTCAG 
TTTTCTAGGTCAATTGTTTAATTACATATGGACACTCCAGCAACTGTTTTTTTTTCTTTC 
AGTATCCTTCATATTCTCACAGTTGTTTCCTTTTCTTTATCAGATTTTTGAGGCATTTGG 
TCCCGTTGAGCTTGTTCAGCTACCACTTGATCCTGAAACTGGGCAGTGCAAAGGATTTGG 
ATTTATTCAGGTTAGTGGAACGTGTTTTTTACTTTGTTGGTACTCTTTTTCTTAGTTATT 
CCTCACTGAGTTTTATTTTCTCTTGCATAGTTTGTTCAACTTGAACATTCAAAGGCAGCA 
CAAATTGCCTTAAATGGAAAGCTGGAGATTGCTGGTAGGACAATCAAGGTGAGTTTTGAA 
TTCCTTGTGGAAAAATGATGAGTTCTTTTGAATTGCATGTATCTAATGTTTACTTTATCC 
GGGTTAATATTTTCTTTTTAGGTTTCTTCCGTCTCTGATCATATTGGTACACAAGATTCT 
GCTCCAAAATCTGCTGATTTTGATGATGATGATGGAGGTGGACTGGTAAGCTAGAGATCC 
TGGTCCTTTTACTCTTTGTCTCCTTTAACTTAAAGGTCTGTTTTTATGACTCTCTCTCGC 
TCCCTCTCAGGCTTTAAATGCACAATCTAGGGCTATGCTTATGCAGAAGCTGGATCGTTC 
AGGTATCGCTACAAGGTATATCTGTCTCTCTTGTCCGCATCTATTTTACCCATTTGGTTC 
ACAAATCTTTTATTTGCGAGTACCTCCTTATAACATATGGAATTCTATCCACAGCATTGT 
GGGCTCTCTTGGAGTACCAGGGCTAAATGGAGCAGCGTTTAATCAACCAGGCATGAATCC 
TAGTTTCCCAACATCAGTGCTTCCGACAACAGCAATCCCTTCTTTTGTCAATGAACATGT 
TGGTCTGCCAAGCGAATGCCTTCTATTGAAGAATATGTTTGATCCTGCAACCGAGGTCAA 
TGCTTGCTTCTGTTTTTTGTTTTTTGTTTTGTTTGAGCTGGGAAAAACAAGTCTCGGCCA 
TTATTGCTATTAACATCAAACCATTATTTTGCTGCAGACGGAACCAAACTTTGATCTTGA 
AATCAGAGACGACGTTGCGGATGAATGTTCAAAGTATGGCCCAGTCAACCATATATACGT 
AGACAAGTAAGTATTTTAAATCAAAATGTGTTACATGTTTGGCTGTTTCTGTTTATAGAT 
ATGTGACATTGGTATGAATTCTGGTAAAATGCAGGAACAGTGCGGGGTTTGTGTATCTGA 
GGTTTCAATCAGTGGAGGCAGCAGCAGCAGCTCAAAGAGCAATGCATATGAGATGGTTTG 
CACAAAAGATGATATCTGCAACTTTCATGGTAAAACAGTTAGTTCGTTCATCCTCTTTGG 
CTTTTACTTTCATCTGTTTACTGAATGAATACTTTTATTGCAGCCTCCTCATGAATATGA 
AGCCAAAGCCAAGGCCTGAATTGAAGACAAGTCGGATTTTTGTCTTTAGTAGATTTCTTG 
TTCTAACTGCTATGCAGATTCTCAATCTCTTGTCTGAAATATGTTACATAGATAAAAGGA 
TTATGAATGAGGACCTTTCATTCTTCTTCTTTTTTTTCTGTCCTCGTTTGTTGTAACTTT 
CCCATATATTATTGATCTTTGAACTTATAAAATCCGCAATATC
>AT1G17760.1 |  CSTF77 protein binding 
AGAACCGCGGAAAATATTCGTTTCCTGAAGACGGACCGGTTGCTTTGAGTTTCCCCGTTC 
GACAATAGGGTATCACCGACCACCGTGTTTCGGGCAGACTCGTCGGAGGAGTGTTAAAAT 
TGTTGAATCTCAGATTAGGGTTTACTTCTATGGTAAACTTCTGAAGGTCTGTCTGTTTTC 
CTGATCTGAGGTCCTTCTAGGGATTTTTTTTTATGGCGTTGAAGCAGCAGAAGCTTTAGC 
TAGACTTGTCGGAAGATTGTGACACTTATTGAATCTCAGATTAGGGTCTACTTATATTAC 
CATTGAGTGGAATATTTGAAAGACTGTTCTTCCGAAGGTGAAATTCATGGCTGATAAGTA 
CATCGTCGAGGAAGCAGAGGCTTTGGCCAAGAGAGCTTTGGTACAATTCTTTCCCCAGCT 
ATATACTTGTCTGACTTCTCGTACTCTTTCATAAAGTTTAGATTTTTACTTGTTGGGTTT 
CGTAAAATTGTGTCCTTTCCTCAGCATTCACCAATTGCACAGGCGACGCCGATCTACGAG 
CAGCTTTTGTCACTTTATCCCACTTCTGTAAGTTTCCCATGACTTTGCTTCCACGTATTT 
TAAGAGTTTCCTGATGTTTTTGGTTAATTGTGAGCTCCTTTGTACTCTGTAGGCGAGATT 
TTGGAAGCAATATGTGGAGGCACAGATGGCTGTAAACAATGATGATGCTACCAAACAGAT 
ATTTAGTCGTTGTTTGTTGACCTGCCTTCAAGTTCCTCTTTGGTAATGCCATGTTACCCT 
TTATTAGTCGTTGATAAGAGTCAATTTAACATCTTTTCGTCTCATTGTTGGGTTTCTTGC 
TCAGCTGCAATGCAAGTCTTGCCATCTCCTTGGATATAATTCTAACATCTTATTCTCTCA 
GGCAATGTTACATTCGGTTCATCAGAAAGGTCTACGACAAGAAGGGAGCAGAGGGTCAAG 
AGGAGACCACAAAGGCTTTTGAGTTTATGCTTAACTATATTGGTATTGCTTCTCTTCCGC 
AGTTTTGGCTCTATTTTGTTTGTTTTTCATTTCAATCATGTCTCATACATAGAGGGAATT 
TTTTCCGTTTTGTGAGTAATGAATACAGTTATGTTTAGTAAACAATATGATTTGATCAAT 
TTTATGCTTAATATAGTTGCTAATGATAACTATTCATCAGCAATAGCAAGCACATAGTTA 
CGCTTCGTGTCTATGTAGACCTCTAGTTTCCCTTTATCATGCCAACACATAACACAACTT 
GGGCCTTACAGATGGTTGTTTATTTCGATTTATGAATCTCCAGGGACAGACATCGCATCA 
GGGCCTATATGGACTGAGTACATTGCCTTTCTAAAATCTCTTCCGGTTCGTTATATCACT 
CTAACTTTGTCCTTGATACTAATAATTTGTTATTGCAGAGAAACTAATAGATTCCCATGC 
AGGCTCTTAACCTCAACGAAGATTTGCATCGGAAGACTGCTCTTCGAAAAGTGTATCATA 
GAGCTATATTAACTCCGACCCACCACGTTGAACAACTTTGGAAAGATTATGAAAACTTCG 
AAAATACTGTTAACCGTCAATTGGTAAACTTCTAAGAAATTAAAATTATGTGGCTTCTTA 
TTTTCATGAAAAGAAGCAGGTACGAACTTCATTCTCTTGGCTTTGTTGATGGATAATCTA 
ATCTAATCATGTGAGCAGGCAAAAGGACTTGTAAATGAGTATCAACCAAAATTTAACAGT 
GCCAGGGCTGTATATAGGGAGCGCAAGAAGTACATTGAAGAAATTGATTGGAACATGCTT 
GCTGTCCCACCAACAGGAACTTCCAAGGTAAAGAATTTATCATCCATTGCTTCTTTTTGG 
AACTGCTGAGTGCTGAATGTACAATTATTTTCTTATCTTTTTGAGTTCGATAAGATTGGA 
TATATTGACTCTTAAACTGCCTAAAAGACATTATGAGCATAATTCACGTCATGAGATCAT 
GTTATTAAGATAGGAAATACATATTGAGTATCATCTGCTTACTTTGCTACTTTACACCGT 
CTTATGGTTTTTTGCAGGAAGAAACCCAGTGGGTGGCCTGGAAAAAGTTCTTGTCCTTTG 
AAAAGTAAATCCCCAATTATCATATACAGTTTTTAATTTTAATATACATTCCATTCAGTG 
ATGATGTGTGTTTTACGTATCTCCTTAGCCATTGTTTCTCTACCATAGCTAGATTTTAAT 
ATATCGCAACAGTTAATTGGTCCCTTGGTAGATTTTTTTGATTTTTTCGGTTTACGCCTA 
ATGGTAAGACTTTTATATCTTGTTCCGTCTCTGTGTTTTGCCGATTAAGATTTATGATAT 
TAACTAGAGAGCTGGAATAAATTACTATCCAGTTATGTCTCCAACAAGTGATGATGAGGT 
CTTATGCATAGAATTGTTTAACGAGTCCTTCTAAATATAACAAACTTCTGTATCTAATAC 
AATTGTAAATTTCAGAGGAAACCCTCAAAGGATTGACACGGCCTCGTCAACTAAGCGGAT 
TATATATGCCTATGAACAGGTATGCGAAGAGTCAGTGAGATGCTCTTGCTGAAATTTTGG 
AGGACTAATCTCCGAAATGTGTTCATTTCTGAATTGACTGACTATTACTCTGGTTTTACA 
GTGTCTGATGTGTTTATATCACTATCCCGATGTATGGTATGACTATGCTGAGTGGCACGT 
AAAATCTGGTTCCACGGATGCTGCAATCAAAGTATTTCAGCGAGCTCTTAAAGCCATTCC 
TGGTAAAAATCTAATCTATCCTTTTTTCTTTATGTCTATGAACTAGTTGCTTTATGAAGG 
ATCAACTATTACTCTTTGCTTACCTGCTGGCTTACTGTTTTAATCTTATCTTCTATCTAC 
TCTTAAGAAGTCTATTTTCTCTCTGCGACTCTTTTATATTTTTTACTAAGTGTCTACATT 
TCCCACTCTCGTATGTCAGATTCAGAGATGTTGAAATATGCTTTTGCTGAGATGGAGGAA 
TCTCGTGGAGCAATTCAGGTTTTTATTTCTTGCTGCTGGCTTCTTGTAATTTAGCTTTAT 
TAGTTGTCCGCATACTCGTTGCTTATAGTTGTATGATTTTGCAGTCAGCGAAGAAATTAT 
ATGAAAACATTTTGGGGGCTAGCACAAACTCTTTGGCACATATACAAGTAAGTACGCTCA 
AGTTTCAAAATTTAGGACTTGCGAAGATTGGCATAAACAGCATATCTTTCACTTTGAAAT 
TGTTTCTTTTCTCTGAAAACATTCTCATATGATATATACTTATATATATATATATATATT 
CTTTCGCAGTACCTTCGTTTTCTCCGGAGGGCTGAGGGTGTTGAAGCTGCTCGCAAGTAC 
TTTTTAGATGCTAGAAAATCTCCTAGCTGCACATATCATGTGTATATTGCTTTTGCTACC 
ATGGCCTTTTGTATTGACAAGGAACCAAAGGTGTATTTTCTTACCCACTATGTGGTGGTC 
TATATGCTATTTAGAACTGCTTTTGTCTTGTGAAGGAGGTAGTGGTCGTTCAGTCAAGTT 
CAGAACCCACTCGTCTTATTAGTCTCTTAGTTGTTTAAGTTAACCAGGACCCATGAGACT 
TTTGTGATAATAAAGTCAAAATGATTTGAATATTGGGGTGTTTTGGCTATTGATGCACTT 
AAACTCTTCATTTGTTTGCAAAATACATGTACGTTACTTTTATGCCTCGTACATTCCTCT 
TTGTGCCTTCATTTGTTCGATTCTTTAACAAAGAATTAACATGTTCTTGCAAGACATATA 
TACTAATGTAAACCATCTGACTTCAATTTCTATTCAGTTTCACAATAAAAATCCTTATGT 
TTGTATTTTTATGCAGGTTGCACATAATATCTTTGAAGAGGGGTTGAAACTCTATATGAG 
TGAACCTGTTTACATCCTTAAGTAAGTGTCACTGTAGCTTTACTTAGCGTTCCATTTTCT 
TAAGATACTTGGAAGCTCTTCTTTATTGAAGAAATATTGAGACTTTAAGACCTTCTCAGA 
TAAAATATCCTCAAACTTGTTTCTCTCCCAAACCTTCCTAAGACAGAATTTTAACCATCT 
GGTTTTGCTTTGCAATCTAGGTATGCAGATTTCTTGACTAGATTGAATGATGATAGAAAT 
ATCAGAGCTCTATTTGAGCGGGCATTAAGCACGTTACCAGTTGAAGACTCTGCTGAGGTA 
CGCTGATAGTGATATATTGTTTCTCAAAGCTGTTAAAGTATGCAGATTTTGTTCTTAAGC 
ATGAAAAGAGACAACAAGGAAAATTACTAACCTGCTAATGAAAATAACCAAACCGAGCAC 
CTAATTTGATTATAGCATTTCTGAATGCTTAAATATGATAATGGTTTAGCAATTGGAGGT 
GTAATCTTGATGCACATCTGAGCCTTATGAACAGTGGTGGGGATAGTAGACATTTAAAAC 
TGAACTGAAAGAGTCCAATATTATTGTGGTTCACATGTAATACTGTTTAAAATGCTAGAA 
CAATAAAGAAGACGACTGGTGTCAATGGGTTACGCCGTTATGCTAATTGATTTCTAGGAT 
TAACTTTTTTCTTGCTCCATGTTTTGTAGGTCTGGAAAAGATTCATTCAGTTTGAGCAAA 
CATATGGAGATCTTGCTAGTATTCTAAAGGTATTTTAACTCATTGAATGTTGTCAACGTA 
TACGAGGAAAGCTACTATTATTAGCTTCCTGTGTTTTGTTAGCATTTTTTGTAGTTGTTT 
TTCGGTTGACTCCATTATGATGATAAGTTTGTTGAAGGGTCCAAACATTTATATCTATTC 
CATCTTACTGGCTTTTAGTTGCATGGAAGATCTAAAAATGCTGACACGTTCAACTTATTG 
CTAGAATAGACTATGTCAGACTCGCACCTCATAAAAGAGACATTTGATCAACGATGAAAT 
TTACTGAAATCAGATCCACGATACATCCAGTATCAAGTGTGGCTGTTTGATGGAGTAGTC 
TGCTTATCTTCTTAGTTTTTTGCTCATAAATTTTCTTTACTATGACAACCTTGTTGTAGG 
TTGAGCAGAGAATGAAAGAAGCACTTTCTGGAAAAGGGGAAGAGGGGTCTTCTCCTCCAG 
AGAGTTCACTTCAAGATGTTGTTTCTCGGTACAGTTACATGGATCTTTGGCCATGCACTT 
CTAACGACCTTGATCATTTAGCCAGACAAGAGGTATTTTCCATGCAACATATCGCAATTA 
GCTCAAATAGCTACTAATGATACATCTAGTAAGTACTAATTCTAACCGATCAATGTGTTC 
ACTATAGTTGCTTGTGAAGAATCTGAATAAGAAAGCAGGGAAAACAAATCTACCTCATGT 
TCCTGCGGCTATAGGTCTGTTCTTTTTAATTTTCTGGTGTGATGGATTATGTTAAACTTT 
GGTGATGACTGAAGTAAATAAACCGCCTTCTGGGCTGACAGGTAGTGTAGCTTCTTCGTC 
AAAAGTTGTTTATCCAGATACATCTCAGATGGTTGTTCAAGACCCGACAAAGAAATCAGG 
TATCTGATTTGCACTTTGCCGCAATATTTGGCTGCACGATGAATGGAATTGTTAACTTAT 
TCTGAACCACTCATGATTTGACTGTAGAGTTTGCTAGTTCTGCAAACCCAGTGGCAGCTT 
CTGCTTCGAACACCTTCCCAAGTACTGTGACTGCAACTGCAACTCATGGATCAGCCAGCA 
CATTTGACGAAATACCAAAGACTACTCCACCTGCATTGGTAGCATTTTTAGCTAACTTGC 
CTATTGTGGACGGTAAATCTCTTAAAAACCAACTCCAAGTTGTATCTGAACTGAGCACCT 
GAATAAGTGTCCACTAACCAACTAGTTTATCATTATCTTCTCAATTCGCAGGTCCAACAC 
CCAATGTGGATGTTGTTCTGTCGATATGTTTGCAGAGCGACTTTCCAACAGGTCAAACTG 
TAAAGCAGAGTTTTGCTGCTAAAGGCAATCCTCCAAGTCAAAACGATCCCTCGGGTCCAA 
CCCGCGGTGTGTCTCAAAGATTACCAAGAGACAGAAGAGCTACAAAGAGAAAAGATTCAG 
ACAGTAAGTTACATATGCTTATAGTTTATGTTCAAGTATATATATTTTATGGCTCATGAC 
TATGTCATCACTCAAATGTTTGGCACTTCTTAGCTGCAGATGCATATAACTTCTACTATC 
CCTTAGAACAACCGTTAAATGATAGTTACTTATCTTATTCTATCTCTCTGTTAACAGGGC 
AAGAAGAAGATGATACAGCAACTGTACAAAGCCAGCCTTTGCCCACAGATGTTTTCAGAC 
TAAGGCAGATGCGGAAAGCTCGAGGGATCGCAACATCATCACAGACACCAACCGGTTCCA 
CATCGTATGGTAGTGCCTTCTCTGGCGAGCTTTCTGGTAGCACTGGCTAAAATATACTGA 
GATTGGCAAATTTGTGAAGCCTCTCTTAATACTTGTAATTTATTTCCCCCAACAATTCCA 
ACTTATGCAATAAAATTAAGTCTCTTTGGAT
>AT1G21570.1 |  zinc finger (CCCH-type) family protein 
ATGCGACCATTTAAGCAATCAAAGTTTTCTCTGGTTTGGACGCAAAATGATCCGCAGCCA 
AGAATGCCCATAGCTCACATGCGAAATCAGAATATTGTGCCGCAACTTGTTCCCTGGAAA 
AGAGTGACGTACTGGAGAAGATTAATGAACTCAGTGTCTGCTTTCCGAAATGGTTCTTCT 
CTCAACATTAGGTATGTTAGCATCTAAAGGTGCTCATTTTCCTTGGGCTGCAACCTTTTT 
TTTTGTGTTTGCAAACATGATAACAGGGCCATTCTATCTTCAGCCGAAAGTTGTCAATGA 
TGAGGAAGAGACACACAATTTACACAAGATCAACTAATGGGTATTCCCTCAGAAAATCTA 
AGGTATTAAGTGTTGGTGGGTCGCATTTAAAATGGTCCAAGTCCATTGAGAGAGACTCGA 
GAAAAGCTAATGAGGTTAGTTTCCTCAGTGTCTTTGGCCTAAGTCTATAAATAATTGCTC 
CTTTAGGACTATTGAATGTGGTGTCGACAATAAATGTATCTTTTTCATATTTGTACAGGA 
GGCCACATTGGCTGTGGCTGCATACTCAAAGAAAGAAAGTGAAAAGCAATCTGGACAAAA 
TAATACTAGTACGGCGAGCAGAAACCATCTGGCACGTAAGTTGGTTCACGATATCCATGA 
CCTATTTGGTTCCCTTCTTTTGAATTTATTTTCTTGCCATTTTTGAGATGGCCGGATGAC 
TCTGTTTCCAGCAAACCTCAAGTTTTTTATAATTGATTTCTGGTTTTCAGGGGAGCGCGT 
TTTCAGGTTTGGTTCCCTTCGTTATAAAATGGACTCTTCAAGACGAACTCTTCAGAGAAT 
ATCTGGTAGGATATTCTTAAGTTAAAAACTCATGAATGCTATAGTTTGATATCGTTGATG 
TGAAATGAATATACGAAAACTGACAGACACACACACACACACGTGTTATATACTGGTCAC 
ACCCTCTAGGTGATTGATGATTCTCAACAAAATGTTTTGATCGGATTTGAGAACTCTCTC 
GTTGTATAAGTCTTACCCTTGTGTATCTCTCATTAGCTTAAACATAAATTTTTGTTAGAT 
GTTGATTCACCGTGCTCTGGACCTTCTGAAAATGGAAAGGGTGTGAAAAGACCGTTTATC 
CCAAAGAGATTGGTGATCGGCAATGAAGAGTACGTAATTCTCAATGCATTTTATCTATTT 
ATATACTCCACATTCTGGAGCCTCAATTGAACATTTGAATCTATTTTTGCAGATATGTTC 
GGTTCGGGAATGGTAACCAGCTTGTCAGAGATCCAAAGAAACGAACTCGTGTGTTGGCAA 
ATGAGAAAGTCAGATGGAGCCTGCACAATGCCCGGTTGCGGTTGGCTAAAAAGAAGAAGT 
ACTGCCAGTTTTTCACAAGATTTGGGAAATGCAACAAAGATGACGGAAAATGTCCCTATG 
TTCATGATCCCTCGAAAATTGCTGTTTGCACCAAATTTTTGAATGGATTGTGTGCAAATG 
CAAATTGCAAATTGACTCACAAGGTTTTCCTACTAAGTCATTGCTGCATAATTGTACTTA 
CAGAAATCTCTAACTGGATAACTTATTTCTTCCACAGGTCATTCCAGAAAGGATGCCTGA 
TTGTTCTTATTATCTGCAAGGTAAGAATTTCCACTGTACTAAGATCCCATTGCGGCTACT 
CACAATACTAATACCTATAATGCAGGCCTATGCAACAATGAGGCATGTCCATATAGGCAT 
GTGCATGTCAATCCGATCGCCCCTATATGTGATGGGTTTTTAAAGGGATACTGTTCCGAA 
GGAGACGAGGTAAGGATTCCACTTAAAATTGGCATCTAATACGTGTTGACATGCATATCC 
ACCTTTCCTTTGCACTGCTAGTGACTCTCTTAGTGCCCTTGATCCTATCTAATTCTTTTG 
ATTACTTCAGTAGCATATTAAGTATACTAATACCATAAGGAGTATAAGGGAAAGAGATCC 
CTCTCTGGCTTTATGTCATACATTTTTTTTCTCCATCTCAATTCGCAAACACATGATGAA 
GATTGCGGATTGTCTCTACATAATGGTCACAGTGTCGGAAGAAGCATTCCTACAACTGCC 
CGGTTTTCGAAGCCACTGGATCATGCTCTCAAGGATTGAAATGCAAGCTCCACCACCCCA 
AGAACCAAAGCAAAGGAAGAAAGAGAAAAAGAACAAACGAACCATCACAGAAAAATGCCC 
GTAGGCGTTACTTTAGTTCACTTCACAACATCCTTTCCGAGTCTGAGCCAATGGTATTCA 
ATAGGCGTTCTACTGACAGTGAAGTTTTTGGAATGGAAAGCCTCGATTTTATAACCCTTG 
GCACTGCTGAGTATGAAGCCGGTGATGACAATGATCCAGCCACCGTGCAATCTATCTCCA 
GTGACAGTGAATCACTAATCTCAATATACAATCTAATCACACCAGTAGCTCTGATGCAGT 
AAGAAGCATCAGTTTGTTTTGGTGAGTACAAAGGTAAGCTCAAGGGGATTCAGATTCGTC 
ACATTCAAGGATGAGAAATCCATGAAGGATGTGATCGAGGGATTGGCTGGACAAGAGCTC 
GATGGTCGCAGCATCACTGTGATAATGGCTCAGTTACGAGGAAGTGGTAGAGGTAGTGAG 
GATACAGCAGCAGTGGTGGCGGTTACTCAGGAGAAGGTGGTTGTGGCTATGGAGTTGGTG 
GTGGTTACTCAAGAGGAGGTGGTCGTGGCGGTAGAGGCGAAGGAGGATACAGCGGCAGTG 
TTGGCGGTTACTCAAGAGGTGGTGGTCGTGGCGGCAGAGGCGAAGGAGGATACAGCGGCA 
GTGTTGGCGGTGAGGAGGATATGGTGGTGGTCACGGAGGAAGAGGAGGTGGAGGATGGTT 
ATTCCGTATTGGTTCTGCCTCATCTGGGTTCTATGTGTTGTCTTTGGTTTTACTTTTGCT 
ACTTTGGATGTAACAGGTCGTGTGATTAAATTTGATATCTGGAAACGTAATGGTAAGTCA 
CTTTTCCTTGTCTAAATTAATA
>AT1G61010.1 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
CTAACTGAAATTGCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAG 
AAAGACGAAACATGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGC 
GAGATGGAGATCAACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCT 
GTGTTTACATGTCCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAAT 
CAAGCAAATGTGTTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGT 
TGTGCAGTTTGATTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTT 
CGATGAGATTGATCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTT 
CTTCCTCTTTTGGCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGT 
CTTGATTTGAATAGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACA 
AAAACAGAAGGATGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTA 
GGAGGCTAGAGTTTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAA 
GAGGTTTATTGGGTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATA 
TAGATCATGCAGCATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATG 
ATTTTGTTTTTTGGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTT 
TGATCAGACGACATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAA 
GCTGTTGCTTACAGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGA 
TGAACAAGACATCAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTAT 
GACTATGTTTATACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAAT 
CTGCTTCAAAACTGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATT 
GACTTCCATCAAACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCAT 
GTTTTGGGTGCAGCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGC 
GACTATTCCCGTGAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCT 
GACATATGCATCATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGT 
GAGAAACGCTTCACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATC 
CCGGCTTTTGCACTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCG 
AACCACCCAGATCTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGT 
ATGGCGGTTTACCAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCA 
AATTCTAATCCGTTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAAT 
GATGTCGGTCCATCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGG 
CAACTCTTTGACAGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATG 
GTGGAAGGTACACTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAAT 
GGTCTTACTGCTCCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGAT 
TACGCGCAGACGAGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCAC 
GGTGAAGCTAACGAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGA 
AACACAAAGATCATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAG 
AAATTGGCGAAAACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTA 
AGCGGGATTCTGGTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCAT 
GTTTTCTCACAGCTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGA 
GCTTTTGGTGTGATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACA 
GATGAGGAATCGGGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAG 
TCAGAGAAGCACATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGAC 
TCCATTGTAGCTCTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAA 
GAAGATGCTGTGAAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCA 
CTTCTTGTTTCGCTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGG 
GTCGATGGCAATGTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCA 
GGTCTTAAGGAAAGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATC 
CCTCTCTCAGCTTCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATA 
GAGTTTTATCCATCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGT 
CTAATGGATGTTATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGAT 
AATGATCAAGTCTTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCA 
TAAATCATTTTGCTG
>AT1G61010.1 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
CTAACTGAAATTGCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAG 
AAAGACGAAACATGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGC 
GAGATGGAGATCAACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCT 
GTGTTTACATGTCCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAAT 
CAAGCAAATGTGTTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGT 
TGTGCAGTTTGATTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTT 
CGATGAGATTGATCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTT 
CTTCCTCTTTTGGCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGT 
CTTGATTTGAATAGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACA 
AAAACAGAAGGATGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTA 
GGAGGCTAGAGTTTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAA 
GAGGTTTATTGGGTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATA 
TAGATCATGCAGCATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATG 
ATTTTGTTTTTTGGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTT 
TGATCAGACGACATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAA 
GCTGTTGCTTACAGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGA 
TGAACAAGACATCAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTAT 
GACTATGTTTATACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAAT 
CTGCTTCAAAACTGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATT 
GACTTCCATCAAACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCAT 
GTTTTGGGTGCAGCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGC 
GACTATTCCCGTGAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCT 
GACATATGCATCATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGT 
GAGAAACGCTTCACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATC 
CCGGCTTTTGCACTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCG 
AACCACCCAGATCTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGT 
ATGGCGGTTTACCAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCA 
AATTCTAATCCGTTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAAT 
GATGTCGGTCCATCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGG 
CAACTCTTTGACAGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATG 
GTGGAAGGTACACTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAAT 
GGTCTTACTGCTCCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGAT 
TACGCGCAGACGAGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCAC 
GGTGAAGCTAACGAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGA 
AACACAAAGATCATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAG 
AAATTGGCGAAAACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTA 
AGCGGGATTCTGGTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCAT 
GTTTTCTCACAGCTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGA 
GCTTTTGGTGTGATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACA 
GATGAGGAATCGGGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAG 
TCAGAGAAGCACATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGAC 
TCCATTGTAGCTCTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAA 
GAAGATGCTGTGAAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCA 
CTTCTTGTTTCGCTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGG 
GTCGATGGCAATGTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCA 
GGTCTTAAGGAAAGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATC 
CCTCTCTCAGCTTCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATA 
GAGTTTTATCCATCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGT 
CTAATGGATGTTATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGAT 
AATGATCAAGTCTTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCA 
TAAATCATTTTGCTG
>AT1G61010.1 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
CTAACTGAAATTGCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAG 
AAAGACGAAACATGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGC 
GAGATGGAGATCAACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCT 
GTGTTTACATGTCCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAAT 
CAAGCAAATGTGTTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGT 
TGTGCAGTTTGATTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTT 
CGATGAGATTGATCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTT 
CTTCCTCTTTTGGCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGT 
CTTGATTTGAATAGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACA 
AAAACAGAAGGATGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTA 
GGAGGCTAGAGTTTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAA 
GAGGTTTATTGGGTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATA 
TAGATCATGCAGCATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATG 
ATTTTGTTTTTTGGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTT 
TGATCAGACGACATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAA 
GCTGTTGCTTACAGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGA 
TGAACAAGACATCAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTAT 
GACTATGTTTATACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAAT 
CTGCTTCAAAACTGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATT 
GACTTCCATCAAACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCAT 
GTTTTGGGTGCAGCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGC 
GACTATTCCCGTGAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCT 
GACATATGCATCATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGT 
GAGAAACGCTTCACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATC 
CCGGCTTTTGCACTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCG 
AACCACCCAGATCTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGT 
ATGGCGGTTTACCAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCA 
AATTCTAATCCGTTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAAT 
GATGTCGGTCCATCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGG 
CAACTCTTTGACAGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATG 
GTGGAAGGTACACTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAAT 
GGTCTTACTGCTCCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGAT 
TACGCGCAGACGAGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCAC 
GGTGAAGCTAACGAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGA 
AACACAAAGATCATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAG 
AAATTGGCGAAAACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTA 
AGCGGGATTCTGGTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCAT 
GTTTTCTCACAGCTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGA 
GCTTTTGGTGTGATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACA 
GATGAGGAATCGGGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAG 
TCAGAGAAGCACATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGAC 
TCCATTGTAGCTCTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAA 
GAAGATGCTGTGAAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCA 
CTTCTTGTTTCGCTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGG 
GTCGATGGCAATGTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCA 
GGTCTTAAGGAAAGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATC 
CCTCTCTCAGCTTCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATA 
GAGTTTTATCCATCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGT 
CTAATGGATGTTATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGAT 
AATGATCAAGTCTTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCA 
TAAATCATTTTGCTG
>AT1G61010.2 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
GCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAGAAAGACGAAACA 
TGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGCGAGATGGAGATC 
AACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCTGTGTTTACATGT 
CCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAATCAAGCAAATGTG 
TTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGTTGTGCAGTTTGA 
TTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTTCGATGAGATTGA 
TCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTTCTTCCTCTTTTG 
GCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGTCTTGATTTGAAT 
AGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACAAAAACAGAAGGA 
TGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTAGGAGGCTAGAGT 
TTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAAGAGGTTTATTGG 
GTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATATAGATCATGCAG 
CATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATGATTTTGTTTTTT 
GGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTTTGATCAGACGAC 
ATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAAGCTGTTGCTTAC 
AGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGATGAACAAGACAT 
CAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTATGACTATGTTTAT 
ACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAATCTGCTTCAAAAC 
TGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATTGACTTCCATCAA 
ACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCATGTTTTGGGTGCA 
GCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGCGACTATTCCCGT 
GAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCTGACATATGCATC 
ATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGTGAGAAACGCTTC 
ACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATCCCGGCTTTTGCA 
CTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCGAACCACCCAGAT 
CTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGTATGGCGGTTTAC 
CAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCAAATTCTAATCCG 
TTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAATGATGTCGGTCCA 
TCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGGCAACTCTTTGAC 
AGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATGGTGGAAGGTACA 
CTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAATGGTCTTACTGCT 
CCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGATTACGCGCAGACG 
AGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCACGGTGAAGCTAAC 
GAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGAAACACAAAGATC 
ATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAGAAATTGGCGAAA 
ACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTAAGCGGGATTCTG 
GTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCATGTTTTCTCACAG 
CTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGAGCTTTTGGTGTG 
ATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACAGATGAGGAATCG 
GGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAGTCAGAGAAGCAC 
ATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGACTCCATTGTAGCT 
CTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAAGAAGATGCTGTG 
AAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCACTTCTTGTTTCG 
CTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGGGTCGATGGCAAT 
GTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCAGGTCTTAAGGAA 
AGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATCCCTCTCTCAGCT 
TCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATAGAGTTTTATCCA 
TCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGTCTAATGGATGTT 
ATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGATAATGATCAAGTC 
TTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCATAAATCATTTTG 
CTGATTCGTGCTTTTCCCATATGCATTTTTCTATCATTATGCTGATCTAGGATATGGAAG 
CAAAAGCTTTGTGGTGCATCAAGTTAAGAGGTTTCTAAAGTTAAAAAAGTACTAGGCTTC 
TTCCAGATTCTTTGTAAGACATATTAGTGAGCCTTGCTTTTGATATTTGCAGTTTCATGA 
ATACACGGTGTCGTTTGATGCGTTTCTACCAAGCCTCTAAAGTACAAGGCAGGTCTGATT 
GAGCTAAAGTAAGGTAGAAGAGAGATTGTAATGAGCACATTTTCTATTATTTTTCCACGT 
ACAAAGTATACATTATTCACATCAGTGAATGTCTCTTGACCTCTATGTTTTGGCAAGATG 
TCTAGTGCATCAAGATATTAAGACCAAATCTCTACAATATTAAAATGCTTAATTTTTTTT 
TT
>AT1G61010.2 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
GCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAGAAAGACGAAACA 
TGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGCGAGATGGAGATC 
AACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCTGTGTTTACATGT 
CCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAATCAAGCAAATGTG 
TTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGTTGTGCAGTTTGA 
TTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTTCGATGAGATTGA 
TCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTTCTTCCTCTTTTG 
GCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGTCTTGATTTGAAT 
AGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACAAAAACAGAAGGA 
TGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTAGGAGGCTAGAGT 
TTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAAGAGGTTTATTGG 
GTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATATAGATCATGCAG 
CATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATGATTTTGTTTTTT 
GGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTTTGATCAGACGAC 
ATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAAGCTGTTGCTTAC 
AGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGATGAACAAGACAT 
CAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTATGACTATGTTTAT 
ACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAATCTGCTTCAAAAC 
TGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATTGACTTCCATCAA 
ACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCATGTTTTGGGTGCA 
GCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGCGACTATTCCCGT 
GAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCTGACATATGCATC 
ATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGTGAGAAACGCTTC 
ACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATCCCGGCTTTTGCA 
CTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCGAACCACCCAGAT 
CTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGTATGGCGGTTTAC 
CAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCAAATTCTAATCCG 
TTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAATGATGTCGGTCCA 
TCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGGCAACTCTTTGAC 
AGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATGGTGGAAGGTACA 
CTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAATGGTCTTACTGCT 
CCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGATTACGCGCAGACG 
AGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCACGGTGAAGCTAAC 
GAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGAAACACAAAGATC 
ATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAGAAATTGGCGAAA 
ACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTAAGCGGGATTCTG 
GTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCATGTTTTCTCACAG 
CTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGAGCTTTTGGTGTG 
ATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACAGATGAGGAATCG 
GGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAGTCAGAGAAGCAC 
ATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGACTCCATTGTAGCT 
CTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAAGAAGATGCTGTG 
AAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCACTTCTTGTTTCG 
CTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGGGTCGATGGCAAT 
GTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCAGGTCTTAAGGAA 
AGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATCCCTCTCTCAGCT 
TCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATAGAGTTTTATCCA 
TCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGTCTAATGGATGTT 
ATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGATAATGATCAAGTC 
TTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCATAAATCATTTTG 
CTGATTCGTGCTTTTCCCATATGCATTTTTCTATCATTATGCTGATCTAGGATATGGAAG 
CAAAAGCTTTGTGGTGCATCAAGTTAAGAGGTTTCTAAAGTTAAAAAAGTACTAGGCTTC 
TTCCAGATTCTTTGTAAGACATATTAGTGAGCCTTGCTTTTGATATTTGCAGTTTCATGA 
ATACACGGTGTCGTTTGATGCGTTTCTACCAAGCCTCTAAAGTACAAGGCAGGTCTGATT 
GAGCTAAAGTAAGGTAGAAGAGAGATTGTAATGAGCACATTTTCTATTATTTTTCCACGT 
ACAAAGTATACATTATTCACATCAGTGAATGTCTCTTGACCTCTATGTTTTGGCAAGATG 
TCTAGTGCATCAAGATATTAAGACCAAATCTCTACAATATTAAAATGCTTAATTTTTTTT 
TT
>AT1G61010.2 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
GCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAGAAAGACGAAACA 
TGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGCGAGATGGAGATC 
AACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCTGTGTTTACATGT 
CCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAATCAAGCAAATGTG 
TTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGTTGTGCAGTTTGA 
TTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTTCGATGAGATTGA 
TCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTTCTTCCTCTTTTG 
GCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGTCTTGATTTGAAT 
AGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACAAAAACAGAAGGA 
TGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTAGGAGGCTAGAGT 
TTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAAGAGGTTTATTGG 
GTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATATAGATCATGCAG 
CATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATGATTTTGTTTTTT 
GGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTTTGATCAGACGAC 
ATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAAGCTGTTGCTTAC 
AGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGATGAACAAGACAT 
CAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTATGACTATGTTTAT 
ACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAATCTGCTTCAAAAC 
TGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATTGACTTCCATCAA 
ACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCATGTTTTGGGTGCA 
GCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGCGACTATTCCCGT 
GAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCTGACATATGCATC 
ATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGTGAGAAACGCTTC 
ACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATCCCGGCTTTTGCA 
CTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCGAACCACCCAGAT 
CTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGTATGGCGGTTTAC 
CAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCAAATTCTAATCCG 
TTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAATGATGTCGGTCCA 
TCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGGCAACTCTTTGAC 
AGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATGGTGGAAGGTACA 
CTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAATGGTCTTACTGCT 
CCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGATTACGCGCAGACG 
AGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCACGGTGAAGCTAAC 
GAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGAAACACAAAGATC 
ATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAGAAATTGGCGAAA 
ACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTAAGCGGGATTCTG 
GTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCATGTTTTCTCACAG 
CTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGAGCTTTTGGTGTG 
ATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACAGATGAGGAATCG 
GGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAGTCAGAGAAGCAC 
ATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGACTCCATTGTAGCT 
CTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAAGAAGATGCTGTG 
AAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCACTTCTTGTTTCG 
CTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGGGTCGATGGCAAT 
GTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCAGGTCTTAAGGAA 
AGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATCCCTCTCTCAGCT 
TCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATAGAGTTTTATCCA 
TCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGTCTAATGGATGTT 
ATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGATAATGATCAAGTC 
TTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCATAAATCATTTTG 
CTGATTCGTGCTTTTCCCATATGCATTTTTCTATCATTATGCTGATCTAGGATATGGAAG 
CAAAAGCTTTGTGGTGCATCAAGTTAAGAGGTTTCTAAAGTTAAAAAAGTACTAGGCTTC 
TTCCAGATTCTTTGTAAGACATATTAGTGAGCCTTGCTTTTGATATTTGCAGTTTCATGA 
ATACACGGTGTCGTTTGATGCGTTTCTACCAAGCCTCTAAAGTACAAGGCAGGTCTGATT 
GAGCTAAAGTAAGGTAGAAGAGAGATTGTAATGAGCACATTTTCTATTATTTTTCCACGT 
ACAAAGTATACATTATTCACATCAGTGAATGTCTCTTGACCTCTATGTTTTGGCAAGATG 
TCTAGTGCATCAAGATATTAAGACCAAATCTCTACAATATTAAAATGCTTAATTTTTTTT 
TT
>AT1G61010.3 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
GCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAGAAAGACGAAACA 
TGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGCGAGATGGAGATC 
AACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCTGTGTTTACATGT 
CCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAATCAAGCAAATGTG 
TTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGTTGTGCAGTTTGA 
TTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTTCGATGAGATTGA 
TCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTTCTTCCTCTTTTG 
GCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGTCTTGATTTGAAT 
AGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACAAAAACAGAAGGA 
TGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTAGGAGGCTAGAGT 
TTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAAGAGGTTTATTGG 
GTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATATAGATCATGCAG 
CATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATGATTTTGTTTTTT 
GGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTTTGATCAGACGAC 
ATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAAGCTGTTGCTTAC 
AGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGATGAACAAGACAT 
CAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTATGACTATGTTTAT 
ACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAATCTGCTTCAAAAC 
TGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATTGACTTCCATCAA 
ACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCATGTTTTGGGTGCA 
GCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGCGACTATTCCCGT 
GAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCTGACATATGCATC 
ATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGTGAGAAACGCTTC 
ACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATCCCGGCTTTTGCA 
CTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCGAACCACCCAGAT 
CTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGTATGGCGGTTTAC 
CAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCAAATTCTAATCCG 
TTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAATGATGTCGGTCCA 
TCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGGCAACTCTTTGAC 
AGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATGGTGGAAGGTACA 
CTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAATGGTCTTACTGCT 
CCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGATTACGCGCAGACG 
AGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCACGGTGAAGCTAAC 
GAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGAAACACAAAGATC 
ATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAGAAATTGGCGAAA 
ACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTAAGCGGGATTCTG 
GTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCATGTTTTCTCACAG 
CTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGAGCTTTTGGTGTG 
ATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACAGATGAGGAATCG 
GGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAGTCAGAGAAGCAC 
ATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGACTCCATTGTAGCT 
CTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAAGAAGATGCTGTG 
AAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCACTTCTTGTTTCG 
CTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGGGTCGATGGCAAT 
GTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCAGGTCTTAAGGAA 
AGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATCCCTCTCTCAGCT 
TCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATAGAGTTTTATCCA 
TCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGTCTAATGGATGTT 
ATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGATAATGATCAAGTC 
TTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCATAAATCATTTTG 
CTGATTCGTGCTTTTCCCATATGCATTTTTCTATCATTATGCTGATCTAGGATATGGAAG 
CAAAAGCTTTGTGGTGCATCAAGTTAAGAGGTTTCTAAAGTTAAAAAAGTACTAGGCTTC 
TTCCAGATTCTTTGTAAGACATATTAGTGAGCCTTGCTTTTGATATTTGCAGTTTCATGA 
ATACACGGTGTCGTTTGATGCGTTTCTACCAAGCCTCTAAAGTACAAGGCAGGTCTGATT 
GAGCTAAAGTAAGGTAGAAGAGAGATTGTAATGAGCACATTTTCTATTATTTTTCCACGT 
ACAAAGTATACATTATTCACATCAGTGAATGTCTCTTGACCTCTATGTTTTGGCAAGATG 
TCTAGTGCATCAAGATATTAAGACCAAATCTCTACAATATTAAAATGCTTAATTTTTTT
>AT1G61010.3 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
GCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAGAAAGACGAAACA 
TGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGCGAGATGGAGATC 
AACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCTGTGTTTACATGT 
CCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAATCAAGCAAATGTG 
TTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGTTGTGCAGTTTGA 
TTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTTCGATGAGATTGA 
TCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTTCTTCCTCTTTTG 
GCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGTCTTGATTTGAAT 
AGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACAAAAACAGAAGGA 
TGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTAGGAGGCTAGAGT 
TTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAAGAGGTTTATTGG 
GTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATATAGATCATGCAG 
CATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATGATTTTGTTTTTT 
GGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTTTGATCAGACGAC 
ATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAAGCTGTTGCTTAC 
AGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGATGAACAAGACAT 
CAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTATGACTATGTTTAT 
ACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAATCTGCTTCAAAAC 
TGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATTGACTTCCATCAA 
ACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCATGTTTTGGGTGCA 
GCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGCGACTATTCCCGT 
GAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCTGACATATGCATC 
ATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGTGAGAAACGCTTC 
ACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATCCCGGCTTTTGCA 
CTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCGAACCACCCAGAT 
CTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGTATGGCGGTTTAC 
CAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCAAATTCTAATCCG 
TTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAATGATGTCGGTCCA 
TCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGGCAACTCTTTGAC 
AGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATGGTGGAAGGTACA 
CTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAATGGTCTTACTGCT 
CCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGATTACGCGCAGACG 
AGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCACGGTGAAGCTAAC 
GAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGAAACACAAAGATC 
ATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAGAAATTGGCGAAA 
ACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTAAGCGGGATTCTG 
GTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCATGTTTTCTCACAG 
CTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGAGCTTTTGGTGTG 
ATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACAGATGAGGAATCG 
GGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAGTCAGAGAAGCAC 
ATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGACTCCATTGTAGCT 
CTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAAGAAGATGCTGTG 
AAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCACTTCTTGTTTCG 
CTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGGGTCGATGGCAAT 
GTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCAGGTCTTAAGGAA 
AGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATCCCTCTCTCAGCT 
TCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATAGAGTTTTATCCA 
TCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGTCTAATGGATGTT 
ATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGATAATGATCAAGTC 
TTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCATAAATCATTTTG 
CTGATTCGTGCTTTTCCCATATGCATTTTTCTATCATTATGCTGATCTAGGATATGGAAG 
CAAAAGCTTTGTGGTGCATCAAGTTAAGAGGTTTCTAAAGTTAAAAAAGTACTAGGCTTC 
TTCCAGATTCTTTGTAAGACATATTAGTGAGCCTTGCTTTTGATATTTGCAGTTTCATGA 
ATACACGGTGTCGTTTGATGCGTTTCTACCAAGCCTCTAAAGTACAAGGCAGGTCTGATT 
GAGCTAAAGTAAGGTAGAAGAGAGATTGTAATGAGCACATTTTCTATTATTTTTCCACGT 
ACAAAGTATACATTATTCACATCAGTGAATGTCTCTTGACCTCTATGTTTTGGCAAGATG 
TCTAGTGCATCAAGATATTAAGACCAAATCTCTACAATATTAAAATGCTTAATTTTTTT
>AT1G61010.3 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
GCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAGAAAGACGAAACA 
TGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGCGAGATGGAGATC 
AACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCTGTGTTTACATGT 
CCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAATCAAGCAAATGTG 
TTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGTTGTGCAGTTTGA 
TTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTTCGATGAGATTGA 
TCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTTCTTCCTCTTTTG 
GCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGTCTTGATTTGAAT 
AGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACAAAAACAGAAGGA 
TGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTAGGAGGCTAGAGT 
TTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAAGAGGTTTATTGG 
GTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATATAGATCATGCAG 
CATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATGATTTTGTTTTTT 
GGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTTTGATCAGACGAC 
ATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAAGCTGTTGCTTAC 
AGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGATGAACAAGACAT 
CAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTATGACTATGTTTAT 
ACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAATCTGCTTCAAAAC 
TGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATTGACTTCCATCAA 
ACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCATGTTTTGGGTGCA 
GCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGCGACTATTCCCGT 
GAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCTGACATATGCATC 
ATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGTGAGAAACGCTTC 
ACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATCCCGGCTTTTGCA 
CTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCGAACCACCCAGAT 
CTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGTATGGCGGTTTAC 
CAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCAAATTCTAATCCG 
TTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAATGATGTCGGTCCA 
TCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGGCAACTCTTTGAC 
AGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATGGTGGAAGGTACA 
CTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAATGGTCTTACTGCT 
CCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGATTACGCGCAGACG 
AGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCACGGTGAAGCTAAC 
GAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGAAACACAAAGATC 
ATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAGAAATTGGCGAAA 
ACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTAAGCGGGATTCTG 
GTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCATGTTTTCTCACAG 
CTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGAGCTTTTGGTGTG 
ATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACAGATGAGGAATCG 
GGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAGTCAGAGAAGCAC 
ATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGACTCCATTGTAGCT 
CTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAAGAAGATGCTGTG 
AAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCACTTCTTGTTTCG 
CTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGGGTCGATGGCAAT 
GTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCAGGTCTTAAGGAA 
AGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATCCCTCTCTCAGCT 
TCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATAGAGTTTTATCCA 
TCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGTCTAATGGATGTT 
ATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGATAATGATCAAGTC 
TTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCATAAATCATTTTG 
CTGATTCGTGCTTTTCCCATATGCATTTTTCTATCATTATGCTGATCTAGGATATGGAAG 
CAAAAGCTTTGTGGTGCATCAAGTTAAGAGGTTTCTAAAGTTAAAAAAGTACTAGGCTTC 
TTCCAGATTCTTTGTAAGACATATTAGTGAGCCTTGCTTTTGATATTTGCAGTTTCATGA 
ATACACGGTGTCGTTTGATGCGTTTCTACCAAGCCTCTAAAGTACAAGGCAGGTCTGATT 
GAGCTAAAGTAAGGTAGAAGAGAGATTGTAATGAGCACATTTTCTATTATTTTTCCACGT 
ACAAAGTATACATTATTCACATCAGTGAATGTCTCTTGACCTCTATGTTTTGGCAAGATG 
TCTAGTGCATCAAGATATTAAGACCAAATCTCTACAATATTAAAATGCTTAATTTTTTT
>AT1G79890.1 |  helicase-related 
ATGACGGAGATACGAGAGTTCCCGGCGTTTCCATACAAGCCGTACTCGATCCAGATCGAT 
TTCATGAATGCGCTCTATCAATTTCTCGATAAGGGAGGCGTCTCCATGCTCGAAAGCCCC 
ACTGGTATATATATATATTTTTTTTTCCACATTGGATCAGTTATTACTCAGTAGTAAGTA 
AGTAGACTCACTTAGGGTTTGATCTCTCTCTCTCTTTCTCTCTCTCTTAGGGACTGGAAA 
ATCTCTAAGCATTATCTGCAGTGCTCTCCAGTGGCTTACTGACCGCAAGGAGAAACGAAA 
CTCAGGATTGACCGAAGAATCCCATAAGGTTGATGGAAACGATGATGAGGACGAGCCCGA 
TTGGATGAGGAATTTTACTCTCAACGAAGCAGATGGAGCCAATGGTGACAAGAGCATCAA 
AAACACCAAATCCCCATTTTCTCTCAGGAAGCATGCTAAGGAAGTTTTCACGGAAGGGGA 
AAAGGCTGATGAGCTAAACGATCAAGAATTTTTGTTGGATGAATACGAAAGCCAAGATGA 
ATCATCTCCGGGCGGAGGCAACTCTAAAAGAAAACCTGCCCGAGGTTTTGACAGTAGTTC 
ATCAGAGGATGAGGAAGATGAGAATGACTGCTCGGATGACGAACAAGGAGGCTTCAAGGT 
TTTCTTTTGCAGCCGCACACATTCACAGCTTTCCCAGTTTGTCAAGGAGTTGAGAAAGAC 
TGTCTTTGCCAAAAAACTCAAAGTTGTGTGTCTCGGCTCCCGAAAGAACTTGTGCATAAA 
CGAAGGTGACCCACCATTTCTCCTTGTTCTTTTTCATTGTTTGCTTCGTATTTACTTACA 
CTTACCATAGCTCATGTACAGATGTTCTTAAGCTTGGGAATGTGACCCGAATCAACGAGA 
GGTGCTTGGACTTGCAAAAGAAGAAGATATCTCAAGTCTCTAAAAAGAAGGTACACTTTA 
TCAACTTGTTTTATGAGATGATTTATCTATATATAAAAGTGTGTTCCGTCTCGCATTGCT 
GGTAGCCTCTGAATTCTGAATCAAAGCTTCCAAATTAAATGAATATCTGCTTGTTTCGTC 
ATTGTTAATGGTCATTTAGCTAAGTAGAGTAAAAGTAAGATTTTTGCTAACTAATGGAAG 
CTTCAACATTTCAGAATTTAGGTGCAAATGTAAGAATAGTACGAACCAAAGCTTCTTGCA 
GATGCCCAATGCTTAGAAAACATAAACTACAGAGAGAATTCAAGGCTGAGAGTTTTCAAC 
AAGAAGCCATGGACATTGAGGATCTTGTTCAGCTTGGACGAGAGATGAGAACTTGTCCAT 
ACTACGGTTCTAGAAGAATGGCCCCGGCAGCTGATCTTGTTATTCTTCCATATCAATCTC 
TTCTATCAAAGTCGTCACGAGAATCTCTTGGCCTAAGCTTGAAAAATAGTGTTGTTATCA 
TAGACGAGGCTCACAATTTGGCTGACACTCTTCTCAGTATGCACGATGCAAAACTAACAG 
TGTCACAGGTATAAATTTCAGTTTCATCAGCTTTCTGAGCACATGTTGTTTGGATGGACT 
TTTGCATTGCTATTGGGTTCTCTGTGTCAGGCCATACGTGGAGTCATGTTTTTAAATGAT 
TTGTATTGCAGTTGGAGGATATACATTGCAGCATAGAGAGTTATCTGGGAAGATTCCAGA 
ATCTCTTGGGAGCTGGAAACAGGAGATATATCCAAATTATGTTGATTCTTACCCGAGCTT 
TCCTCAAACCTCTTGCTAGTGATAGGAATCTGAGTAGCGTAAATGTTGGTCTTGATACTG 
AAAACCCCTCTAAAAGCAAGCCTTGTGGTGCTTGTTCAATGGCAATATATGACTTTTTGT 
TTTCTCTCAATATAGACAATATAAATTTGGTCAAGTTACTCGCCTATATAAAGGAAAGCA 
ATATCATTCATAAGGTGAATTGGTTCTTAATATTTTCCCCTTTCGCTTGTCCAACATTTT 
TCTCCTGTCCATTTCCCTTTTTTTAACTTTGCTAGTCAACTGTGCGTCCAGGTCAGTGGA 
TATGGAGAGAGAGTCGCTGCTATGTTGCAGAAAGATCCAGTGGCTCATGAAGAAATGAGC 
AAGTTAACAAGTTTTAGAGCGTTTTCTGATATGTTGGTGGCGCTCACTAATAACAATGGT 
GATGGGCGGATAATAATCTCAAGGACGAGTTCGTCTACCTCTGGCCAACATGGAGGGTAC 
ATTAAATATGTCATGCTCACTGGAGCGAAGTTATTTTCAGAGGTTGGCCCTTTCATACAT 
GAGTTTCTTTATCTCTGAGTTCAACAATGTAATAGTTAATCAAACCAATTTGTAGGTGGT 
GGATGAAGCGCATGCTGTCATATTGGCCGGTGGGACTCTTCAACCTATAGAAGAGACAAG 
GGAACGACTCTTTCCATGGCTACCATCAAATCAGCTGCAGTTCTTCTCATGTAGTCACAT 
TGTTCCTCCTGAGAGCATAATGCCAATTGCAGTTTCACATGGTCCTTCTGGTCAGTCTTT 
TGACTTTAGCCACAGTTCAAGAAGCTCAATAGGAATGGTGAGTAATCCAAATGACGCTCG 
TTTTCTCACATGTTTCTTTCCTTTAACATTAATGAGATTCAGAAAGAGTATTGAGAGTAA 
CCTATGATTTTGACTTTCTGGGTATGGTTGGCAGATACAGGAGTTAGGACTCTTAATGAG 
CAACCTTGTGGCAGTGGTTCCTGAAGGAATTATCGTCTTCTTCTCCTCCTTTGAGTATGA 
AACACAGGTGCACACAGCGTGGAGTAACTCAGGGATACTCAGAAGAATAGTGAAGAAGAA 
GCGTGTGTTCAGAGAACCCAGGAAAAACACTGAAGTAGAAGCTGTTCTCAGAGATTACAA 
GGAAGCGATAGAAAGCGAAAGAGGGGCAATAATGCTAGCTGTGGTTGGTGGGAAGGTGTC 
AGAAGGAATCAACTTCAGCGACAGCATGTGTCGGTGTGTTGTGATGGTTGGTTTGCCGTA 
TCCCAGCCCGTCTGACATAGAGTTGTTAGAGAGAATAAAGCATATAGAAGGTCGTGCAGA 
TTCAGATTCCATAAAACCTTCTGTGACTTTGGTTGATGATTCTTACTACAGTGGAGATGT 
TCAAGCAGGATTTGGCGTGTTAAAGAGCTGCAAACGGAGAGGGAAAGAATACTATGAAAA 
TCTGTGTATGAAAGCAGTTAACCAATCAATCGGTGAGTTTGTGGTTTCAACTATATGTGA 
CGATATAAGTGGAGGTTGTGTTTTATTAATTGATAATGGGACTGAAACAGAATGTTCTTC 
CCGGCTTGTTTTTCAGGTAGGGCAATCAGACACGAAAAGGACTATGCATCCATTTTACTG 
GTAGATGCTCGATATTCTAATGATCCATCCAAAAGAACATCTCATTCTCATCCATCCAAC 
AAGCTCCCAAAGTGGATCAAAGATCGTCTTATTTATTCCACCAAAGGCTATGGAGATGTT 
CACAGACTGTTGCACCAATTCTTTAAACATAAAAATGTTGAAAATTCATCCGAAACCAAT 
CAGCATTAG
>AT2G39840.1 |  TOPP4 protein serine/threonine phosphatase 
CGTTTCTGATACTTTAATTAATACTCATTGAAAAAATCAATTCGAACTAAAAAAAATCTC 
GAAAGTCTTTGCGCGTAATTTTCTTCTTTATTTTGTTCTCACTGATTATTTTGCATTAGC 
TCTTTTCTTTTTTGGGGTCGAAAAAATTAGGTTTTTTTTTGGGATTCTGTTGATGGCGAC 
GACGACGACGACGCAGGGGCAGCAAACGGCGATTGACTCGGCGGTTCTCGATGATATAAT 
CAGGCGACTCACGGAGGTCCGGTTAGCTAGACCAGGAAAGCAAGTCCAGCTCTCTGAAGC 
TGAGATCAAACAGCTCTGTACTACAGCTAGAGATATTTTCCTTCAGCAACCCAATTTACT 
TGAGCTTGAGGCTCCCATCAAAATCTGTGGTATCTTCCCAATTTGATTCGTTGATTTTAA 
TAATTTCGTCGGAATTGATTTTAGGGTTCTTATTGTGTTTCTTAGATTTTCCAAAAGTGT 
GAACTTGGTTAGGTTTTGGGGATAAAGTTGTTAGACCATTGTGAGACCTTTTTGTTTGAT 
GTTGTGAAGTGACTAGAATCTGAGTGAGAAATGTTTTGGCTTTTTGTGGATAATGATTGA 
GTGGAGAGGCTTATCTTGTTGCTTATGATACTGTGTGTGTTCATGAAAAATCCTATCCCG 
TTCTGTGATTTCCTTATGGTTTGTGGTGTACATGTCTTAAACCAGGTGACATACATGGGC 
AATATAGTGATTTGTTGAGGCTATTTGAGTATGGTGGCTTCCCTCCTAGTGCCAATTATC 
TATTTCTTGGGGACTATGTGGACAGAGGCAAACAGAGTCTTGAAACAATATGTCTCTTAC 
TAGCTTACAAGATCAAATACCCTGGCAACTTTTTTCTACTAAGGGGAAACCACGAATGTG 
CTTCTATCAATAGGATATATGGATTTTATGATGAGTGTAAAAGGAGGTTCAATGTGAGAG 
TATGGAAGGTTTTTACTGATTGTTTTAACTGCCTTCCTGTTGCGGCGCTTATAGATGACA 
AAATATTGTGTATGCACGGTGGACTTTCGCCGGATCTTGACCATTTGGATGAGATTAGAA 
ACTTGCCGAGACCAACTATGATTCCGGATACCGGGCTTCTCTGTGATTTGCTCTGGTCTG 
ATCCTGGGAAAGATGTTAAAGGATGGGGAATGAATGATAGAGGTGTTTCATACACCTTTG 
GTCCAGATAAAGTTTCCGAGTTTCTTACGAAACATGATTTAGATCTTGTGTGTCGTGCCC 
ATCAGGTAGATATTTTTCAATCATGTCTCTTTGATACTACTGCTTTTGTGATGTTAACAA 
GGGAGTTGGATTTTTTATGGCAGGTCGTGGAGGATGGGTATGAGTTCTTTGCTGATAGAC 
AACTTGTGACGGTGTTTTCAGCTCCTAACTACTGTGGTGAATTTGATAATGCTGGTGCGA 
TGATGAGCGTGGACGAGAACCTTATGTGCTCGTTTCAGATTTTGAAGCCCGCTGAGAAGA 
AGACCAAGTTCATGATGTCCACAAAGATTTGATACTTTCATTGAGGTTAGTCAATAGTCT 
GTCCTTGGCGGAAACCAAAACGAAACTAGTGAATGAAAGGATTCTCTTGCACTGATTTGT 
TCATGTTATTCATTACAAAGTCAAGTTCACATTTCTGTTGAACATGATTTCTTTTGGATT 
CTTCCAGGCTAAACTTTTTACTTAAATGGGTCTTGATTTCGGCTTTTCCTTCTTTCACAG 
ATGGATTTGGTCTTTCTTGAGAAATTGATTGAAACCATTGAAGATTTGGCTGTGAAGTGT 
GTACTTATGGTAGTGAGAACTCTTGGAAAGGAGCAAGACCTTCTTAGTCTTCTAATCTCT 
TTCTTCCCCCAAATTCACTTTCAGCATTTTTTTTCTATCTTCTTTTATGGGTTTTACATG 
ATTTTCATCTGCCTGTTGGGATCACATAGTTGGTGTGTACATGCATATGGTCGTTTCTTG 
GATTTTAGGACACCAAATGAAAATGATGTTATAAAAAAGGTTTAGTATGATG
>AT4G04885.1 |  PCFS4 (PCF11P-SIMILAR PROTEIN 4) zinc ion binding 
ATCTCTCTCTTCCCCCACAAGGGTGGCGATTCGAGGAGTTTCCATGGTGGAACAGAAACC 
CTAGAGCCTTTATGCTGCCACTAATTATCACTCTTCACTATTGAATTGGGGATGGACTCA 
GAGAAAATCCTCAATCCAAGACTTGTTTCGATTAATAGCACCAGCCGCAAAGGTATGTCC 
GTTGAGTTGCCGCAGAAACCGCCGCCACCGCCGTCGTTGTTAGACCGGTTTAAAGCTTTG 
CTTAATCAGCGTGAAGATGAGTTCGGTGGTGGTGAAGAGGTTTTGCCTCCGAGTATGGAT 
GAGATTGTTCAGCTTTATGAGGTTGTTTTGGGTGAGCTTACTTTCAATTCTAAGCCTATT 
ATCACTGATCTCACTATTATCGCTGGTGAACAACGGGAACATGGTGAAGGAATCGCTAAT 
GCTATTTGCACTCGAATCCTTGAGGTTTGCTTTCTTCTTATTTGTTTCCACTTTCTAGCC 
TTATTGTATAGTATGTAAGTGTAGAAGTGGGAAAAAAATTAGGTTTTTGATTGTCAGAGA 
TTAGTGTTTGGTTTGTGGTTTAGTGAAATGGCTGCTTCTGAGTTACCTGTGGGTGTATAT 
ATGCAGGCTCCTGTTGAGCAAAAGTTGCCATCTCTGTATCTTTTAGACAGCATTGTTAAG 
AACATTGGGCGGGATTATGGTCGCTATTTCTCATCCCGTCTACCCGAGGTGAGCAGTCTA 
CAAGAAGATGTTTACTTAAATGATTTGAATAGGGCTGAAGCATACCCATGAGCTGTTTTG 
ATCCTATTCTGCTTTAGGTCTTCTGCCTTGCATATAGGCAAGCACATCCGAGTTTACATC 
CGTCAATGCGTCACCTGTTTGGGACTTGGTCGAGTGTTTTTCCACCACCTGTACTACGCA 
AGATTGATATGCAATTGCAACTTTCATCTGCAGCAAACCAATCTTCCGTAGGGGCTTCTG 
AGCCTAGTCAACCAACGAGAGGTATACATGTTAATCCAAAATATCTTCGCAGGCTGGAGC 
CCTCAGCCGCCGAAAATGTAAGCCTTTCTCTTTGTCATTATGAACAGAGATGACATTCTT 
TTTTTAGGTGCATCTGCAACCTTGAAGCTATGGTGTGTTAATTTTATATAAGTGTACTAA 
GTAAAACGGGTATTAGATTAGTTTGGCCTCATAGTGGTCTTATCCATTGTATTTCTTTAA 
AGTTTTGTTAGTTAGACGAGATAGATGTTTACATTCTTCAAGTAATCAATCTTGACTGGA 
AGGGAGTTGTTGTTATGGCCTCTCTCAGTTATACATGATGAGTAGGTCACTGGGACTCTG 
GTACATTAGAAATGATCTTGTTAGCACATGTAGAGGGTTTTTTTTTGGTTATAGTACAGT 
AGATCACTGTTTATGCATCATGTGTCGTTTGGAACTGTTTTTATATGTTTTTTTTCAAAG 
AGTGACTATACCTGAGATGCATATTTCCTTAATTGCTCTTGCTTGACATGCAGAATTTGA 
GAGGAATTAATTCCAGTGCAAGAGTTTATGGCCAAAATTCACTCGGTGGGTATAATGATT 
TCGAAGATCAGTTAGAGAGCCCATCTTCACTGTCTAGTACACCAGATGGTTTTACCAGGA 
GGTCTAATGATGGAGCTAATCCTTCTAATCAAGCTTTTAACTATGGAATGGGTCGAGCTA 
CTAGCAGAGATGATGAACATATGGAATGGCGAAGAAAGGAAAACTTAGGCCAAGGAAATG 
ATCACGAAAGACCTAGAGCGTTGATAGATGCATATGGAGTTGACACCAGCAAACACGTAA 
CGATCAATAAACCAATTCGCGATATGAATGGCATGCACAGTAAGATGGTTACACCATGGC 
AGAACACTGAGGAAGAAGAGTTTGATTGGGAAGATATGAGCCCTACCCTAGATCGTAGCA 
GAGCTGGTGAATTTTTGCGATCATCTGTACCAGCATTAGGAAGTGTAAGGGCAAGACCCA 
GAGTAGGAAACACAAGTGATTTTCATTTAGATTCTGACATTAAGAATGGTGTAAGTCATC 
AGCTACGAGAAAATTGGAGTTTGTCACAAAATTATCCACATACATCCAACCGTGTTGATA 
CAAGAGCAGGAAAAGACTTGAAAGTATTGGCTTCATCTGTAGGGTTAGTTTCATCAAACA 
GTGAATTCGGGGCTCCTCCATTTGATAGCATTCAAGATGTTAACTCACGTTTTGGCCGGG 
CTCTTCCTGATGGGACATGGCCCCATTTGAGTGCTAGAGGACCCAACTCTCTCCCTGTAC 
CTTCTGCTCATTTGCATCATTTGGCAAATCCCGGTAATGCGATGTCAAATCGCTTGCAAG 
GTAAGCCTTTATATAGGCCCGAAAACCAGGTCTCTCAGAGTCATCTTAATGATATGACTC 
AACAGAATCAGATGCTAGTTAATTATTTGCCATCCTCATCTGCTATGGCTCCAAGGCCAA 
TGCAATCGTTGTTAACCCACGTAAGTCATGGGTACCCTCCACATGGGTCAACCATTAGAC 
CATCTTTATCAATCCAAGGTGGGGAAGCCATGCATCCTCTTTCTTCAGGAGTTTTATCTC 
AGATAGGAGCCTCTAATCAACCACCAGGTGGCGCATTCTCTGGTCTGATTGGCTCTCTCA 
TGGCTCAAGGTTTGATCTCATTGAACAATCAGCCTGCTGGTCAGGTAATTATTCAAATCA 
TGTCCTTGAGAGTCGGTTTGTTCTTAGTTATTGCTTTATCTTGAATTGTTGGTTTATATA 
TTCAGGGACCATTGGGGTTGGAGTTTGATGCAGACATGCTCAAGATACGTAATGAGTCTG 
CAATCAGTGCTTTATATGGGGATCTCCCGAGGCAATGCACAACCTGTGGTCTACGCTTCA 
AGTGCCAAGAAGAGCACAGTAAGCACATGGATTGGCATGTAACCAAGAACAGGATGTCCA 
AGAACCATAAGCAGAACCCTTCTCGGAAATGGTTTGTAAGTGCTAGCATGTGGCTCAGTG 
GTGCAGAAGCACTTGGAGCTGAAGCAGTACCAGGGTTCTTGCCCACGGAGCCAACAACAG 
AAAAGAAGGATGACGAAGATATGGCAGTTCCTGCAGATGAAGACCAAACTTCATGTGCAT 
TATGTGGTGAGCCATTTGAAGACTTTTATAGTGATGAAACCGAGGAATGGATGTACAAAG 
GTGCGGTATACATGAATGCTCCTGAAGAATCAACAACAGATATGGACAAGTCTCAGTTAG 
GTCCTATAGTGCATGCAAAGTGCAGGCCAGAGTCCAATGGGGTAAGCCATTCCATGCATT 
TTCATTAGCTTCATTTGTGTCTAGTTGAATCCATTTTCATTTTCGCTGCTAGACATTTAT 
CCAGTGACGACCTCTTGATTTCCCGATCATGGCTTTTTCAGGGTGATATGGAAGAGGGTA 
GTCAGAGGAAAAAGATGCGGAGTTAGATCCCTTAGACCGAATTTTAGGTCTTTTTCTTGA 
CTACATTTAAGTTACATTCTTATTTCTTCATCATCTATATGCACTTAGTCACAGAATACC 
ACCAATGAAGAGAAATGATGGAGAGAGTCTTCTTTCTCCTAAAACTGTACCATTGAAAAA 
AAGAGGTTTACACCCACATATATTATCATTCTTTATGCCTCTAAATTCCTGTTGTGCCTT 
AGGACATGGATATCGTGTAACTGTTCTGCATTCTCTGCTACACCTAACCTGGGGTGCTTG 
TAGTAGTAAAATCAGATGTCGCAACAGTAGTTTCCCCATGTAAATGGAATACAATGTCTC 
TGTTTCGGATTGTCTTTTTCTTTTTCATCTTTAGATATTGCAGGGAAAGCCCGAGAAGAC 
TGATATTCGAATGTGAACAGATTTCTTATGATGAATGGATCTCATAGATGCTGTTGCTAA 
GAGAACCAGTTTCAGGTTTCTTCTTTAGAGCTTTCCCTGTCTGAGTTTTACCTTTCTATG 
TTAGGCTGTTAGCTAAAAATGTTAGTTAACATAACTCTCTTTAAGCGTAT
>AT5G13480.1 |  FY protein binding 
GCTCTTGGGTTGTCATCAATTCGCGAATTTGATACACGCACACCCTAAAGAGAGATCCAC 
GCTCGTTTCAAGGTAACCTAAATTCGAACACTTTCGCAGTTTCCCTTCGATTCGAATAAA 
TCACTGTTCTCCGTGGGCAACAATGTACGCCGGCGGCGATATGCACAGGGGTTCACAGAT 
GCCACAACCACCGATGATGCGGCAGTCGTCAGCTTCTTCCACTAACATCAATCCCGACTA 
CCACCACCCATCTGGCCCCTTCGACCGTAAGTAGACTTTGAGCGTCTTCCTTTTATCGGA 
TTAGTGATGACTGTGAGATTTAATGTCTCTCTGTCTGATGTTGCAGCCAATGTAGACAGT 
TTTGGGGCGAAACGAATGAGAAAGCATACACAGAGAAGAGCTGTTGATTACACCAGCACC 
GTTGTTAGATATATTCAGGTAATGTATTCCCATTGCTGCTCACAGTATTTCTTTGTTAGA 
ACCTTTTGTACTGCTTGATTATATTTCTCTTGTTTTCTGTAAAGTTTTAGTCTTGGTCTA 
TATACTCATAGCCTCTGCTTTCCCCAGTTGAATTCTTCGGTCCTTTTTATCTCAAAAGCC 
ATTAGATAGGATTGTCTTTATGTCATGGAACTGATATGGATATGTAGTTCAACGAACTCA 
TACTTTATATGGAACTAAAAGTAGAGAGTGTTTACTCCATATATGTTTTTGTTCAGGCTC 
GAACATGGCAGCGAGACTCAAGGGATAGGACCACTCTGCAACCAACCCCAGCTGCAGCAG 
TTGATGTTAGATTTCTTTGCTTTTCTGGGTTTTGCAATAAGATTGAATGGTTTACTGATC 
TAACTTTTATATCAATGCTTCAGATGCTTCCCACAGTTGCCTATTCGGATAATCCTTCAA 
CAAGCTTTGCTGCAAAGTTTGTTCACGCATCTCTAAACAAGAACCGTTGTTCAATCAACC 
GTGTATTGGTATATCCCTCTACCAGCTGTGTGTTTTGTATTATTCTCTGTTTGCCATGTT 
TATCTATTCAAGAAAGCAACATCTTTCTTTCTTTGTTTTAACTCTATTATGCCAACTTAA 
TGGGATCATTGCTGATTGGGTTTCTTTTATTTAGTGGACACCTTCAGGAAGACGTCTTAT 
CACGGGCTCCCAAAGTGGGGAGTTTACTCTTTGGAATGGGCAATCTTTTAATTTTGAAAT 
GATTCTTCAGGTTCGTTTCTCAGATTGTATAACTAATCTGTTGAAACTTCTGTTTTGATT 
CTTCTATAGTTGCTGCTCCTGGTATTGACTGTTTAAATTTGTTGTCAATATCAGGCACAT 
GATCAACCTATTAGGTCGATGGTATGGAGCCACAATGAAAATTATATGGTTTCTGGTGAT 
GATGGAGGCACATTAAAGTAAATTTGTTTTTCCCTTTCAGTCCCTAACTTATGATGTTGT 
AAACGAGAAGCTCAGAATTCTATGATTCAAATGCTGTGACAATAAGGATCAATTGTTTCT 
TATGTATCAGGTATTGGCAGAACAATATGAACAATGTGAAAGCCAATAAAACTGCTCACA 
AGGAATCAATTCGCGATTTAAGGTAAAAAAAAGTTTGATATGTTGAATTGCATTAAATGA 
ATCTCTCAAAACTGAACAATGTGTATCCAACAGTTTTTGTAAAACAGATTTGAAGTTCTG 
TTCGTGTTCTGATGATACGACTGTTAAAGTCTGGGATTTTACCAAGTGCGTAGATGAAAG 
CTCATTAACCGGTAATGTTATTTGAACAGATTGGCGGCAGATACTTTATTTCTTTGTTGC 
TTGCTCTTCTAATTTGAATTTAGAAGGCCGCTTGAGATGTGCTGTACGTTATTAGAATTG 
GATTCTTAGGCTACATAGGAAAAGGTGTCATTGAGATTCGCTTTGGTGTCATGCCATGTA 
ACGTTAGTTAGTTTTAAAGGTTCCAAATTGGTGCTTATAACAAGTTTCCTATCCTTTTGG 
AGGCATGTTTTCACAGTTTTCTTCATATTTGTAATATTTGAGAACTTTCGAAGTAATCAA 
AGGGTTCTTTATATTTTGAACTCAGGCAGGCCATGGTTGGGATGTCAAGAGCGTTGACTG 
GCACCCCACAAAGTCCCTACTAGTTTCTGGTACATTATTTTATAGACTTCTATTTGAATA 
ATGCAATAAAAAGAAACCGCTGTATATTTCAGAGCTTCTCTATGGCTGATCATTAACCGC 
TTTAATCTGTGTTGTCAGGTGGAAAAGACCAACTTGTCAAACTCTGGGATACTAGATCTG 
GGAGAGAGCTTTGCTCACTGTAAGTAGTACATAATGTAATATGTAATTTTATTATAGTTT 
CATGTTCAAAGCTTTGACGAATTTGATGGCCTATTCTTACTTCTGCAGCCATGGTCACAA 
AAACATAGTACTTAGCGTGAAGTGGAACCAAAATGGCAATTGGCTTTTAACGGCCTCGAA 
AGATCAGATAATTAAGGTAAGTCTCACTTTCTTTTGGGTGGGGGGGGGGGGGGGGGATAT 
TGATTTGTAAATGAGATTTTTTCCTTGCATTATGGAAGCATTTGTATGACACTTATGCAT 
GTAATCTGCAGCTGTATGATATAAGGACTATGAAGGAGCTTCAATCCTTTCGTGGGCACA 
CGAAAGATGTAACATGTAAGCTGTCAAATTCTATAATGATCATGTTTTAAACACGTGAAA 
TCAGACAAACTGGCCGCATCAAATTACTTTTCTGTACATTGACTAGGACTCTAGAGTATA 
TGCCTTTGAAAGATTATCATTGTACCCATGCTTTACTTGTCGACATATGAGACATTATCC 
CATGGATGCGAGTTTTCAATTTGTTTCTTCGATATTTCTAATTTGCAACTATTTCTAATT 
AAAAGTTGTCTTAACTCTTTTTAAGCTTTGGCGTGGCATCCCTGCCATGAAGAATATTTT 
GTCAGTGGGAGCTCTGACGGCTCCATTTGTCATTGGATTGTGGGGTAGGTACTGTTGTGC 
AGCAGTATGCTGTTTTATTTATTCGTTCATGCTGCTATTGTTTTAATCACTTATAAGGGT 
TTTTTAAATCATGTTTCTTCTCTACATTTTATATTCAGTCATGATGCATCTACATACTAG 
TAGTCTAGTAGCATCTTACTTTACCTTATATTTTGTGGTTTTTGTTTGAGGTGTATCTAA 
TTATGAAAACTTTTCTTAATTCCCAGGCATGAAAACCCGCAGATTGAAATCCCAAATGCT 
CATGATAACAGTGTTTGGGATCTTGCATGGCATCCTATTGGATATCTTCTTTGCAGGTAG 
CAATTTCAATAGTCTGGTGCTATGAGTTCCTTACAGTTTTATTCTATGATGTGTTGTGGT 
TCCCTGTGCTCTTGAATAACTAAATGCTTCAGATAATGATTTTTAACCCTATTATCTGCA 
GTGGTAGCAATGATCACACAACCAAGTTTTGGTGCAGAAACAGGCCTGCAGATAATCCCC 
GAGATGTTCTTATGCAGAACCAAGGTTTGTTTTTGGGCTATTAGTATCTGATTTTTTAGT 
AGGCATTGGGATGGATAGGTTGTGGGTAGTACATAATTACTATGTCCTTATCCATCTCAG 
TAGTAAGGATGTTGTGATAGGCTTAACTGGTCAGGCCCTGGCAGGGTCAGTCATATACTC 
CTATAATGGCTGGTTCGAAATGGACCTTGGCTTTTTAAGGTTCAGGCTCGGCCAGCCATA 
TGGCACCGTGATTAACTGAATTTTTTTGTAGAAAAGAACAGACTTGACTGGTCAAGCTGA 
GCTGATCTGATATAGGTGCAGATTTCTACAGGCTTTAAAAACTCAGACCCAAGTACTCGG 
TCATTAGTATCTCACTTACTGTTTTAATTTTGAGCATGTACTTTCAAGTTGCATTTGTCA 
GAAATTAGTGTTTTTTATTTAGTGTTTACTAACAAATTGAAGATGTGATTTGTGTGTACT 
GATAAGCGTAATTTGTATCAGGCTATAATGAACAAGGTTTTGGTCGCCAACCTGATAATT 
TCCAACCATCTGAGGCATCGCCAATCCCTGGAGCATTTGTGCCTGGGTTGACACGGAACG 
AGGGGACTATCCCAGGAATAGGAATAGCAATGCCATTTGATGCATCCTCTCAAGGGGATC 
ATAAACAGCCTCTTCCAGGTTCCATGGCACTGGGGGCTCCTCCTTTGCCACCTGGTCCCC 
ACCCATCGCTTCTTGGAAGTGGCCAGCAGCAAGGGTATCAGCAACAACAACAACACCAAG 
GTCATCCCCAGCAAATGCTTCCAATGCCCAATATGCCTCACCATCAGCTACCACCATCAT 
CTCATATGCCATTGCACCCTCATCATCTTCCCCGGCCTATGCAAATGCCTCCTCACGGTC 
ACATGCCACCTCCCTCAATGCCTATGTCTCATCAGATGCCTGGATCAATGGTATGGCCCT 
CAGATCTCTTGTAATTCAACCACAACTTAAGCCTGGCTTTTGTCGGTACCCCATGTGTTG 
GATTCCTCTTTGTTTTATTTTCTTAGTGATATCTTAGAGAGGTGTAGAAAGAGATATTAA 
TCCTCACTTGTTGTTGGAGTAGGGAATGCAAGGTGGCATGAATCCTCAGATGTCGCAAAG 
TCATTTTATGGGTGCTCCTTCAGGAGTATTTCAAGGACAACCAAACAGTGGCGGACCCCA 
AATGTATCCCCAAGGACGTGGTGGTTTCAACCGTCCACAGATGATTCCAGGCTACAACAA 
CCCTTTCCAACAGGTCCCATTTAAACACTAGTCTTTTGTTATTTAGTATACCCGTAAAGG 
TTTCACATGTATATATGTGCAAATAGGCAAAATGTCTACACAACAATGCAAAACACCTGA 
TACGATTGAACCACAATACAACTTTCTCAGCTAGTTTTAAACTCACTAGCTAGGTTCAAT 
GGTATGATTAGATGTTGAAAATGTAGAGCTAAAATAGCATAATCCGTTGACTAATCCGTT 
GTCTATATTTTATTTCGTGCAGCAGCAGCAGCCACCTTTACCTCCTGGCCCTCCACCAAA 
CAACAATCAGCAACATCAGTAGGCAGCCGTTGTATTAGTACATTAGTTTACAACCGCACT 
GTCTGCGGGATAAAACGATTGAAGTAAAACTATTATATGGGATTCAAATTTCGTTTCTAT 
AAAACAAAACAT
>AT5G14530.1 |  transducin family protein / WD-40 repeat family protein 
GTCCTCGGATTTTTCTCGTGCTTCACTGATAATCCAGCTTGACGATGTCGTTGACGGAGC 
TAGACGACGGACTGGTTCGCAGGATGGCCATGGGCGCAGTCTTCTCTGATTTTGTACGAA 
CGAATTTTTCTCTTTTTGTAATCTCATTTGATTTCGGATTAAACTTTGGTGGAATCCAGC 
TTCCGAGATTAATCCGTTCAATTTCTCGGTGTTGGTTTTACACAGGGAGGGAAGATACAT 
TCGGTGGGTTTCCATAGGACTGATGATCTATTGGTCACATCCAGCGAAGATGATTCACTT 
CGCCTCTTCGATATCGCCAACGCTAAGTCAGTTCTTCCTTCCTGTTTTTAGGTTTTATAC 
TTATCTGGTCAAGTTCTAGAGAAACTAGGTTACTTAAGGAATCAAGAAGAAGCTTTTTGA 
TTAACCGATTAGTTGAAATTCTTGTGGAGCAAAAAGAAGACTGAAATATTCAATTTGTAT 
GGATGTTTGTTAGACAGCTGAAGATTACATACCATAAGAAACATGGCACCGATCGTGTAT 
GCTTTACCCATCATCCTAGCTCTCTAATTTGCTCTTCTCGATACAATTTGGAGTCCACTG 
GTGGTGAGTCCTCCTTTTCTCTTGCTTGAGATTGGATAATCAAAGCGGTGGTGGATTATT 
ACTTACTTGTATACTTGTTTTTGTGTACCAGAATCCTTGAGATATCTCTCAATGTATGAT 
AATCGGATCCTACGCTACTTTAAAGGGCATAAAGACAGGTCTGCTTATAACCTCTGGAAT 
TGTGAATTTGGATTTTACTAGTATGTACATTGATGATGGAAAATGTTCTTCTGTTTCAGG 
GTTGTATCACTTTGTATGTCTCCTATAAATGATAGCTTCATGTCTGGTTCTCTCGACCGA 
AGTGTTAGACTCTGGGATCTTCGTGTAAATGCCTGCCAGGTTGGTTTCTATAGTTTTACA 
CTCTGAGAAGGCTAGATGGAATAAGTCTTAATATGCTAGAGTTTTAATGAGAAAAGTGCC 
TTTTTCTTTTTGTTAGCAAAAACCTCGTGATATATCACCTTGAAAGTTAAACTTGATGAA 
GATGCTGGAACCACGAAACATTGAGAATATTTAGGCTCTTTACCTTAATACTCTCTCTGT 
GAATTTATATGGTTTCATGATCTATGCTTACCCTTTTAGTCAATAGGGAATTCTACATCT 
ACGTGGTAGACCTGCAGTTGCGTATGACCAACAAGGCCTTGTGTTTGCAATTGCAATGGA 
AGGAGGTGCTGTTAAATTATTTGATTCCAGGTGTTATGACAAGGTTAGCTTCTTACAATG 
ATTCACACAGCCTTACGCATGACTGCTCTTGTTAGTTCTAACTTCTAAACCCAATTGATC 
TCTTATGTAGGGTCCCTTTGACACATTTCTGGTGGGTGGGGATACTGCTGAGGTTAACGA 
TATAAAATTCAGCAACGATGGGAAATCCATGCTCCTAACGACTACAAATAACAATATCTA 
CGTTCTTGATGCATATCGTGGAGAGAAGGTAATCACGTTCTCTATCTTTCACCTGAAGAA 
GACAGAACGTTAGGTTTCAAGTTGGTAAAAGACGGTATGTTATTTTGCAGAAATGTGGTT 
TTAGTTTGGAGCCTTCACAGGGTACACCCATAGAGGCCACCTTCACACCAGATGGCAAGT 
ATGTTCTGTCAGGTAATACGCGTTCCTAGATGATCTTTTATCATGACTCATCTACACAAT 
ATTCAAATTTAATCAGCTTAGTTTTCTTTTTCGGATACAGGTTCAGGTGATGGAACCTTA 
CATGCGTGGAACATCGAGAACCCATCTGAGGTAAAGTGCAGAATAATCAACACCACTAGG 
ACACTGATTCACTTAAAAGTGATGAATAATTTATAAAGTTGTAGATACTATTTTTGCGTT 
ATGCTTTCACAGTATTTAAATTTTAGTGGGGATTTTGTGTAAAAAGCAGGTGGCGAGGTG 
GGAGAACAACATAGGAGTAGTGTCGTGTCTGAAATGGGCACCACGTAGAGCCATGTTCGT 
TGCTGCTTCTACGGTTCTCACATTCTGGATCCCAAACGACGGTGAATCACCAGCCCCCGC 
CGATCCTCCTACCGATCAACAACAGTGACGACATATATGTTTCCATTATGCACTTGTGTA 
TCGTTTTTTAATGTTGACAATTAGAAAAATTTGGAAGCAGTAGTATGTTAATCAAATTTA 
GAGTTTATGAATTTGAGTCTAGATGGTTACAATATGTTTTCTTTAATGACTATTTACTCT 
TATTTTACGT
>AT1G73960.1 |  TAF2 (TBP-ASSOCIATED FACTOR 2) metallopeptidase/ zinc ion binding 
GCAAAAAAGGAACATGGCCAAGGCTCGAAAGCCGAAGAACGAGGAAGCTCCTGGCGCGAA 
GACTTCAGAGAACACTGGAGCTAAAGTTCTTCACCAGAAACTCTTTCTCTCTATTGACTT 
CAAAAAACGCCAAATCTACGGGTCCGTTTTCCTCTCTTTCTTTCGATTTTTCATTCGCGA 
AACAAGTCCGTGAATGTGATTTTTGGTTGATATATATAATTCGGGATGAAGAAACCGGCA 
GAATTTGAATCTTGCACCGACAGTATTCTTTGGATTTTTCAATTTATGGTGAATCCTCTG 
CTTTTGATTATTTGGGGTTTTACTTATATACCTTGGTTTTATCATTCTTGGCTGCATTTT 
CATGGGATATTTTTGTTGGCTTTCTATAGTTACACAGAGTTAGAAGTGAGTGTGCCAGAT 
ATTGGTATTGTGGGACTACACGCAGAGAACTTGGGAATTGAGAGTGTTTTGGTAGATGGG 
GAACCTACTGTATTTGAGTACTATCCGCACCATCAGAACTCTGAAACTGAAAGTAACTGG 
AACTCGGTCTCTGACCCAGCTTCAGCAGCTGATGCTGCGGCCATGGAATATGTCGGGGTT 
CTTAAGAGAGAAGACACTGCAAATTTACTGATCAACTGTTGCAAGCCTTCTAAGGATTTA 
TCTGAACAGCTGGACAGTGTGACTTTAGAAAACGGTTCCCAATCTTCAGGGGAGGCAAAA 
CAGGTAATTGTTCTGATTCTCATATACACTGCCATGGGTTACAAGTGACCGCTGTCCTTT 
GTTTAACGATTTATGTTTGCTCATATGATGCAGAATGTTAAATTGATTCGGATTAACTAC 
TGGGTAGAGAAAATAGAGTCAGGAATTCATTTTGATGGGAACATTGTACATACTGATAAC 
CAGATGAGACGTGCTCGTTGTTGGTTTCCTTGTATTGATGATGAGTACCATCGTTGCAGG 
TATTCAGTTTTGTTAAGAAGTAACACTGTATTCATCTCCTGTCTTTTGAGATCAAAGTGG 
GTATCACAACCTGTTTAACTTTTTTTTTTAATAACTTTGTGGTGGGTGCAGTTTCGATTT 
GGAATTCACTGTTCCGCACAACTTTGTGGCTGTTAGTGTTGGGAAATTACTCTACCAGGT 
AAGTTGTGTAAATCTGTCATACATGAATGGATTAGAGGAAGTGCTATTTTCTTCGATCCT 
GTATCTTACGTACAAGACATATTCCATTATAGATCTGGATTGAATGGAAAAACTTAGAAA 
AAGCTGTCATTCCCGTGACTTGTGGACGTAGGCATAAAATCTGCGTCCAAATTTGGTTTC 
AGCTTATATATGAAAGAAGCCATATCCAGTGCTGTTTAATCTGAAAGTGTACTATCTCTA 
TTTGCAAGGAAACTTGTTCATTGTTCTGTCCTTATATTATCAGAAGATTTTGCTGTTCAG 
TATAGTTATCTAATGAATCTGGATCAAACAGAAGAACTTTTTCTCTGTTATTGTAGGCAT 
ATAAGCTAAAACTTTGTTGAATAGGTTTACAGTTTCCATCATTCAATTTTATTAGTACTC 
TTACAAGGTGGAGGGGGCGTAATCTTTAAACTTTCACACTTTTCAGGTTATGTGCAAAGA 
AGATACTACTCAAAAAACGTATGTTTATGAACTAGCTATTCCTATTGCACCGCGGTGGGT 
GTCTTTAGTTGCAGGACCATTGGAAATCCTTCCAGATCAGACCAACTTTCTCATATCTAA 
CTTGTGTTTGCCGCATGATCTCTCGAGGCTTCGTAATACAATGGAATTTTTCCATGAAGC 
TTATAGGTCCGTAAATTTGTATTCTGGCAACTTATTGTAGTCAAACTGAATTAAAGTATA 
AGTCTTGTCTACTGGAATTCAACTTCTACAGCTACTATGAGGATTATTTAAGTGCGAACT 
TTCCATTTGGATTCTACAAGCAAGTATTTTTACCTCCTGAAATGGTTGTTACTTCGTCGA 
CTTCGGGAGCTTCCTTGAGTATCTTTAGCTCCCACATACTATATGATGAGAGGGTTATTG 
ATCAGGTATTGTTTCCTGGTAAATTGACCTGTGGGTAGATAATACCTTCATCAGACACAT 
GCACGTAAATGGTTTGTATATGCTAATATTAGGATGGAAGGCACACCAGACCTAATTTGT 
ATGATGCATTTTTGAAAAAAGTACAACCAAGCACGTGTCTGAGCATGTTAAATATATTTC 
TGCATTACCACTTATGAATATTGCAAGCTGCGTTCATCTATTTCTTGCATTTCACCCCTT 
CATTGGCATATGGATTTTGGTGTAGAAGTTTTCACTATGTTTATAGGAAGTTTTCTTTCT 
TTGGTGGTGTTTCGTCATCTTTTTAGTTCCTTTATGCAAAAATCTGATAGAGCTTCAATT 
ATCTTTGCAGACAATAGATACACGCATTAAACTTGCTTCTGCGTTAGCAAAACAGTGGTT 
TGGAGTTTATATTACTCCTGAATCACCAAATGATGGTGGGCTTGTGACATTTTTCTACAC 
TTTGATTTGCGTACGATTTGTTATATCAGCTTCATGTGAAAACATGTAATTTTGTGATTC 
ATGATTGTCCATGTTGTTATAACAGATTGGCTCCTTGATGGTCTTGCTGGTTTCTTAACG 
GATATGTTTATCAAGCAGTTTTTGGGAAATAATGAAGCACGATATCGGAGATACAAGGTT 
TATACCTACTACTCGAGTTATTCTTCCCTGACGCCTCTGTAACCATTTCTGAACTAAGCC 
ATGAACCTCATATCTGGATTCTCTTTTTTTTTTTTGATCCAATTGCAGGCAAATTGTGCT 
GTCTGTAAAGCTGATGATAGTGGTGCAATGTGCTTGAGCTCATCTCCTTCTTGCAGGGAC 
CTATTTGGAACTCATTCTATTGGAATGCATGGGAAGATACGATCATGGAAATCAGTAAGC 
CATATTTTTTCTTTTCATATTTATCATTCATGCTCTCACATTTTTGTAGGAGTGGATGAG 
TTCTTTGGGATAATTTACATGATTTTGCATCTGTTGTTTGTTACGAGTAATAATTATTCT 
CTCATTTTTGAAGGGAGCAGTCCTTCAGATGTTGGAGAAGCAAATGGGCTCAGACTCGTT 
TCGTAAAGTATGGTCATGGTGCTATCGTTTTTTCAGGAAATCACTTTGTTTGTTTTCTTA 
CGCATATGATTAATAGACCTTCTACATGATGATTTACAGATATTGCAGAAAATTATTTCT 
CGAGCCAAGGATCCATCTAATTCTATACGGTCTCTTAGCACGAAGGAGGTAACACGACTG 
TGTTTGTTTTACATGTTACGCTCGAAAAGATCCACATATTTCCTTTATTAAAGTTTTTGT 
GTTTTGATAAACCTCTTATTTTTAGTTGGTTAAGAAAAATAAATAAATATGAGAAAGTAT 
TTTGATCTTTCAGTATAAAGTATATATATGTGGGATAGTTGCGGTCCTAAGATAGTCATC 
TAGCGTAATCTTTTGGGTTAGCTGATAACACTAAAAGGTCAGGAAGAATTCTGGGATTTC 
TTCTTTGGGAGTTTTTCTTAACTAAATATTTTCGTTGCTCCTGGAGCATTTTTTTATTTA 
TCGAAATGGATCTGTCTCTTAGCTGTAACTTGATATACTTCACAAATGTCGTAAATGTGC 
CACTCGACCATAATGTGATACGGCCATTCATCCGTAACTTGGTTCAACAACTCATAACCT 
AATTGTTGACAAATATGAAGCATCTCCTCCATTTGTTGTATATTTCTCTTCGTGATCAAC 
CGATTATCTTTCAGCTTGAATTTTCGAAGTCAGTTCTAATATCTGTGTTTCTCAAATTTC 
ACTTTTGAGATGCAGTTCCGGCAATTTGCTAATAAGATTGGAAATCTTGAGCGTCCATTT 
CTTAAAGAATTTTTTCAGCGATGGGTTGCATCTTATGGTTGTCCCGTGCTAAGGTATTTT 
TTTTCTAATTAAGAGTTACGTTCTTCTGAACTTAGTTCAATGGATTCCTGGATCTTCATT 
TAATCTTATCTCGATGTTCTTACTGGTGCTTTATTAAACTAGGATTGGGTTGTCTTACAA 
CAAAAGGAAAAACAATGTTGAAATGGCTGCTCTGCGAGAATGCACGGCTGCACTGGATGC 
AAGATTATCAGTTATAGGGGCTACTTCTGATTCAGAAAGCCGGGATGTGGATGCTGGCTG 
GCCGGGTATTATGAGTATAAGGGTTTATGAACTCGATGGAATGTCTGATCATCCAAAGTT 
GCCTATGGCTGGAGATAGATGGCAGCTACTGGAATTACCATGTCATTCTAAACTTGCTGC 
TAAACGCTATCAAAAACCAAAGAAGGGAGGGAAACCTGATGGGGCTGAAGACAATGTTGA 
TGCTATAGCACCGTTAGAAAATAAAACGAGGTGGGTTTCTGTGGTACACTATTTCTGGCA 
TTCCTGGTCTGTTTACATACCTTGCAACAACACAAGAAAGAGAACTGAGACTCTGAGAGA 
TTGAATCTTTCTCTGTAGCATTGAATCTCCCTTGGCTTGGATTAAAGCTGACCCTGAGAT 
GGAATATATTGCTGAGATTCACCTTCATCAGCCCCTACAAATGTGGGTAAGAGATCTTCT 
CTGACACATCTTGAAAATCTATGGTGCACATCACAGTCGTTATTTCTTTCGCTTTCTACA 
TGGTTGGTTCGTGACAAGAAGCTCATGAACTAGTTTACTTAGGTATTATCTAACTGAGTC 
TTTCTGTGTGTTTTCTGTGTGTTGTGCTCTTACTTCTAGACATCTCAAAATCCTACATTG 
GTTACAGTTCATGTTTAATCGTTTCTCACACTTGTGGGTTTCTGTCACTTTTGATCAGGT 
CAATCAACTAGAGAAGGACGGAGATGTTGTTGCTCAGGCACAAGCAATTGCGTCACTTGA 
AGCCTTAAAACAACACTCCTTTTCCATTGTGAATGCACTCAAAAATGTCCTCACTGACTC 
CAAGGTTTAGTCCGTCTCTTGTGTACTTTTTCTCTAAAACCAGTTTGAAGATGAAGTTCT 
TGTCTCCAAAATATTATTGTGACATATAGGTCTTCTGGAGAATACGTATTGCGGCAGCGT 
TTGCATTGGCTAAAACAGCATCAGAGGTATGATAAAAATTGTTCAATCTTATGTTCCAAA 
GGGACAAGACGTATAATAATCAAATTTGTAACTTGATTTAAGTGCATAGTATGAAGGTTA 
GCAAAAGGCATTGATTCAAAAGTATAAGATTAGGAACCTTATATGTGCAAATTGTTATGT 
TTTTAGAGGAATAGAACCAGCTGAAATTTCACCATTTACAAGAAAACTTGTGGGAAAAGA 
ATTCCATTCATTCAGGTGAGAAAAATGATAAGGGAACAAATTTAATAGGAAACTTTGCAT 
TTACTACATTGCAGAAGTAATGAGTGGAAAAAAAATTCCTCTGATCTCAACATTCCTTTC 
ATCAATCTTCCATTCATCTTAATTTTCATTTATTTCTAGCATGTTACCAGATTTTATTTG 
TTTCTCTTTTGAGATTTTCATGAGTGTATGTCTATTGGTTTTAACTGCATAGTATGCCAT 
CTTTCAACTTATTTTTGTAAACTGCACTTTCTAAAGGCCTGCACTCCTTTTCGTGACCTT 
TGAAACAGGTCTTACTGCAATTGTTGATTTAAGCTCATTTTTGTTTCTAGCAGGAGTCTG 
ACTGGGCGGGTTTGCAACATCTAATAAAGTTTTATAAGAGTAGAAGATTTGATGCAGAGA 
TTGGACTCCCCAAGTGAGATTGGAGCCTTTTAATTTTTGGACCTCTCTTTGGTAACCAGC 
AGAAGATTTCTCATAAAACTGATATTCTCCTTTCAGGCCGAATGACTTCCGCGATTTCCC 
AGAATATTTTGTGCTTGAGGTAGGAAATGAGCTTGATATAGTGTCACGCATTGATCTCAG 
ATGTTAGCTGGAGATGCTATGACGTGTCCTTTCGATATGACAGAAACTGTGTCTGCTCTA 
CTTAGCATATAAGTTGGGTATCTCCTTAAAAGTTTAGGCTACTAATTAATATGTCATGGT 
AAAATAGATAAAAGAATGAATGTTGAGCCAACAAAGAACATAATAGAAAATAACGAGCAT 
AAGGACACAAATATCCAGAAGCTTCCTTGTGTATTCAGCTTTTTAGGAAAATTCGTTATG 
CAGTGAGGGTGTGATTTCTTGTTTCTCTCTTCTTAGCCTGCTTTCCTCTGGGGGTTTCCA 
TTGTTATTCCCCTGCCTGAAACTATGGTTTGTAACAGTTTAACTCTTTTGTTTCACTCGG 
TTAGCGCCAGTGGTTCTTTGGTTATTGTTGAGTTAAATTCATTTCTTCTCTTGAACTTTG 
AACATTTCGTCTCTTGAATGTTTTATCTAAACTATTGTTATTTTCTACGTCTTAGGCCAT 
TCCACATGCCATTGCAATAGTTAGGGGTGCTGAGGGGAAAAGCCCTAGAGAAGCTGTTGA 
ATTTATCTTACAGCTTCTGAAGGTATACATCTCTATTGGGTAAATTTTGTGAAACCTTTG 
TTGCCTACTGATATAGCCTTTTTATAAAAGCTGTTAGTCTTTATTCGCTGCAGTGATTTC 
TTTCATCTATGAAAGATTAGGTGTTTCGCTTGTTTTCAGTCCATATTATCATCTTAACTG 
ATCTCGCCCTTTTTTTCCTATTCCATTTTATAGTACAATGACAACAGTGGGAATTCGTAT 
TCTGATGTATTCTGGCTTGCTGTGCTTGTTCAGTCAGTTGGTGATCTCGAATTCTGTCAG 
CAGGTCTGTGATCTTGTAAAAGACACTCTATGATTTATCTGTTGTAGTGTAATATTTATT 
TTTGTCTTTTCCTACTGACGCTATTAGGAGTAAAAAACCCTTGAATTTGGTACATAGAAA 
AGACAAGATTTGGTACTTAGCTCATGTATTATATAGCTATCAAAATTTTGAGGCTTCATT 
GGTTTATTTAGCTTTATGGAGGTCTCATACTTTTATGGAAAAAAAAACGATTTGGTCTCA 
TACTTTTATGACAAAAAATAAAGATTCCTATTATTCAGTTCATATGCAAAGATGTGGATT 
TTAGAACTTCAATATACCAGCTTTGCTACATGGTTAATGGTTAATTGCTCAATACTTCTT 
GCCTCTTTGTTTCCCTGGCAGAGTCTAACGTTTTTGGCCCCTCTTCTGAAGCGCATTGAC 
AGACTCTTGCAGTTTGACAGGTACCCTCATGTTTGATGTTAATGATTTGATAGGTTTTAA 
CAGAACTTATTACTGAGAGCTTGTTGGAGATAAATGTACTAGGTTGATGCCAAGCTACAA 
TGGCATCTTGACAATTAGCTGCATCCGAACATTGGCACAGACTGCTCTCAAGCTTTCTGA 
TTCCATCAGTTTCGTAAGTTCTTTCCTTTCGCTTTTTTCTTCCAATTGCTCCTTATGAGA 
TAGATACCAGCGGTGATTAAAAGCTTGCAATTTACTGACTTCAGGATCACATCTGTAAAC 
TTATTGAACCTTTCCGGAATTCGGATACAATATTGCAAATTCGTATAGAAGGAAGTAGGG 
CACTTCTTGACATCGAGTACCAATCCAAAGGCATAAGTTCCGCACTTTTGTTGTTTATGA 
AATATTTGGTAGAAGAATCATCTTTGAGAGGTTGGTTATATTCTCATGCTGGAACATAGC 
AGCTTTCTATTTCTAATAGAGTTCATTTATTGCTTTTATATCTTTGGCCCTTGATTACAG 
GGCAGGTAAAATTGTGTGTACACACAATGCGGTTATGTCAAATAGCAGTTGGATGTGACT 
CAGACGATTGTGTCGACACTGTTACTCTTCTGGATTTGCTGCATCTATTCAAGAGCCATG 
TAGTATTTAACAATGAACTTCTTCGCTACTACTTGTTCTGCATTTTTCAAATCCTCGCTG 
GAAGGTCTGTAGTTTACTTCCTTCAGTGGATTTTGTTTGGAATCCAGTTGTTCTATTTGA 
GCCTAGAGGGTTATTTTTCTCTGTTTTCTTCTGCTTATCACCATAATTATCCACATTCTG 
AACAGAATATACTTATTGTTGTCTCATTTTCAGACCCCCAACGTTGTTCGGAGTTCCCAA 
AGAAAAACCTTTGCAGCTTGTTGATGTGGAGGCCTGCATTGAACCGAAAAATGTATTTTT 
GGTTCCCGGAGCAGAGGCAGGGGAGCCTTCACTTTCGGCACTTGGAGATGCCAAAGGACA 
ATCGCTGGATGTTGCTCCTTATGGTGTTCCAATAATACCACAGGAAATGTTCATGCCTAT 
TGTTCCTGAACTGATGTTGCCAGAACCTGTTGCAGCGTATGATGAGACACAGCATCTTGA 
ACCTCGCATGGAAAGTCAAAACCAACCTTCACATGAAAATCCCATCGTTCATGAGATTCC 
ATCAGATGTTGAAGGTCCAACAGAAGAATTAGCTCATAGGGAAGCAAACCCTCCAACAAA 
GGAACCTCAAAAAGAACCTGATGTGGTTTCTGTGTCTGTTAGTCATGAGGTGAAGAAGTC 
TGTTATACGGATCAAGGTCAGACCATCTGGGGCAACCAGCAGAGCGGAAGGATCAGCACG 
AACTATAGAAAGATCTCAAGGGATTGTGGTACGCCATGATATAGACCGAGGTCAAACTAG 
TTCAGCTTCAGTGGACGCCCCACAGAGAATCTCAACTGACGCTGTGAGCATAAGCAATCA 
GAATCACGTGGAGGAAGTAAATTCGTGTCACGATGTTGGTTCTCGCATGACTGCAAGCAT 
CGGCAGTGTAAAATTTGCAAGCGAAGGCGATATTTTTGGGAAAGAGTTGCAATGCACTGC 
TGAGTCTGGGAAACCTTCGACAAGCCAGAAAGCAGATAATAACAACCGAACTGTACCACC 
TAGCTTCTTACCACTAGACCACAGTATGGAAAACGAGGCGCAGCAGAAATACGCGAGCCT 
CCAAACACTTTCGATTGGTAAAGAAAAGGAAAAGAAGAAAGACAAGGAAAAGAAAGAGAA 
GAAGAGGAAAAGAGAAGATCCCGTTTATCTAGAGAAGAAACGGTTAAAGAAAGAGAAGAA 
ACGAAAGGAGAAGGAAATGGCGAAGCTCGTGAGCAGCACTACGGATCCAGCTAAAAAGAA 
GATAGAGAGTGTTGCGGAGGTTAAAGAAGAAGAACCAAGTGATGGTGCCATGTTGATTAA 
GGTTGAACCAAAGACTGAACCATCAACAGCAGAAGCTAGACCGCTTCCCAAATTCCGAAT 
CAAACTGAAAAGCAAAGCGTTCAACAACTCATAAGGTTAGATCCGAGCCAGTCCCTCCCC 
GCCAAAATCTGAGTAGTAACTTTTATTTCCAAAAGCTTTGTTGTTACAACTTGCAAGGTG 
TTGTGATTATATGTCAATGTAATCTGTTTATTCAATGCGCTT
>AT1G73960.1 |  TAF2 (TBP-ASSOCIATED FACTOR 2) metallopeptidase/ zinc ion binding 
GCAAAAAAGGAACATGGCCAAGGCTCGAAAGCCGAAGAACGAGGAAGCTCCTGGCGCGAA 
GACTTCAGAGAACACTGGAGCTAAAGTTCTTCACCAGAAACTCTTTCTCTCTATTGACTT 
CAAAAAACGCCAAATCTACGGGTCCGTTTTCCTCTCTTTCTTTCGATTTTTCATTCGCGA 
AACAAGTCCGTGAATGTGATTTTTGGTTGATATATATAATTCGGGATGAAGAAACCGGCA 
GAATTTGAATCTTGCACCGACAGTATTCTTTGGATTTTTCAATTTATGGTGAATCCTCTG 
CTTTTGATTATTTGGGGTTTTACTTATATACCTTGGTTTTATCATTCTTGGCTGCATTTT 
CATGGGATATTTTTGTTGGCTTTCTATAGTTACACAGAGTTAGAAGTGAGTGTGCCAGAT 
ATTGGTATTGTGGGACTACACGCAGAGAACTTGGGAATTGAGAGTGTTTTGGTAGATGGG 
GAACCTACTGTATTTGAGTACTATCCGCACCATCAGAACTCTGAAACTGAAAGTAACTGG 
AACTCGGTCTCTGACCCAGCTTCAGCAGCTGATGCTGCGGCCATGGAATATGTCGGGGTT 
CTTAAGAGAGAAGACACTGCAAATTTACTGATCAACTGTTGCAAGCCTTCTAAGGATTTA 
TCTGAACAGCTGGACAGTGTGACTTTAGAAAACGGTTCCCAATCTTCAGGGGAGGCAAAA 
CAGGTAATTGTTCTGATTCTCATATACACTGCCATGGGTTACAAGTGACCGCTGTCCTTT 
GTTTAACGATTTATGTTTGCTCATATGATGCAGAATGTTAAATTGATTCGGATTAACTAC 
TGGGTAGAGAAAATAGAGTCAGGAATTCATTTTGATGGGAACATTGTACATACTGATAAC 
CAGATGAGACGTGCTCGTTGTTGGTTTCCTTGTATTGATGATGAGTACCATCGTTGCAGG 
TATTCAGTTTTGTTAAGAAGTAACACTGTATTCATCTCCTGTCTTTTGAGATCAAAGTGG 
GTATCACAACCTGTTTAACTTTTTTTTTTAATAACTTTGTGGTGGGTGCAGTTTCGATTT 
GGAATTCACTGTTCCGCACAACTTTGTGGCTGTTAGTGTTGGGAAATTACTCTACCAGGT 
AAGTTGTGTAAATCTGTCATACATGAATGGATTAGAGGAAGTGCTATTTTCTTCGATCCT 
GTATCTTACGTACAAGACATATTCCATTATAGATCTGGATTGAATGGAAAAACTTAGAAA 
AAGCTGTCATTCCCGTGACTTGTGGACGTAGGCATAAAATCTGCGTCCAAATTTGGTTTC 
AGCTTATATATGAAAGAAGCCATATCCAGTGCTGTTTAATCTGAAAGTGTACTATCTCTA 
TTTGCAAGGAAACTTGTTCATTGTTCTGTCCTTATATTATCAGAAGATTTTGCTGTTCAG 
TATAGTTATCTAATGAATCTGGATCAAACAGAAGAACTTTTTCTCTGTTATTGTAGGCAT 
ATAAGCTAAAACTTTGTTGAATAGGTTTACAGTTTCCATCATTCAATTTTATTAGTACTC 
TTACAAGGTGGAGGGGGCGTAATCTTTAAACTTTCACACTTTTCAGGTTATGTGCAAAGA 
AGATACTACTCAAAAAACGTATGTTTATGAACTAGCTATTCCTATTGCACCGCGGTGGGT 
GTCTTTAGTTGCAGGACCATTGGAAATCCTTCCAGATCAGACCAACTTTCTCATATCTAA 
CTTGTGTTTGCCGCATGATCTCTCGAGGCTTCGTAATACAATGGAATTTTTCCATGAAGC 
TTATAGGTCCGTAAATTTGTATTCTGGCAACTTATTGTAGTCAAACTGAATTAAAGTATA 
AGTCTTGTCTACTGGAATTCAACTTCTACAGCTACTATGAGGATTATTTAAGTGCGAACT 
TTCCATTTGGATTCTACAAGCAAGTATTTTTACCTCCTGAAATGGTTGTTACTTCGTCGA 
CTTCGGGAGCTTCCTTGAGTATCTTTAGCTCCCACATACTATATGATGAGAGGGTTATTG 
ATCAGGTATTGTTTCCTGGTAAATTGACCTGTGGGTAGATAATACCTTCATCAGACACAT 
GCACGTAAATGGTTTGTATATGCTAATATTAGGATGGAAGGCACACCAGACCTAATTTGT 
ATGATGCATTTTTGAAAAAAGTACAACCAAGCACGTGTCTGAGCATGTTAAATATATTTC 
TGCATTACCACTTATGAATATTGCAAGCTGCGTTCATCTATTTCTTGCATTTCACCCCTT 
CATTGGCATATGGATTTTGGTGTAGAAGTTTTCACTATGTTTATAGGAAGTTTTCTTTCT 
TTGGTGGTGTTTCGTCATCTTTTTAGTTCCTTTATGCAAAAATCTGATAGAGCTTCAATT 
ATCTTTGCAGACAATAGATACACGCATTAAACTTGCTTCTGCGTTAGCAAAACAGTGGTT 
TGGAGTTTATATTACTCCTGAATCACCAAATGATGGTGGGCTTGTGACATTTTTCTACAC 
TTTGATTTGCGTACGATTTGTTATATCAGCTTCATGTGAAAACATGTAATTTTGTGATTC 
ATGATTGTCCATGTTGTTATAACAGATTGGCTCCTTGATGGTCTTGCTGGTTTCTTAACG 
GATATGTTTATCAAGCAGTTTTTGGGAAATAATGAAGCACGATATCGGAGATACAAGGTT 
TATACCTACTACTCGAGTTATTCTTCCCTGACGCCTCTGTAACCATTTCTGAACTAAGCC 
ATGAACCTCATATCTGGATTCTCTTTTTTTTTTTTGATCCAATTGCAGGCAAATTGTGCT 
GTCTGTAAAGCTGATGATAGTGGTGCAATGTGCTTGAGCTCATCTCCTTCTTGCAGGGAC 
CTATTTGGAACTCATTCTATTGGAATGCATGGGAAGATACGATCATGGAAATCAGTAAGC 
CATATTTTTTCTTTTCATATTTATCATTCATGCTCTCACATTTTTGTAGGAGTGGATGAG 
TTCTTTGGGATAATTTACATGATTTTGCATCTGTTGTTTGTTACGAGTAATAATTATTCT 
CTCATTTTTGAAGGGAGCAGTCCTTCAGATGTTGGAGAAGCAAATGGGCTCAGACTCGTT 
TCGTAAAGTATGGTCATGGTGCTATCGTTTTTTCAGGAAATCACTTTGTTTGTTTTCTTA 
CGCATATGATTAATAGACCTTCTACATGATGATTTACAGATATTGCAGAAAATTATTTCT 
CGAGCCAAGGATCCATCTAATTCTATACGGTCTCTTAGCACGAAGGAGGTAACACGACTG 
TGTTTGTTTTACATGTTACGCTCGAAAAGATCCACATATTTCCTTTATTAAAGTTTTTGT 
GTTTTGATAAACCTCTTATTTTTAGTTGGTTAAGAAAAATAAATAAATATGAGAAAGTAT 
TTTGATCTTTCAGTATAAAGTATATATATGTGGGATAGTTGCGGTCCTAAGATAGTCATC 
TAGCGTAATCTTTTGGGTTAGCTGATAACACTAAAAGGTCAGGAAGAATTCTGGGATTTC 
TTCTTTGGGAGTTTTTCTTAACTAAATATTTTCGTTGCTCCTGGAGCATTTTTTTATTTA 
TCGAAATGGATCTGTCTCTTAGCTGTAACTTGATATACTTCACAAATGTCGTAAATGTGC 
CACTCGACCATAATGTGATACGGCCATTCATCCGTAACTTGGTTCAACAACTCATAACCT 
AATTGTTGACAAATATGAAGCATCTCCTCCATTTGTTGTATATTTCTCTTCGTGATCAAC 
CGATTATCTTTCAGCTTGAATTTTCGAAGTCAGTTCTAATATCTGTGTTTCTCAAATTTC 
ACTTTTGAGATGCAGTTCCGGCAATTTGCTAATAAGATTGGAAATCTTGAGCGTCCATTT 
CTTAAAGAATTTTTTCAGCGATGGGTTGCATCTTATGGTTGTCCCGTGCTAAGGTATTTT 
TTTTCTAATTAAGAGTTACGTTCTTCTGAACTTAGTTCAATGGATTCCTGGATCTTCATT 
TAATCTTATCTCGATGTTCTTACTGGTGCTTTATTAAACTAGGATTGGGTTGTCTTACAA 
CAAAAGGAAAAACAATGTTGAAATGGCTGCTCTGCGAGAATGCACGGCTGCACTGGATGC 
AAGATTATCAGTTATAGGGGCTACTTCTGATTCAGAAAGCCGGGATGTGGATGCTGGCTG 
GCCGGGTATTATGAGTATAAGGGTTTATGAACTCGATGGAATGTCTGATCATCCAAAGTT 
GCCTATGGCTGGAGATAGATGGCAGCTACTGGAATTACCATGTCATTCTAAACTTGCTGC 
TAAACGCTATCAAAAACCAAAGAAGGGAGGGAAACCTGATGGGGCTGAAGACAATGTTGA 
TGCTATAGCACCGTTAGAAAATAAAACGAGGTGGGTTTCTGTGGTACACTATTTCTGGCA 
TTCCTGGTCTGTTTACATACCTTGCAACAACACAAGAAAGAGAACTGAGACTCTGAGAGA 
TTGAATCTTTCTCTGTAGCATTGAATCTCCCTTGGCTTGGATTAAAGCTGACCCTGAGAT 
GGAATATATTGCTGAGATTCACCTTCATCAGCCCCTACAAATGTGGGTAAGAGATCTTCT 
CTGACACATCTTGAAAATCTATGGTGCACATCACAGTCGTTATTTCTTTCGCTTTCTACA 
TGGTTGGTTCGTGACAAGAAGCTCATGAACTAGTTTACTTAGGTATTATCTAACTGAGTC 
TTTCTGTGTGTTTTCTGTGTGTTGTGCTCTTACTTCTAGACATCTCAAAATCCTACATTG 
GTTACAGTTCATGTTTAATCGTTTCTCACACTTGTGGGTTTCTGTCACTTTTGATCAGGT 
CAATCAACTAGAGAAGGACGGAGATGTTGTTGCTCAGGCACAAGCAATTGCGTCACTTGA 
AGCCTTAAAACAACACTCCTTTTCCATTGTGAATGCACTCAAAAATGTCCTCACTGACTC 
CAAGGTTTAGTCCGTCTCTTGTGTACTTTTTCTCTAAAACCAGTTTGAAGATGAAGTTCT 
TGTCTCCAAAATATTATTGTGACATATAGGTCTTCTGGAGAATACGTATTGCGGCAGCGT 
TTGCATTGGCTAAAACAGCATCAGAGGTATGATAAAAATTGTTCAATCTTATGTTCCAAA 
GGGACAAGACGTATAATAATCAAATTTGTAACTTGATTTAAGTGCATAGTATGAAGGTTA 
GCAAAAGGCATTGATTCAAAAGTATAAGATTAGGAACCTTATATGTGCAAATTGTTATGT 
TTTTAGAGGAATAGAACCAGCTGAAATTTCACCATTTACAAGAAAACTTGTGGGAAAAGA 
ATTCCATTCATTCAGGTGAGAAAAATGATAAGGGAACAAATTTAATAGGAAACTTTGCAT 
TTACTACATTGCAGAAGTAATGAGTGGAAAAAAAATTCCTCTGATCTCAACATTCCTTTC 
ATCAATCTTCCATTCATCTTAATTTTCATTTATTTCTAGCATGTTACCAGATTTTATTTG 
TTTCTCTTTTGAGATTTTCATGAGTGTATGTCTATTGGTTTTAACTGCATAGTATGCCAT 
CTTTCAACTTATTTTTGTAAACTGCACTTTCTAAAGGCCTGCACTCCTTTTCGTGACCTT 
TGAAACAGGTCTTACTGCAATTGTTGATTTAAGCTCATTTTTGTTTCTAGCAGGAGTCTG 
ACTGGGCGGGTTTGCAACATCTAATAAAGTTTTATAAGAGTAGAAGATTTGATGCAGAGA 
TTGGACTCCCCAAGTGAGATTGGAGCCTTTTAATTTTTGGACCTCTCTTTGGTAACCAGC 
AGAAGATTTCTCATAAAACTGATATTCTCCTTTCAGGCCGAATGACTTCCGCGATTTCCC 
AGAATATTTTGTGCTTGAGGTAGGAAATGAGCTTGATATAGTGTCACGCATTGATCTCAG 
ATGTTAGCTGGAGATGCTATGACGTGTCCTTTCGATATGACAGAAACTGTGTCTGCTCTA 
CTTAGCATATAAGTTGGGTATCTCCTTAAAAGTTTAGGCTACTAATTAATATGTCATGGT 
AAAATAGATAAAAGAATGAATGTTGAGCCAACAAAGAACATAATAGAAAATAACGAGCAT 
AAGGACACAAATATCCAGAAGCTTCCTTGTGTATTCAGCTTTTTAGGAAAATTCGTTATG 
CAGTGAGGGTGTGATTTCTTGTTTCTCTCTTCTTAGCCTGCTTTCCTCTGGGGGTTTCCA 
TTGTTATTCCCCTGCCTGAAACTATGGTTTGTAACAGTTTAACTCTTTTGTTTCACTCGG 
TTAGCGCCAGTGGTTCTTTGGTTATTGTTGAGTTAAATTCATTTCTTCTCTTGAACTTTG 
AACATTTCGTCTCTTGAATGTTTTATCTAAACTATTGTTATTTTCTACGTCTTAGGCCAT 
TCCACATGCCATTGCAATAGTTAGGGGTGCTGAGGGGAAAAGCCCTAGAGAAGCTGTTGA 
ATTTATCTTACAGCTTCTGAAGGTATACATCTCTATTGGGTAAATTTTGTGAAACCTTTG 
TTGCCTACTGATATAGCCTTTTTATAAAAGCTGTTAGTCTTTATTCGCTGCAGTGATTTC 
TTTCATCTATGAAAGATTAGGTGTTTCGCTTGTTTTCAGTCCATATTATCATCTTAACTG 
ATCTCGCCCTTTTTTTCCTATTCCATTTTATAGTACAATGACAACAGTGGGAATTCGTAT 
TCTGATGTATTCTGGCTTGCTGTGCTTGTTCAGTCAGTTGGTGATCTCGAATTCTGTCAG 
CAGGTCTGTGATCTTGTAAAAGACACTCTATGATTTATCTGTTGTAGTGTAATATTTATT 
TTTGTCTTTTCCTACTGACGCTATTAGGAGTAAAAAACCCTTGAATTTGGTACATAGAAA 
AGACAAGATTTGGTACTTAGCTCATGTATTATATAGCTATCAAAATTTTGAGGCTTCATT 
GGTTTATTTAGCTTTATGGAGGTCTCATACTTTTATGGAAAAAAAAACGATTTGGTCTCA 
TACTTTTATGACAAAAAATAAAGATTCCTATTATTCAGTTCATATGCAAAGATGTGGATT 
TTAGAACTTCAATATACCAGCTTTGCTACATGGTTAATGGTTAATTGCTCAATACTTCTT 
GCCTCTTTGTTTCCCTGGCAGAGTCTAACGTTTTTGGCCCCTCTTCTGAAGCGCATTGAC 
AGACTCTTGCAGTTTGACAGGTACCCTCATGTTTGATGTTAATGATTTGATAGGTTTTAA 
CAGAACTTATTACTGAGAGCTTGTTGGAGATAAATGTACTAGGTTGATGCCAAGCTACAA 
TGGCATCTTGACAATTAGCTGCATCCGAACATTGGCACAGACTGCTCTCAAGCTTTCTGA 
TTCCATCAGTTTCGTAAGTTCTTTCCTTTCGCTTTTTTCTTCCAATTGCTCCTTATGAGA 
TAGATACCAGCGGTGATTAAAAGCTTGCAATTTACTGACTTCAGGATCACATCTGTAAAC 
TTATTGAACCTTTCCGGAATTCGGATACAATATTGCAAATTCGTATAGAAGGAAGTAGGG 
CACTTCTTGACATCGAGTACCAATCCAAAGGCATAAGTTCCGCACTTTTGTTGTTTATGA 
AATATTTGGTAGAAGAATCATCTTTGAGAGGTTGGTTATATTCTCATGCTGGAACATAGC 
AGCTTTCTATTTCTAATAGAGTTCATTTATTGCTTTTATATCTTTGGCCCTTGATTACAG 
GGCAGGTAAAATTGTGTGTACACACAATGCGGTTATGTCAAATAGCAGTTGGATGTGACT 
CAGACGATTGTGTCGACACTGTTACTCTTCTGGATTTGCTGCATCTATTCAAGAGCCATG 
TAGTATTTAACAATGAACTTCTTCGCTACTACTTGTTCTGCATTTTTCAAATCCTCGCTG 
GAAGGTCTGTAGTTTACTTCCTTCAGTGGATTTTGTTTGGAATCCAGTTGTTCTATTTGA 
GCCTAGAGGGTTATTTTTCTCTGTTTTCTTCTGCTTATCACCATAATTATCCACATTCTG 
AACAGAATATACTTATTGTTGTCTCATTTTCAGACCCCCAACGTTGTTCGGAGTTCCCAA 
AGAAAAACCTTTGCAGCTTGTTGATGTGGAGGCCTGCATTGAACCGAAAAATGTATTTTT 
GGTTCCCGGAGCAGAGGCAGGGGAGCCTTCACTTTCGGCACTTGGAGATGCCAAAGGACA 
ATCGCTGGATGTTGCTCCTTATGGTGTTCCAATAATACCACAGGAAATGTTCATGCCTAT 
TGTTCCTGAACTGATGTTGCCAGAACCTGTTGCAGCGTATGATGAGACACAGCATCTTGA 
ACCTCGCATGGAAAGTCAAAACCAACCTTCACATGAAAATCCCATCGTTCATGAGATTCC 
ATCAGATGTTGAAGGTCCAACAGAAGAATTAGCTCATAGGGAAGCAAACCCTCCAACAAA 
GGAACCTCAAAAAGAACCTGATGTGGTTTCTGTGTCTGTTAGTCATGAGGTGAAGAAGTC 
TGTTATACGGATCAAGGTCAGACCATCTGGGGCAACCAGCAGAGCGGAAGGATCAGCACG 
AACTATAGAAAGATCTCAAGGGATTGTGGTACGCCATGATATAGACCGAGGTCAAACTAG 
TTCAGCTTCAGTGGACGCCCCACAGAGAATCTCAACTGACGCTGTGAGCATAAGCAATCA 
GAATCACGTGGAGGAAGTAAATTCGTGTCACGATGTTGGTTCTCGCATGACTGCAAGCAT 
CGGCAGTGTAAAATTTGCAAGCGAAGGCGATATTTTTGGGAAAGAGTTGCAATGCACTGC 
TGAGTCTGGGAAACCTTCGACAAGCCAGAAAGCAGATAATAACAACCGAACTGTACCACC 
TAGCTTCTTACCACTAGACCACAGTATGGAAAACGAGGCGCAGCAGAAATACGCGAGCCT 
CCAAACACTTTCGATTGGTAAAGAAAAGGAAAAGAAGAAAGACAAGGAAAAGAAAGAGAA 
GAAGAGGAAAAGAGAAGATCCCGTTTATCTAGAGAAGAAACGGTTAAAGAAAGAGAAGAA 
ACGAAAGGAGAAGGAAATGGCGAAGCTCGTGAGCAGCACTACGGATCCAGCTAAAAAGAA 
GATAGAGAGTGTTGCGGAGGTTAAAGAAGAAGAACCAAGTGATGGTGCCATGTTGATTAA 
GGTTGAACCAAAGACTGAACCATCAACAGCAGAAGCTAGACCGCTTCCCAAATTCCGAAT 
CAAACTGAAAAGCAAAGCGTTCAACAACTCATAAGGTTAGATCCGAGCCAGTCCCTCCCC 
GCCAAAATCTGAGTAGTAACTTTTATTTCCAAAAGCTTTGTTGTTACAACTTGCAAGGTG 
TTGTGATTATATGTCAATGTAATCTGTTTATTCAATGCGCTT
>AT1G73960.2 |  TAF2 (TBP-ASSOCIATED FACTOR 2) metallopeptidase/ zinc ion binding 
GCAAAAAAGGAACATGGCCAAGGCTCGAAAGCCGAAGAACGAGGAAGCTCCTGGCGCGAA 
GACTTCAGAGAACACTGGAGCTAAAGTTCTTCACCAGAAACTCTTTCTCTCTATTGACTT 
CAAAAAACGCCAAATCTACGGGTCCGTTTTCCTCTCTTTCTTTCGATTTTTCATTCGCGA 
AACAAGTCCGTGAATGTGATTTTTGGTTGATATATATAATTCGGGATGAAGAAACCGGCA 
GAATTTGAATCTTGCACCGACAGTATTCTTTGGATTTTTCAATTTATGGTGAATCCTCTG 
CTTTTGATTATTTGGGGTTTTACTTATATACCTTGGTTTTATCATTCTTGGCTGCATTTT 
CATGGGATATTTTTGTTGGCTTTCTATAGTTACACAGAGTTAGAAGTGAGTGTGCCAGAT 
ATTGGTATTGTGGGACTACACGCAGAGAACTTGGGAATTGAGAGTGTTTTGGTAGATGGG 
GAACCTACTGTATTTGAGTACTATCCGCACCATCAGAACTCTGAAACTGAAAGTAACTGG 
AACTCGGTCTCTGACCCAGCTTCAGCAGCTGATGCTGCGGCCATGGAATATGTCGGGGTT 
CTTAAGAGAGAAGACACTGCAAATTTACTGATCAACTGTTGCAAGCCTTCTAAGGATTTA 
TCTGAACAGCTGGACAGTGTGACTTTAGAAAACGGTTCCCAATCTTCAGGGGAGGCAAAA 
CAGGTAATTGTTCTGATTCTCATATACACTGCCATGGGTTACAAGTGACCGCTGTCCTTT 
GTTTAACGATTTATGTTTGCTCATATGATGCAGAATGTTAAATTGATTCGGATTAACTAC 
TGGGTAGAGAAAATAGAGTCAGGAATTCATTTTGATGGGAACATTGTACATACTGATAAC 
CAGATGAGACGTGCTCGTTGTTGGTTTCCTTGTATTGATGATGAGTACCATCGTTGCAGG 
TATTCAGTTTTGTTAAGAAGTAACACTGTATTCATCTCCTGTCTTTTGAGATCAAAGTGG 
GTATCACAACCTGTTTAACTTTTTTTTTTAATAACTTTGTGGTGGGTGCAGTTTCGATTT 
GGAATTCACTGTTCCGCACAACTTTGTGGCTGTTAGTGTTGGGAAATTACTCTACCAGGT 
AAGTTGTGTAAATCTGTCATACATGAATGGATTAGAGGAAGTGCTATTTTCTTCGATCCT 
GTATCTTACGTACAAGACATATTCCATTATAGATCTGGATTGAATGGAAAAACTTAGAAA 
AAGCTGTCATTCCCGTGACTTGTGGACGTAGGCATAAAATCTGCGTCCAAATTTGGTTTC 
AGCTTATATATGAAAGAAGCCATATCCAGTGCTGTTTAATCTGAAAGTGTACTATCTCTA 
TTTGCAAGGAAACTTGTTCATTGTTCTGTCCTTATATTATCAGAAGATTTTGCTGTTCAG 
TATAGTTATCTAATGAATCTGGATCAAACAGAAGAACTTTTTCTCTGTTATTGTAGGCAT 
ATAAGCTAAAACTTTGTTGAATAGGTTTACAGTTTCCATCATTCAATTTTATTAGTACTC 
TTACAAGGTGGAGGGGGCGTAATCTTTAAACTTTCACACTTTTCAGGTTATGTGCAAAGA 
AGATACTACTCAAAAAACGTATGTTTATGAACTAGCTATTCCTATTGCACCGCGGTGGGT 
GTCTTTAGTTGCAGGACCATTGGAAATCCTTCCAGATCAGACCAACTTTCTCATATCTAA 
CTTGTGTTTGCCGCATGATCTCTCGAGGCTTCGTAATACAATGGAATTTTTCCATGAAGC 
TTATAGGTCCGTAAATTTGTATTCTGGCAACTTATTGTAGTCAAACTGAATTAAAGTATA 
AGTCTTGTCTACTGGAATTCAACTTCTACAGCTACTATGAGGATTATTTAAGTGCGAACT 
TTCCATTTGGATTCTACAAGCAAGTATTTTTACCTCCTGAAATGGTTGTTACTTCGTCGA 
CTTCGGGAGCTTCCTTGAGTATCTTTAGCTCCCACATACTATATGATGAGAGGGTTATTG 
ATCAGGTATTGTTTCCTGGTAAATTGACCTGTGGGTAGATAATACCTTCATCAGACACAT 
GCACGTAAATGGTTTGTATATGCTAATATTAGGATGGAAGGCACACCAGACCTAATTTGT 
ATGATGCATTTTTGAAAAAAGTACAACCAAGCACGTGTCTGAGCATGTTAAATATATTTC 
TGCATTACCACTTATGAATATTGCAAGCTGCGTTCATCTATTTCTTGCATTTCACCCCTT 
CATTGGCATATGGATTTTGGTGTAGAAGTTTTCACTATGTTTATAGGAAGTTTTCTTTCT 
TTGGTGGTGTTTCGTCATCTTTTTAGTTCCTTTATGCAAAAATCTGATAGAGCTTCAATT 
ATCTTTGCAGACAATAGATACACGCATTAAACTTGCTTCTGCGTTAGCAAAACAGTGGTT 
TGGAGTTTATATTACTCCTGAATCACCAAATGATGGTGGGCTTGTGACATTTTTCTACAC 
TTTGATTTGCGTACGATTTGTTATATCAGCTTCATGTGAAAACATGTAATTTTGTGATTC 
ATGATTGTCCATGTTGTTATAACAGATTGGCTCCTTGATGGTCTTGCTGGTTTCTTAACG 
GATATGTTTATCAAGCAGTTTTTGGGAAATAATGAAGCACGATATCGGAGATACAAGGTT 
TATACCTACTACTCGAGTTATTCTTCCCTGACGCCTCTGTAACCATTTCTGAACTAAGCC 
ATGAACCTCATATCTGGATTCTCTTTTTTTTTTTTGATCCAATTGCAGGCAAATTGTGCT 
GTCTGTAAAGCTGATGATAGTGGTGCAATGTGCTTGAGCTCATCTCCTTCTTGCAGGGAC 
CTATTTGGAACTCATTCTATTGGAATGCATGGGAAGATACGATCATGGAAATCAGTAAGC 
CATATTTTTTCTTTTCATATTTATCATTCATGCTCTCACATTTTTGTAGGAGTGGATGAG 
TTCTTTGGGATAATTTACATGATTTTGCATCTGTTGTTTGTTACGAGTAATAATTATTCT 
CTCATTTTTGAAGGGAGCAGTCCTTCAGATGTTGGAGAAGCAAATGGGCTCAGACTCGTT 
TCGTAAAGTATGGTCATGGTGCTATCGTTTTTTCAGGAAATCACTTTGTTTGTTTTCTTA 
CGCATATGATTAATAGACCTTCTACATGATGATTTACAGATATTGCAGAAAATTATTTCT 
CGAGCCAAGGATCCATCTAATTCTATACGGTCTCTTAGCACGAAGGAGGTAACACGACTG 
TGTTTGTTTTACATGTTACGCTCGAAAAGATCCACATATTTCCTTTATTAAAGTTTTTGT 
GTTTTGATAAACCTCTTATTTTTAGTTGGTTAAGAAAAATAAATAAATATGAGAAAGTAT 
TTTGATCTTTCAGTATAAAGTATATATATGTGGGATAGTTGCGGTCCTAAGATAGTCATC 
TAGCGTAATCTTTTGGGTTAGCTGATAACACTAAAAGGTCAGGAAGAATTCTGGGATTTC 
TTCTTTGGGAGTTTTTCTTAACTAAATATTTTCGTTGCTCCTGGAGCATTTTTTTATTTA 
TCGAAATGGATCTGTCTCTTAGCTGTAACTTGATATACTTCACAAATGTCGTAAATGTGC 
CACTCGACCATAATGTGATACGGCCATTCATCCGTAACTTGGTTCAACAACTCATAACCT 
AATTGTTGACAAATATGAAGCATCTCCTCCATTTGTTGTATATTTCTCTTCGTGATCAAC 
CGATTATCTTTCAGCTTGAATTTTCGAAGTCAGTTCTAATATCTGTGTTTCTCAAATTTC 
ACTTTTGAGATGCAGTTCCGGCAATTTGCTAATAAGATTGGAAATCTTGAGCGTCCATTT 
CTTAAAGAATTTTTTCAGCGATGGGTTGCATCTTATGGTTGTCCCGTGCTAAGGTATTTT 
TTTTCTAATTAAGAGTTACGTTCTTCTGAACTTAGTTCAATGGATTCCTGGATCTTCATT 
TAATCTTATCTCGATGTTCTTACTGGTGCTTTATTAAACTAGGATTGGGTTGTCTTACAA 
CAAAAGGAAAAACAATGTTGAAATGGCTGCTCTGCGAGAATGCACGGCTGCACTGGATGC 
AAGATTATCAGTTATAGGGGCTACTTCTGATTCAGAAAGCCGGGATGTGGATGCTGGCTG 
GCCGGGTATTATGAGTATAAGGGTTTATGAACTCGATGGAATGTCTGATCATCCAAAGTT 
GCCTATGGCTGGAGATAGATGGCAGCTACTGGAATTACCATGTCATTCTAAACTTGCTGC 
TAAACGCTATCAAAAACCAAAGAAGGGAGGGAAACCTGATGGGGCTGAAGACAATGTTGA 
TGCTATAGCACCGTTAGAAAATAAAACGAGGTGGGTTTCTGTGGTACACTATTTCTGGCA 
TTCCTGGTCTGTTTACATACCTTGCAACAACACAAGAAAGAGAACTGAGACTCTGAGAGA 
TTGAATCTTTCTCTGTAGCATTGAATCTCCCTTGGCTTGGATTAAAGCTGACCCTGAGAT 
GGAATATATTGCTGAGATTCACCTTCATCAGCCCCTACAAATGTGGGTAAGAGATCTTCT 
CTGACACATCTTGAAAATCTATGGTGCACATCACAGTCGTTATTTCTTTCGCTTTCTACA 
TGGTTGGTTCGTGACAAGAAGCTCATGAACTAGTTTACTTAGGTATTATCTAACTGAGTC 
TTTCTGTGTGTTTTCTGTGTGTTGTGCTCTTACTTCTAGACATCTCAAAATCCTACATTG 
GTTACAGTTCATGTTTAATCGTTTCTCACACTTGTGGGTTTCTGTCACTTTTGATCAGGT 
CAATCAACTAGAGAAGGACGGAGATGTTGTTGCTCAGGCACAAGCAATTGCGTCACTTGA 
AGCCTTAAAACAACACTCCTTTTCCATTGTGAATGCACTCAAAAATGTCCTCACTGACTC 
CAAGGTTTAGTCCGTCTCTTGTGTACTTTTTCTCTAAAACCAGTTTGAAGATGAAGTTCT 
TGTCTCCAAAATATTATTGTGACATATAGGTCTTCTGGAGAATACGTATTGCGGCAGCGT 
TTGCATTGGCTAAAACAGCATCAGAGGTATGATAAAAATTGTTCAATCTTATGTTCCAAA 
GGGACAAGACGTATAATAATCAAATTTGTAACTTGATTTAAGTGCATAGTATGAAGGTTA 
GCAAAAGGCATTGATTCAAAAGTATAAGATTAGGAACCTTATATGTGCAAATTGTTATGT 
TTTTAGAGGAATAGAACCAGCTGAAATTTCACCATTTACAAGAAAACTTGTGGGAAAAGA 
ATTCCATTCATTCAGGTGAGAAAAATGATAAGGGAACAAATTTAATAGGAAACTTTGCAT 
TTACTACATTGCAGAAGTAATGAGTGGAAAAAAAATTCCTCTGATCTCAACATTCCTTTC 
ATCAATCTTCCATTCATCTTAATTTTCATTTATTTCTAGCATGTTACCAGATTTTATTTG 
TTTCTCTTTTGAGATTTTCATGAGTGTATGTCTATTGGTTTTAACTGCATAGTATGCCAT 
CTTTCAACTTATTTTTGTAAACTGCACTTTCTAAAGGCCTGCACTCCTTTTCGTGACCTT 
TGAAACAGGTCTTACTGCAATTGTTGATTTAAGCTCATTTTTGTTTCTAGCAGGAGTCTG 
ACTGGGCGGGTTTGCAACATCTAATAAAGTTTTATAAGAGTAGAAGATTTGATGCAGAGA 
TTGGACTCCCCAAGTGAGATTGGAGCCTTTTAATTTTTGGACCTCTCTTTGGTAACCAGC 
AGAAGATTTCTCATAAAACTGATATTCTCCTTTCAGGCCGAATGACTTCCGCGATTTCCC 
AGAATATTTTGTGCTTGAGGTAGGAAATGAGCTTGATATAGTGTCACGCATTGATCTCAG 
ATGTTAGCTGGAGATGCTATGACGTGTCCTTTCGATATGACAGAAACTGTGTCTGCTCTA 
CTTAGCATATAAGTTGGGTATCTCCTTAAAAGTTTAGGCTACTAATTAATATGTCATGGT 
AAAATAGATAAAAGAATGAATGTTGAGCCAACAAAGAACATAATAGAAAATAACGAGCAT 
AAGGACACAAATATCCAGAAGCTTCCTTGTGTATTCAGCTTTTTAGGAAAATTCGTTATG 
CAGTGAGGGTGTGATTTCTTGTTTCTCTCTTCTTAGCCTGCTTTCCTCTGGGGGTTTCCA 
TTGTTATTCCCCTGCCTGAAACTATGGTTTGTAACAGTTTAACTCTTTTGTTTCACTCGG 
TTAGCGCCAGTGGTTCTTTGGTTATTGTTGAGTTAAATTCATTTCTTCTCTTGAACTTTG 
AACATTTCGTCTCTTGAATGTTTTATCTAAACTATTGTTATTTTCTACGTCTTAGGCCAT 
TCCACATGCCATTGCAATAGTTAGGGGTGCTGAGGGGAAAAGCCCTAGAGAAGCTGTTGA 
ATTTATCTTACAGCTTCTGAAGGTATACATCTCTATTGGGTAAATTTTGTGAAACCTTTG 
TTGCCTACTGATATAGCCTTTTTATAAAAGCTGTTAGTCTTTATTCGCTGCAGTGATTTC 
TTTCATCTATGAAAGATTAGGTGTTTCGCTTGTTTTCAGTCCATATTATCATCTTAACTG 
ATCTCGCCCTTTTTTTCCTATTCCATTTTATAGTACAATGACAACAGTGGGAATTCGTAT 
TCTGATGTATTCTGGCTTGCTGTGCTTGTTCAGTCAGTTGGTGATCTCGAATTCTGTCAG 
CAGGTCTGTGATCTTGTAAAAGACACTCTATGATTTATCTGTTGTAGTGTAATATTTATT 
TTTGTCTTTTCCTACTGACGCTATTAGGAGTAAAAAACCCTTGAATTTGGTACATAGAAA 
AGACAAGATTTGGTACTTAGCTCATGTATTATATAGCTATCAAAATTTTGAGGCTTCATT 
GGTTTATTTAGCTTTATGGAGGTCTCATACTTTTATGGAAAAAAAAACGATTTGGTCTCA 
TACTTTTATGACAAAAAATAAAGATTCCTATTATTCAGTTCATATGCAAAGATGTGGATT 
TTAGAACTTCAATATACCAGCTTTGCTACATGGTTAATGGTTAATTGCTCAATACTTCTT 
GCCTCTTTGTTTCCCTGGCAGAGTCTAACGTTTTTGGCCCCTCTTCTGAAGCGCATTGAC 
AGACTCTTGCAGTTTGACAGGTACCCTCATGTTTGATGTTAATGATTTGATAGGTTTTAA 
CAGAACTTATTACTGAGAGCTTGTTGGAGATAAATGTACTAGGTTGATGCCAAGCTACAA 
TGGCATCTTGACAATTAGCTGCATCCGAACATTGGCACAGACTGCTCTCAAGCTTTCTGA 
TTCCATCAGTTTCGTAAGTTCTTTCCTTTCGCTTTTTTCTTCCAATTGCTCCTTATGAGA 
TAGATACCAGCGGTGATTAAAAGCTTGCAATTTACTGACTTCAGGATCACATCTGTAAAC 
TTATTGAACCTTTCCGGAATTCGGATACAATATTGCAAATTCGTATAGAAGGAAGTAGGG 
CACTTCTTGACATCGAGTACCAATCCAAAGGCATAAGTTCCGCACTTTTGTTGTTTATGA 
AATATTTGGTAGAAGAATCATCTTTGAGAGGTTGGTTATATTCTCATGCTGGAACATAGC 
AGCTTTCTATTTCTAATAGAGTTCATTTATTGCTTTTATATCTTTGGCCCTTGATTACAG 
GGCAGGTAAAATTGTGTGTACACACAATGCGGTTATGTCAAATAGCAGTTGGATGTGACT 
CAGACGATTGTGTCGACACTGTTACTCTTCTGGATTTGCTGCATCTATTCAAGAGCCATG 
TAGTATTTAACAATGAACTTCTTCGCTACTACTTGTTCTGCATTTTTCAAATCCTCGCTG 
GAAGGTCTGTAGTTTACTTCCTTCAGTGGATTTTGTTTGGAATCCAGTTGTTCTATTTGA 
GCCTAGAGGGTTATTTTTCTCTGTTTTCTTCTGCTTATCACCATAATTATCCACATTCTG 
AACAGAATATACTTATTGTTGTCTCATTTTCAGACCCCCAACGTTGTTCGGAGTTCCCAA 
AGAAAAACCTTTGCAGCTTGTTGATGTGGAGGCCTGCATTGAACCGAAAAATGTATTTTT 
GGTTCCCGGAGCAGAGGCAGGGGAGCCTTCACTTTCGGCACTTGGAGATGCCAAAGGACA 
ATCGCTGGATGTTGCTCCTTATGGTGTTCCAATAATACCACAGGAAATGTTCATGCCTAT 
TGTTCCTGAACTGATGTTGCCAGAACCTGTTGCAGCGTATGATGAGACACAGCATCTTGA 
ACCTCGCATGGAAAGTCAAAACCAACCTTCACATGAAAATCCCATCGTTCATGAGATTCC 
ATCAGATGTTGAAGGTCCAACAGAAGAATTAGCTCATAGGGAAGCAAACCCTCCAACAAA 
GGAACCTCAAAAAGAACCTGATGTGGTTTCTGTGTCTGTTAGTCATGAGGTGAAGAAGTC 
TGTTATACGGATCAAGGTCAGACCATCTGGGGCAACCAGCAGAGCGGAAGGATCAGCACG 
AACTATAGAAAGATCTCAAGGGATTGTGGTACGCCATGATATAGACCGAGGTCAAACTAG 
TTCAGCTTCAGTGGACGCCCCACAGAGAATCTCAACTGACGCTGTGAGCATAAGCAATCA 
GAATCACGTGGAGGAAGTAAATTCGTGTCACGATGTTGGTTCTCGCATGACTGCAAGCAT 
CGGCAGTGTAAAATTTGCAAGCGAAGGCGATATTTTTGGGAAAGAGTTGCAATGCACTGC 
TGAGTCTGGGAAACCTTCGACAAGCCAGAAAGCAGATAATAACAACCGAACTGTACCACC 
TAGCTTCTTACCACTAGACCACAGTATGGAAAACGAGGCGCAGCAGAAATACGCGAGCCT 
CCAAACACTTTCGATTGGTAAAGAAAAGGAAAAGAAGAAAGACAAGGAAAAGAAAGAGAA 
GAAGAGGAAAAGAGAAGATCCCGTTTATCTAGAGAAGAAACGGTTAAAGAAAGAGAAGAA 
ACGAAAGGAGAAGGAAATGGCGAAGCTCGTGAGCAGCACTACGGATCCAGCTAAAAAGAA 
GATAGAGAGTGTTGCGGAGGTTAAAGAAGAAGAACCAAGTGATGGTGCCATGTTGATTAA 
GGTTGAACCAAAGACTGAACCATCAACAGCAGAAGCTAGACCGCTTCCCAAATTCCGAAT 
CAAACTGAAAAGCAAAGCGTTCAACAACTCATAAGGTTAGATCCGAGCCAGTCCCTCCCC 
GCCAAAATCTGAGTAGTAACTTTTATTTCCAAAAGCTTTGTTGTTACAACTTGCAAGGTG 
TTGTGATTATATGTCAATGTAATCTGTTTATTCAATGCGCTT
>AT1G73960.2 |  TAF2 (TBP-ASSOCIATED FACTOR 2) metallopeptidase/ zinc ion binding 
GCAAAAAAGGAACATGGCCAAGGCTCGAAAGCCGAAGAACGAGGAAGCTCCTGGCGCGAA 
GACTTCAGAGAACACTGGAGCTAAAGTTCTTCACCAGAAACTCTTTCTCTCTATTGACTT 
CAAAAAACGCCAAATCTACGGGTCCGTTTTCCTCTCTTTCTTTCGATTTTTCATTCGCGA 
AACAAGTCCGTGAATGTGATTTTTGGTTGATATATATAATTCGGGATGAAGAAACCGGCA 
GAATTTGAATCTTGCACCGACAGTATTCTTTGGATTTTTCAATTTATGGTGAATCCTCTG 
CTTTTGATTATTTGGGGTTTTACTTATATACCTTGGTTTTATCATTCTTGGCTGCATTTT 
CATGGGATATTTTTGTTGGCTTTCTATAGTTACACAGAGTTAGAAGTGAGTGTGCCAGAT 
ATTGGTATTGTGGGACTACACGCAGAGAACTTGGGAATTGAGAGTGTTTTGGTAGATGGG 
GAACCTACTGTATTTGAGTACTATCCGCACCATCAGAACTCTGAAACTGAAAGTAACTGG 
AACTCGGTCTCTGACCCAGCTTCAGCAGCTGATGCTGCGGCCATGGAATATGTCGGGGTT 
CTTAAGAGAGAAGACACTGCAAATTTACTGATCAACTGTTGCAAGCCTTCTAAGGATTTA 
TCTGAACAGCTGGACAGTGTGACTTTAGAAAACGGTTCCCAATCTTCAGGGGAGGCAAAA 
CAGGTAATTGTTCTGATTCTCATATACACTGCCATGGGTTACAAGTGACCGCTGTCCTTT 
GTTTAACGATTTATGTTTGCTCATATGATGCAGAATGTTAAATTGATTCGGATTAACTAC 
TGGGTAGAGAAAATAGAGTCAGGAATTCATTTTGATGGGAACATTGTACATACTGATAAC 
CAGATGAGACGTGCTCGTTGTTGGTTTCCTTGTATTGATGATGAGTACCATCGTTGCAGG 
TATTCAGTTTTGTTAAGAAGTAACACTGTATTCATCTCCTGTCTTTTGAGATCAAAGTGG 
GTATCACAACCTGTTTAACTTTTTTTTTTAATAACTTTGTGGTGGGTGCAGTTTCGATTT 
GGAATTCACTGTTCCGCACAACTTTGTGGCTGTTAGTGTTGGGAAATTACTCTACCAGGT 
AAGTTGTGTAAATCTGTCATACATGAATGGATTAGAGGAAGTGCTATTTTCTTCGATCCT 
GTATCTTACGTACAAGACATATTCCATTATAGATCTGGATTGAATGGAAAAACTTAGAAA 
AAGCTGTCATTCCCGTGACTTGTGGACGTAGGCATAAAATCTGCGTCCAAATTTGGTTTC 
AGCTTATATATGAAAGAAGCCATATCCAGTGCTGTTTAATCTGAAAGTGTACTATCTCTA 
TTTGCAAGGAAACTTGTTCATTGTTCTGTCCTTATATTATCAGAAGATTTTGCTGTTCAG 
TATAGTTATCTAATGAATCTGGATCAAACAGAAGAACTTTTTCTCTGTTATTGTAGGCAT 
ATAAGCTAAAACTTTGTTGAATAGGTTTACAGTTTCCATCATTCAATTTTATTAGTACTC 
TTACAAGGTGGAGGGGGCGTAATCTTTAAACTTTCACACTTTTCAGGTTATGTGCAAAGA 
AGATACTACTCAAAAAACGTATGTTTATGAACTAGCTATTCCTATTGCACCGCGGTGGGT 
GTCTTTAGTTGCAGGACCATTGGAAATCCTTCCAGATCAGACCAACTTTCTCATATCTAA 
CTTGTGTTTGCCGCATGATCTCTCGAGGCTTCGTAATACAATGGAATTTTTCCATGAAGC 
TTATAGGTCCGTAAATTTGTATTCTGGCAACTTATTGTAGTCAAACTGAATTAAAGTATA 
AGTCTTGTCTACTGGAATTCAACTTCTACAGCTACTATGAGGATTATTTAAGTGCGAACT 
TTCCATTTGGATTCTACAAGCAAGTATTTTTACCTCCTGAAATGGTTGTTACTTCGTCGA 
CTTCGGGAGCTTCCTTGAGTATCTTTAGCTCCCACATACTATATGATGAGAGGGTTATTG 
ATCAGGTATTGTTTCCTGGTAAATTGACCTGTGGGTAGATAATACCTTCATCAGACACAT 
GCACGTAAATGGTTTGTATATGCTAATATTAGGATGGAAGGCACACCAGACCTAATTTGT 
ATGATGCATTTTTGAAAAAAGTACAACCAAGCACGTGTCTGAGCATGTTAAATATATTTC 
TGCATTACCACTTATGAATATTGCAAGCTGCGTTCATCTATTTCTTGCATTTCACCCCTT 
CATTGGCATATGGATTTTGGTGTAGAAGTTTTCACTATGTTTATAGGAAGTTTTCTTTCT 
TTGGTGGTGTTTCGTCATCTTTTTAGTTCCTTTATGCAAAAATCTGATAGAGCTTCAATT 
ATCTTTGCAGACAATAGATACACGCATTAAACTTGCTTCTGCGTTAGCAAAACAGTGGTT 
TGGAGTTTATATTACTCCTGAATCACCAAATGATGGTGGGCTTGTGACATTTTTCTACAC 
TTTGATTTGCGTACGATTTGTTATATCAGCTTCATGTGAAAACATGTAATTTTGTGATTC 
ATGATTGTCCATGTTGTTATAACAGATTGGCTCCTTGATGGTCTTGCTGGTTTCTTAACG 
GATATGTTTATCAAGCAGTTTTTGGGAAATAATGAAGCACGATATCGGAGATACAAGGTT 
TATACCTACTACTCGAGTTATTCTTCCCTGACGCCTCTGTAACCATTTCTGAACTAAGCC 
ATGAACCTCATATCTGGATTCTCTTTTTTTTTTTTGATCCAATTGCAGGCAAATTGTGCT 
GTCTGTAAAGCTGATGATAGTGGTGCAATGTGCTTGAGCTCATCTCCTTCTTGCAGGGAC 
CTATTTGGAACTCATTCTATTGGAATGCATGGGAAGATACGATCATGGAAATCAGTAAGC 
CATATTTTTTCTTTTCATATTTATCATTCATGCTCTCACATTTTTGTAGGAGTGGATGAG 
TTCTTTGGGATAATTTACATGATTTTGCATCTGTTGTTTGTTACGAGTAATAATTATTCT 
CTCATTTTTGAAGGGAGCAGTCCTTCAGATGTTGGAGAAGCAAATGGGCTCAGACTCGTT 
TCGTAAAGTATGGTCATGGTGCTATCGTTTTTTCAGGAAATCACTTTGTTTGTTTTCTTA 
CGCATATGATTAATAGACCTTCTACATGATGATTTACAGATATTGCAGAAAATTATTTCT 
CGAGCCAAGGATCCATCTAATTCTATACGGTCTCTTAGCACGAAGGAGGTAACACGACTG 
TGTTTGTTTTACATGTTACGCTCGAAAAGATCCACATATTTCCTTTATTAAAGTTTTTGT 
GTTTTGATAAACCTCTTATTTTTAGTTGGTTAAGAAAAATAAATAAATATGAGAAAGTAT 
TTTGATCTTTCAGTATAAAGTATATATATGTGGGATAGTTGCGGTCCTAAGATAGTCATC 
TAGCGTAATCTTTTGGGTTAGCTGATAACACTAAAAGGTCAGGAAGAATTCTGGGATTTC 
TTCTTTGGGAGTTTTTCTTAACTAAATATTTTCGTTGCTCCTGGAGCATTTTTTTATTTA 
TCGAAATGGATCTGTCTCTTAGCTGTAACTTGATATACTTCACAAATGTCGTAAATGTGC 
CACTCGACCATAATGTGATACGGCCATTCATCCGTAACTTGGTTCAACAACTCATAACCT 
AATTGTTGACAAATATGAAGCATCTCCTCCATTTGTTGTATATTTCTCTTCGTGATCAAC 
CGATTATCTTTCAGCTTGAATTTTCGAAGTCAGTTCTAATATCTGTGTTTCTCAAATTTC 
ACTTTTGAGATGCAGTTCCGGCAATTTGCTAATAAGATTGGAAATCTTGAGCGTCCATTT 
CTTAAAGAATTTTTTCAGCGATGGGTTGCATCTTATGGTTGTCCCGTGCTAAGGTATTTT 
TTTTCTAATTAAGAGTTACGTTCTTCTGAACTTAGTTCAATGGATTCCTGGATCTTCATT 
TAATCTTATCTCGATGTTCTTACTGGTGCTTTATTAAACTAGGATTGGGTTGTCTTACAA 
CAAAAGGAAAAACAATGTTGAAATGGCTGCTCTGCGAGAATGCACGGCTGCACTGGATGC 
AAGATTATCAGTTATAGGGGCTACTTCTGATTCAGAAAGCCGGGATGTGGATGCTGGCTG 
GCCGGGTATTATGAGTATAAGGGTTTATGAACTCGATGGAATGTCTGATCATCCAAAGTT 
GCCTATGGCTGGAGATAGATGGCAGCTACTGGAATTACCATGTCATTCTAAACTTGCTGC 
TAAACGCTATCAAAAACCAAAGAAGGGAGGGAAACCTGATGGGGCTGAAGACAATGTTGA 
TGCTATAGCACCGTTAGAAAATAAAACGAGGTGGGTTTCTGTGGTACACTATTTCTGGCA 
TTCCTGGTCTGTTTACATACCTTGCAACAACACAAGAAAGAGAACTGAGACTCTGAGAGA 
TTGAATCTTTCTCTGTAGCATTGAATCTCCCTTGGCTTGGATTAAAGCTGACCCTGAGAT 
GGAATATATTGCTGAGATTCACCTTCATCAGCCCCTACAAATGTGGGTAAGAGATCTTCT 
CTGACACATCTTGAAAATCTATGGTGCACATCACAGTCGTTATTTCTTTCGCTTTCTACA 
TGGTTGGTTCGTGACAAGAAGCTCATGAACTAGTTTACTTAGGTATTATCTAACTGAGTC 
TTTCTGTGTGTTTTCTGTGTGTTGTGCTCTTACTTCTAGACATCTCAAAATCCTACATTG 
GTTACAGTTCATGTTTAATCGTTTCTCACACTTGTGGGTTTCTGTCACTTTTGATCAGGT 
CAATCAACTAGAGAAGGACGGAGATGTTGTTGCTCAGGCACAAGCAATTGCGTCACTTGA 
AGCCTTAAAACAACACTCCTTTTCCATTGTGAATGCACTCAAAAATGTCCTCACTGACTC 
CAAGGTTTAGTCCGTCTCTTGTGTACTTTTTCTCTAAAACCAGTTTGAAGATGAAGTTCT 
TGTCTCCAAAATATTATTGTGACATATAGGTCTTCTGGAGAATACGTATTGCGGCAGCGT 
TTGCATTGGCTAAAACAGCATCAGAGGTATGATAAAAATTGTTCAATCTTATGTTCCAAA 
GGGACAAGACGTATAATAATCAAATTTGTAACTTGATTTAAGTGCATAGTATGAAGGTTA 
GCAAAAGGCATTGATTCAAAAGTATAAGATTAGGAACCTTATATGTGCAAATTGTTATGT 
TTTTAGAGGAATAGAACCAGCTGAAATTTCACCATTTACAAGAAAACTTGTGGGAAAAGA 
ATTCCATTCATTCAGGTGAGAAAAATGATAAGGGAACAAATTTAATAGGAAACTTTGCAT 
TTACTACATTGCAGAAGTAATGAGTGGAAAAAAAATTCCTCTGATCTCAACATTCCTTTC 
ATCAATCTTCCATTCATCTTAATTTTCATTTATTTCTAGCATGTTACCAGATTTTATTTG 
TTTCTCTTTTGAGATTTTCATGAGTGTATGTCTATTGGTTTTAACTGCATAGTATGCCAT 
CTTTCAACTTATTTTTGTAAACTGCACTTTCTAAAGGCCTGCACTCCTTTTCGTGACCTT 
TGAAACAGGTCTTACTGCAATTGTTGATTTAAGCTCATTTTTGTTTCTAGCAGGAGTCTG 
ACTGGGCGGGTTTGCAACATCTAATAAAGTTTTATAAGAGTAGAAGATTTGATGCAGAGA 
TTGGACTCCCCAAGTGAGATTGGAGCCTTTTAATTTTTGGACCTCTCTTTGGTAACCAGC 
AGAAGATTTCTCATAAAACTGATATTCTCCTTTCAGGCCGAATGACTTCCGCGATTTCCC 
AGAATATTTTGTGCTTGAGGTAGGAAATGAGCTTGATATAGTGTCACGCATTGATCTCAG 
ATGTTAGCTGGAGATGCTATGACGTGTCCTTTCGATATGACAGAAACTGTGTCTGCTCTA 
CTTAGCATATAAGTTGGGTATCTCCTTAAAAGTTTAGGCTACTAATTAATATGTCATGGT 
AAAATAGATAAAAGAATGAATGTTGAGCCAACAAAGAACATAATAGAAAATAACGAGCAT 
AAGGACACAAATATCCAGAAGCTTCCTTGTGTATTCAGCTTTTTAGGAAAATTCGTTATG 
CAGTGAGGGTGTGATTTCTTGTTTCTCTCTTCTTAGCCTGCTTTCCTCTGGGGGTTTCCA 
TTGTTATTCCCCTGCCTGAAACTATGGTTTGTAACAGTTTAACTCTTTTGTTTCACTCGG 
TTAGCGCCAGTGGTTCTTTGGTTATTGTTGAGTTAAATTCATTTCTTCTCTTGAACTTTG 
AACATTTCGTCTCTTGAATGTTTTATCTAAACTATTGTTATTTTCTACGTCTTAGGCCAT 
TCCACATGCCATTGCAATAGTTAGGGGTGCTGAGGGGAAAAGCCCTAGAGAAGCTGTTGA 
ATTTATCTTACAGCTTCTGAAGGTATACATCTCTATTGGGTAAATTTTGTGAAACCTTTG 
TTGCCTACTGATATAGCCTTTTTATAAAAGCTGTTAGTCTTTATTCGCTGCAGTGATTTC 
TTTCATCTATGAAAGATTAGGTGTTTCGCTTGTTTTCAGTCCATATTATCATCTTAACTG 
ATCTCGCCCTTTTTTTCCTATTCCATTTTATAGTACAATGACAACAGTGGGAATTCGTAT 
TCTGATGTATTCTGGCTTGCTGTGCTTGTTCAGTCAGTTGGTGATCTCGAATTCTGTCAG 
CAGGTCTGTGATCTTGTAAAAGACACTCTATGATTTATCTGTTGTAGTGTAATATTTATT 
TTTGTCTTTTCCTACTGACGCTATTAGGAGTAAAAAACCCTTGAATTTGGTACATAGAAA 
AGACAAGATTTGGTACTTAGCTCATGTATTATATAGCTATCAAAATTTTGAGGCTTCATT 
GGTTTATTTAGCTTTATGGAGGTCTCATACTTTTATGGAAAAAAAAACGATTTGGTCTCA 
TACTTTTATGACAAAAAATAAAGATTCCTATTATTCAGTTCATATGCAAAGATGTGGATT 
TTAGAACTTCAATATACCAGCTTTGCTACATGGTTAATGGTTAATTGCTCAATACTTCTT 
GCCTCTTTGTTTCCCTGGCAGAGTCTAACGTTTTTGGCCCCTCTTCTGAAGCGCATTGAC 
AGACTCTTGCAGTTTGACAGGTACCCTCATGTTTGATGTTAATGATTTGATAGGTTTTAA 
CAGAACTTATTACTGAGAGCTTGTTGGAGATAAATGTACTAGGTTGATGCCAAGCTACAA 
TGGCATCTTGACAATTAGCTGCATCCGAACATTGGCACAGACTGCTCTCAAGCTTTCTGA 
TTCCATCAGTTTCGTAAGTTCTTTCCTTTCGCTTTTTTCTTCCAATTGCTCCTTATGAGA 
TAGATACCAGCGGTGATTAAAAGCTTGCAATTTACTGACTTCAGGATCACATCTGTAAAC 
TTATTGAACCTTTCCGGAATTCGGATACAATATTGCAAATTCGTATAGAAGGAAGTAGGG 
CACTTCTTGACATCGAGTACCAATCCAAAGGCATAAGTTCCGCACTTTTGTTGTTTATGA 
AATATTTGGTAGAAGAATCATCTTTGAGAGGTTGGTTATATTCTCATGCTGGAACATAGC 
AGCTTTCTATTTCTAATAGAGTTCATTTATTGCTTTTATATCTTTGGCCCTTGATTACAG 
GGCAGGTAAAATTGTGTGTACACACAATGCGGTTATGTCAAATAGCAGTTGGATGTGACT 
CAGACGATTGTGTCGACACTGTTACTCTTCTGGATTTGCTGCATCTATTCAAGAGCCATG 
TAGTATTTAACAATGAACTTCTTCGCTACTACTTGTTCTGCATTTTTCAAATCCTCGCTG 
GAAGGTCTGTAGTTTACTTCCTTCAGTGGATTTTGTTTGGAATCCAGTTGTTCTATTTGA 
GCCTAGAGGGTTATTTTTCTCTGTTTTCTTCTGCTTATCACCATAATTATCCACATTCTG 
AACAGAATATACTTATTGTTGTCTCATTTTCAGACCCCCAACGTTGTTCGGAGTTCCCAA 
AGAAAAACCTTTGCAGCTTGTTGATGTGGAGGCCTGCATTGAACCGAAAAATGTATTTTT 
GGTTCCCGGAGCAGAGGCAGGGGAGCCTTCACTTTCGGCACTTGGAGATGCCAAAGGACA 
ATCGCTGGATGTTGCTCCTTATGGTGTTCCAATAATACCACAGGAAATGTTCATGCCTAT 
TGTTCCTGAACTGATGTTGCCAGAACCTGTTGCAGCGTATGATGAGACACAGCATCTTGA 
ACCTCGCATGGAAAGTCAAAACCAACCTTCACATGAAAATCCCATCGTTCATGAGATTCC 
ATCAGATGTTGAAGGTCCAACAGAAGAATTAGCTCATAGGGAAGCAAACCCTCCAACAAA 
GGAACCTCAAAAAGAACCTGATGTGGTTTCTGTGTCTGTTAGTCATGAGGTGAAGAAGTC 
TGTTATACGGATCAAGGTCAGACCATCTGGGGCAACCAGCAGAGCGGAAGGATCAGCACG 
AACTATAGAAAGATCTCAAGGGATTGTGGTACGCCATGATATAGACCGAGGTCAAACTAG 
TTCAGCTTCAGTGGACGCCCCACAGAGAATCTCAACTGACGCTGTGAGCATAAGCAATCA 
GAATCACGTGGAGGAAGTAAATTCGTGTCACGATGTTGGTTCTCGCATGACTGCAAGCAT 
CGGCAGTGTAAAATTTGCAAGCGAAGGCGATATTTTTGGGAAAGAGTTGCAATGCACTGC 
TGAGTCTGGGAAACCTTCGACAAGCCAGAAAGCAGATAATAACAACCGAACTGTACCACC 
TAGCTTCTTACCACTAGACCACAGTATGGAAAACGAGGCGCAGCAGAAATACGCGAGCCT 
CCAAACACTTTCGATTGGTAAAGAAAAGGAAAAGAAGAAAGACAAGGAAAAGAAAGAGAA 
GAAGAGGAAAAGAGAAGATCCCGTTTATCTAGAGAAGAAACGGTTAAAGAAAGAGAAGAA 
ACGAAAGGAGAAGGAAATGGCGAAGCTCGTGAGCAGCACTACGGATCCAGCTAAAAAGAA 
GATAGAGAGTGTTGCGGAGGTTAAAGAAGAAGAACCAAGTGATGGTGCCATGTTGATTAA 
GGTTGAACCAAAGACTGAACCATCAACAGCAGAAGCTAGACCGCTTCCCAAATTCCGAAT 
CAAACTGAAAAGCAAAGCGTTCAACAACTCATAAGGTTAGATCCGAGCCAGTCCCTCCCC 
GCCAAAATCTGAGTAGTAACTTTTATTTCCAAAAGCTTTGTTGTTACAACTTGCAAGGTG 
TTGTGATTATATGTCAATGTAATCTGTTTATTCAATGCGCTT
>AT3G56640.1 |  exocyst complex subunit Sec15-like family protein 
ATGGAGGCCAAACCAAAAAGGAGGATTGTTACAGAGAATGGAGATACAGGTGAAGATTTA 
GTTCTTGCAACATTGATTGGAAACGGTGATGATGTAGGTCCTCTCGTTAGGCATGCTTTC 
GAAATGGGGAGGCCTGAGCCTCTCGTTCATCAGCTCAAAAATGTGGCGAGGAAGAAGGAA 
GCTGAAATTGAGGATCTATGCAAGACTCACTATGAAGAATTTATTGTTGCAGTTGATGAG 
CTTCGTGGTGTGTTAGTTGACGCTGAAGAGCTTAAGAGTGATCTTGCAAGTGACAATTTC 
CGTTTGCAAGAGGTTGGTAGTGCCTTATTGGTTAAACTGGAAGAGCTTCTCGAGTCTTAT 
GCAGTCAAGAAGAATGTAACCGAAGCTATTAAAATGTCGAAGATCTGCGTTCAAGCACTG 
GAGTTGTGTGTTAAATGTAATAGTTACATATCTGAAGGACAGTTTTACCATGCCCTGAAA 
ACCATGGATTTGATTGAGAAGAGTTACCTGAAGCTTATCCCACTTAAGGTTCTAAAGTTG 
GTTATAGAGAGAAGAATTCCAGTGATCAAGACTCACATTGAGAAAAAAGTGTGTAGCCAA 
TTTAATGAATGGCTTGTTCACATTAGGAGTTCCTCTAAAAATATTGGACAGACTGCTATT 
GGCCTCACCGCTTCAGCTCGCCAGAGGGAAGAAGAAATGCTGGAACGTCAGAGGAGAGCA 
GAGGAACAGAATACAGGTGGTTTGGGAGAATTGGCATACACTTTAGATGTTGAAGACTCG 
GAACAAGACTCTGTATTGAAGTTTGATCTGACACCTCTGTATCGAGCTTATCACATCCAC 
ACTATTCTTGGAGTCCCAGAACGGTTCCGTGACTATTACTATGAGAATAGGCTACTACAG 
CTCCAATCAGATCTGCAGATCACTTATACACAGCCATTTGTGGAATCATACCAAACATTT 
CTAGCCCAGGTTGCAGGATATTTCATTGTGGAGGATCGGGTGATTAGGACAGCTGGAGAT 
TTCTTGTTGGCTGATCAAGTTGAGACAATGTGGGAAACAGCCATTTCCAAAATTGTAGCC 
ATATTGGAGAACCAATTTGCCAGAATGGATTCGCCTACTCATCTGCTTTTGGTGAAAGAT 
TATGTAACTCTCCTTGGCACAACCCTTAGACAGTACGGTTATGAAGTGGGTCCAGTTCTT 
GATGCCCTTGACAAGAGCCGAGATAAATACCACGAGCTTCTTCTTGAAGAGTGTCGAAAG 
CAAATTGTGACTGCTATTACAGAGGACACTTATCAGCAGATGGTAATCAAGAAGGAAGCT 
GACTATGAAAACAATGTCTTGTCGTTTAATCTTCAGACCTCAGACATTATGCCGGCTTTC 
ACTTACATTGCGCCCTTCTCTTCTATGGTGCCAGATGTTTGCCGCATCATCAGGTCATAC 
ATAAAAGGATCTGTTGATTACTTGTCCTATGGAGTGAACACTAATTTTTTCAGTGTTCTG 
AGGAAGTACCTCGACAAAATCTTGATTGATGTATTGAACGAAGTTATCCTCGAGACGATT 
AGCAACAATTCAATTGGTGTATCTCAAGCTATGCAGATTGCAGCAAACATATCTTTCCTC 
GAAAAGGCCAGTGATTATTTTCTCCGACATGCAGCTCAACTTTGTGGCATCCCAAGCCGA 
TCAGTTGAGAGGCCTCAAGCTAGTTTAGCTGCAAAGGTTGTCCTCAAAACATCAAGAGAC 
GCAGCCTATCTTGCTTTGTTGAATGTGGTTAACACCAAGTTGGACGAGTTCATGAAGCTC 
ACAGAAAATGTTAACTGGACTACAGAGGAAATGCCACAAGGGCCGCACGAGTACATAAAC 
GAGGTTGTTATATACCTCGAGACTGTTATGTCAACGGCACAACAGATCCTCCCAATGGAT 
GCCTTATACAAAGTTGGAGTTGGGGCTATCGAACATATCTCAAACTCCATCGTCTCTACA 
TTCCTCAGCGATAGCATCAAGAGATTCAATGCTAATGCAGTCTCGGCCATTAACCACGAT 
CTGAGAGTGATAGAAAACTTTGCTGATGAGAGATATCACTCAAGCGGGTTAAATGAGATC 
TACAAAGAAGGAAGCTTTAGAAGCTATCTGGTTGAAGCTAGGCAGTTGATAAACCTGTTG 
TCGAGTAGCCAACCCGAGAACTTCATGAACCCGGTGATTAGAGAGAGGAACTACAACACT 
TTGGATTACAAGAAAGTGGCTACGATCTGCGAGAAGTTTAAGGATTCTGCAGACGGGATA 
TTCGGAAGCCTGGCTAATAGAAACACAAAGCTGACAGCCAAGAAGAAATCGATGGACATG 
CTCAAGAAGAGACTCAAGGAATTTAACTGA
>AT2G16940.1 |  RNA recognition motif (RRM)-containing protein 
ACAGAGAGTTAGCGACCACCTCACAAGCTTCTTCGTCTCCTTCACAGAGCTTTATTCTTG 
CCCTAGAGATACCGAGCGGGAGATTCCAGATTGAGAGCAGCTTCGAGTCTCTCTCTCCTC 
GCCGTTCCTTTTCGCTTCTTCAAGTTTCGTTGCCAGAGAGGTAAGTACCGAGTTGCCAAT 
TCGCCTTTTCAATTTCAATCTGAAATTCGCCGTATCGGAGGAATTTGACTGTGGAACCGA 
ATTAGACAGTTGCCGTATGAATAATGTTTCCATTGGGAGTGACTGATGTTGAGGTTGTGC 
TTGTTATTCTACTAATCTACCTTTCTTTTCTAGATTCTAGGTATTGAAGTTATAGAATGG 
ACTTTGATGAGTATGAGTACTTAGAGAAGACAGTTGAAAATCCTCACCTGGAGAATGAAG 
TTGGTAATGGTGGTGGTGATGAGAAAGTCAAATCTGAAGGGAAAGAGAGGAGTAGGAGCT 
CAAGGCATAGGGGTGACAAGAAGAAGGAGAGGGATGAAGATGAGGATGGTCGGCGTTCTA 
AGCGGTCGAGATCGCATCACCGTTCACGTTCTAGGGACAGAGAGAGGGATAGGCATAGAA 
GTAGCAGGGAGCACAGAGATAGAGATCGTGAAAAGGATGTAGATAAAGAAGAAAGAAATG 
GGAAAGATAGAGAGAGGGACAGAGATAAGGATCGAGACAGTAAAGGGCGTGACCATGAAA 
AAGATCGGTCACGAAGAAGTAGAAGTCGATCAGAGCGACATCGGAGTCAGGAAAGAGAAA 
AGAGCTTGGAAATAGAACCTAAGGAAAGAGAGACCAAGGACCGGGATAGAGATCGCAGGT 
GCTCCTTCTCTCTCTCTTGTATTTATTTGAAACTTGTTCTCAAAAATGTCTACTACATTT 
GATCAATATACCTTTTTGTTATGATTGGTACATACTTCCTGAGAGGTATACATCCGAGTT 
GGTGATCGACTTCATAATCTATGTATTGCCTGCTAGTTCACACTTTAGAAGCTGTGTCTT 
AAATTTATGTAGTGTGTTTAGTAGCTGCTTTGCCATTCTATCTTTTTCGCATAGAGTTCT 
TCATGGTAAATTCAGAATATTATTGGGATGTTGTGACTGAAATTGAGGATGCGGGCTCCT 
AGTGCTTCCCGTCTCTTATGCTTTTTGGGTTATCCTACAAAAACTTTGATGTAAGCTATA 
AGTGTTAACAGGTTCATACTAATGCTATTAGGTCCATTGGTATTGCCTTCTGTACAACTT 
GATGGGGCACGTTCCGTTTAAGATTATCATTGTAATAGAAGGTAACATGTTTTTGGTTAG 
CCTTCAGGTTGGTCCCGTGCTAAATTTTAAATGAAAAAAGATCTAAAGTTTTAATTATTA 
GTTTATTGTTCATCCCTTGTTGACTTTGCATAGTTCCCTGCAGGGACTTCTCGTGCTTCA 
TGTGTGTACGCCTATTGGAGAAAGTTTATCTGTTTTGAATTGTTATATTATTAACATATT 
GCTTATACCAGAAGATGGCCACTGATATGTTGTCTCTGGCCTATTCGAAAGATGTTGCGA 
CATCTTGTAAAATATGGATGAGAAAGTTTCTAGTATCAAATTAAACAAGCTTACTTATTT 
GTTATTATGCAGACGCCATAAAGATAAGAAGGAGGATAAGGTAGAGCCTGAGGCTGATCC 
TGAAAGAGATCAGAGAACAGTTTTTGCATATCAGGTATGCCTGTTTTTATAGCTATGGTT 
CCCTTGAAACATTATAACTTGATCAGTAATTGATTTATTTTTTTGTGTACAACAGATTGC 
TTTGAGGGCAACTGAAAGGGATGTATATGAGTTCTTTTCCAGAGCTGGAAAGGTTTGTCC 
ATTCCTCTGCCGGTTTCATGTTGCCATATAAATGTTGGGCTGGCTGGTTCAATTGAATAT 
TTTTAACACATTGCCTCCTAAATATTGTTTTAGGTGCGAGATGTACGGATAATAATGGAT 
CGAATTTCCAGGCGTTCCAGAGGAATAGGGTGAGTTTCAAACAGTTTGACTCTCTAAGAC 
TTTCTCTAAGACTTATGTGGCTAGAGCAAGTTCTTCTTTATGCTTAAGAATTTTAAACTG 
TCGGTACAGTAATAAGCTTTAAATAGTTTCTGAGCAGATAAATTGTACAAATTCTATGTA 
GTATCTTGTTTGAGTACTGTTTTCTGGATTCTGAGCTGTTCTTGCTTGCAGGTATGTGGA 
GTTTTATGATACAATGTCTGTCCCTATGGCTATTGCTCTATCTGGACAACCTCTTCTTGG 
TCAGCCTGTTATGGTAAAACCTTCTGAAGCTGAGAAGAATCTTGTTCAGTCAACAACTGC 
TGCTGCTGGAGCAGGGGGGATGTTGGGCCCCTACTCCGGGGGAGCTAGGCGTCTTTATGT 
TGGTAACCTCCACATTAACATGTCAGAAGATGATTTGCGAAAGGTAAACAATTTCTTTTC 
CTGGCAGCTGCTTTATGTTTTATAAAGAGGAAGTTTTATTTGAATAAATGTCAGAAAATC 
GTAAGAGCAGAGTTTTTCCTGTATACTACAAATCATATACTTATTAATCATAGATCTGTT 
TTGCAATTGCTCATTTTCGGATCATAGTTCGCGTTCAGGTGACATATTATGCTTTCTTTT 
GGCATTCCTAGGTATTTGAATCATTTGGGAGTGTGGAGCTGGTGCAAGTACCTCGTGATG 
AAACTGGTCTCTGCAAAGGATTTGGTTTTGTTCAGGTAGGTAGTGCGGTGTCAGTTTTAA 
TTTTTTGTCTTGTTCTTGCTACTGTATTCTTTTGATTAACAGAATTCTTTTCTTTTTCAA 
AACCTTCAAGTTTGCCCGGCTGGAGGATGCTAGAAACGCACTGAATCTAAATGGGCAGTT 
GGAAATTGCAGGTCGTGCAATCAAGGTAGGGGTCGAACTTATTTTTTTATAATTTTCAAC 
TGATATCGGTAGTATAGAAGGTAGTAGAGAGCTTAAGCTGTGTTAAGTACTTTCTAGACG 
GATTCTTTCTCTCTGTGGTGAAATTATGATATAATTCCCGAACAGACATTTATGTTCTTT 
GTGCTTAGTGATGTTACATTATTACTTTGTATGAAGGCAAATTCTATGAGCAGTGAATTA 
TTTTGGCTGATACTTTGAGCAGTCAACTATCTTAAATCTGTCTCAGTGGCTTCTAAATAT 
GCATGTAACACCACATTATATCTGTTGATGATGTAGTTTTACTTTTCATTAGGTGTCAGC 
TGTAACTGATCAAACTGAAGTCCCAGAAGCTGGACAGACGCAAACCACCGGTGATTTGGA 
TGATGATGATGGAGGTGGCCTGGTTAGTACTTGTCTTCATCTCCCTAGCATAACTTCCAA 
AAGTGGATATATTTCATGGATCTATAGGGAGAACTCAAGTAACCTGTTTTACATGATGTA 
TATAGTTACTGCATGATGTAGGATTTGGTATAGATAAAATATGAACAGAAGATAAACCAA 
CTTTAAGAAAAGGGTGTTAATAGACAATTTTACTATGTGTAAGATCCATGGTGTAGTAGG 
AGAACATGGAGTTATCTTTCCAGTTTCCAACAACACTGTCATAATCATTAAATGCATTTG 
TTCTCTTAGCCTTACCTGGTTGCTTATTCTGCAGTCTCTGAATGCACAATCGCGGGCGCT 
TCTCATGCAAAAGCTCGATCGCAGTGGAACTGCATCGAGGTTTCCTTATTTCCTGTTACT 
AATTTCTGTTTTTGCAGTTTGTTTTCGTTCATTTATGTTCCACTAAATCTTCCAACCTTC 
TCTGCAGCACTGGCCTTACTACAGCTGCATCTTTCAACGGTGGAGTTTCAACAATCTCTT 
CGTTGGCAGCTCCTGCTCTTGTACAAGGGTCTTTTCCTGCTGTTGCTGGACTCGCAGGGT 
CCGGCATTATTCCCGGTGTTATACCAGCTGGTTTCGACCCAATTGGTGTCCCCAGCGAAT 
GTCTGCTGCTTAAAAACATGTTTGATCCATCCACAGAGGTTAGTGGTCTGCTAAATAGTT 
TCTTTTGGCTTAACAATTCGTACCTCAAGCTATTTCTTCTATACACTTGTATCTGTTTGG 
CAGACTGAAGATGATTTTGATGAGGATATAAAAGAAGATGTTAAAGAAGAATGCTCCAAA 
TTCGGAAAACTGAATCATATCTTTGTTGACAAGTGAGTGAGCTTCAGGGTCTTGTAACTT 
TCTCATCTCGAAAAGAGTAGACTAGACTGGTCTCTGACTGACGACTTTGAATCTCTGTTG 
CTAAAACAGGAACAGCGTTGGTTTTGTCTACCTGAGATTTGAGAATGCGCAAGCAGCCAT 
AGGTGCACAACGTGCTCTCCATGGAAGATGGTTTGCTGGAAAGATGATTACTGCGACTTA 
CATGGTATCCAAAAAAAATAACATGACTTGTGTTGTCTCAGTTTCTTCGATTTGTTTTCG 
ATTTCAATTATATTACTAACAATCTTGCTTGATTTGTCCTTTGTTTTAACAGACTACAGA 
GGCTTACGAGGCCAAATTCCCCGAGAGTAAGGTCGTTTAAAGGTGCCGAGACAAAGTTTT 
TAGTATCGTTATTAAAGCATAAATGAAGATACATCTGCGGTGACAAATCCAATATTGAGT 
CAAATTTATGTTTATGCTAGATTACCCGCTTCTTGTATTTGTAAGTCTCGGTAATGTGTG 
TGACGGAAACTTTGACACCTTTCACTTTCAGTATTTGTATTATGCGAACATGTTTTAGAT 
TTCATAAGAATGTTTTTGACTTTTGACTTTTTATATGGGCTATTAACTGTTTGAGCATTC 
CA
>AT1G78580.1 |  ATTPS1 (TREHALOSE-6-PHOSPHATE SYNTHASE) alphaalpha-trehalose-phosphate synthase (UDP-forming)/ transferase transferring glycosyl groups 
GGGCCATAAACCAGAGACAAGGCTCAAGCCAACTCTGCTTCTATCTATCTCTCACTCTAC 
TCATAAAAATCTCCATATACGCTTCTTCTTCGTTCTCTGATTTGCTGGTGCGCTTCTCCG 
TCATCGTTCGCCGATCATAGTCGATCCCGCCGCTTCCAGGTTAGTCGTTTATTCTCGTCT 
GCCTTCGATCTCCTAATCTCATCGTGTTCCGTTAGATTCGCTGATTTTGATTCGTTTAAG 
CTGTTTCTCCTGGGATTCGGTTTTGTTTTTGTTCTTATTTTCAATCGCGATGATCGTCTA 
TTGATTTTTCCCCCTGATTGCTGATCTGTTTTTGAAACGGTTCCAGATTCAAATTATCAT 
ATCTATATATATCGATTTTGTTTGATCTCTGATTCATATCAATATATCTAGTAATTGATT 
AGATGATTGGATTCGATTTTGCTCTGTTTGAATAAGTTTCCGGAATTTAAGTAGAATTTG 
ATATGCAAGTGATTGTATTTGGATCCTAGAACTTGATCTTATGGGATCATAATCCATATA 
AAAAGTAGACTAATGCTAATTTACGTTAGATTAGAGTGACACATCTTGTTTCCTGTTTAA 
GGCGTTTACTAATCTTATTTGGTTTACTTACTGATGACTTATGAGTGATGACCACCACAT 
ACATAAATTTAAAATTATAGGATGCTTTCTGTTTCAATATCCAAAAAGTATAGTAATGAT 
GGTGTGTGTTGGTTGAGTTATAACATCATCAACTATTGATTGGATAATAATCTCGTATTT 
TTTAGCACTAAAAGACTCATTTGCATGTAAACTTTTCCATAGAACAAATCACAATCTTTT 
TTAGTGATAAATATTGTTACATCTTTTTCAAAAGGGATATTTTTACTCAATATAGAAGAT 
CTTTGGTAGGGTCCTAGTGATTGTGGATTCCGTGCCTACTTGAATGAGGTCACTGCAGTC 
TTCACGGGAAAAAGCATTTTCATTCTTATGCAATCTCTCGTTTATCTATCTAGTTTGGTT 
GAAACAGTGCCACTTGGTTACATTTTAGTCTTAGATGTTATTAGAACAGATGCAAGGTGT 
AAGAGATTCTTGTTGCATAGTCATGGGAGTTTTCTTGTGTGTGTTTTTGTTTACTTCACT 
CACATGTTTCTTGGGGTTTCTTAACTTATATAGTTAGACTTTCAACTATAAATTTGTAAA 
CTACAGGACATAGGCGTAAAGCAAAAGTGAGAGAGCAAATCGTATAACTTTATTTTTGCA 
TAAATATATGATGCCCTTAGATTTGCTGTCTTATTAGGTGGACCACCGGTTTCTTATACT 
TTACTTTTCCTTGTTTTTTTTTTTTTTAATTATCGACACATACAATTGGACGCATTATGT 
GTTGTCCACGCACACACACTAATACTACTGTGTATAAACACTAAGTCGTCTTCTTCTTCT 
TCTACCATAAAAAAAGGAACATCGTGTCCTCATGCTTGTTGTTAGCTTGGGAAATCATGC 
GACAGTTTTTGTTTTTAATCTATTTTCAAAGTCAATATATGAACAGTAAGGTTTATAACA 
AAAATAATTGCATCCCCGACAAGAAAGACGTTGAATGATCGATCTTTTGAAGCCATTTCT 
TACTTACTGTACATTGTTTTCTAATGTGCATATCATTCAAAAGTTTGACATTTGTTATCT 
CTGCAAGAGAGTGTGTTGTAGAAAGTCAGTTGTCGAATTTACCCCCCTTTTTCAAAAGTC 
ACATTCAGGTCACTGCTTGGAAAAGAAACACTTTTTTTCTTTCTGACTCGGGTATCCGAT 
TCTCTTTTCTTCTGTTGTTACTAAACAAGAGTTAATTTGCTTGACAGTAGTCTTATAATC 
TTTGGGAAAAAGGTTAGTTAAATTGTATTTTATCTGGTGTCTTTGTGCAACATTATAGAA 
GACACTAACTTAAGCATCCTCCTTTATGCATAATTTGATTTGACCCCTTACTTGTTAGTG 
GTTGAAAGCTATAACGAATATCAAATTGGAGTTTAATTAATCTTATTTTCACACGTGTTT 
TTGACATTGTGGCTACCAACAACATCTCTGTCCATACCAAGTGCTTGTTTAACGTTTACA 
TGAGACTTCAGTTTGTTTGTTTTTTGGCTAGTTAGGGGTAAAAATTCCATTCTTCTTTTT 
TATTGGTCTGTAAAAAAAATTCCATTTCAAGTAAGAAGAAAGGGAGATGTTTCTACGTTG 
TATTCCCCATAGTCAAATCTAACGTCAGCTTCGGCCGAGTGAGAGGGGTCAATTTCATTC 
AGCTTAAATCCAACTTTTTTTTCTATGTCTCATAAATAAATTTCTCTTTGGTTACAAAAA 
AAAGTAAAAAAGTTTGGTCAGGAAGAGAGGAGCGAGGACCCACCGATTACGTCATCTCGT 
CTAAGAAGTAATCAGAAAAAAAAAAACCTAATTTTTAAAATAAAAACATCTTCTCGTGAT 
TGCGAAGTTTGTTTGTGTGTGCTGTGTGGTGAAGGGTGATCTCTCTCTCCGCCCCGAATC 
TCCGGGCGATGCGATTTTTATCACTGTTGGTTTAATAATCTACTTCACGGTGGTGTGTTT 
TAAAATAACTGAAATAGTTCCGGTCGAAATTTGTAGGTTTTCGAGATTTTTTTTTTTTTT 
GGTTGGAAAAATAAAAAGTCTCTGTTTTCAGACCGAATCTTTTGATGTATCACTTGCATG 
GCTGTGAAGGCTCTGTGTAGCCTGTAAAGCTTACACGAGGATTTTGTTGCTCCCCTTAAT 
TTCCCTCTAATATCTCTCCTTCTCTCTCTCTCTACGATAATAATGTCTTCTCTGCACCGT 
TTCCTTTCGCCTTCTTTCTGTCCGTTTCCAAATTTCTTTCGTTTCTTCTTTTTGGCTCTA 
TTTACTTGCCATCTCTCTCGATGATAACGACATGAAACCCACCTCAAACAAAACCACATT 
CACTTATTATTAGCCTTTGTTTTTTTTTGAGTGGCCGTGAAGGTGTGTGATTCTGGTGCC 
CTTTCTTCCTTTTTGTTTCCCTGCTTAAGGTATTCCTGATTTTTTTCCGTTTCTTGGGAT 
TTATTCTGTGCCATTTTTTTTGTTTCTGTTTCCAAATTCTTGGCTAGTTAATTACGACCT 
CAGGATCATGTGGATCCTGTTCTTTTTGTTATCCTCTTCATCAGTGTTTGACACTATCTT 
GTGTTTTTTCCCTCTTTTTCAATAACCTTAGATGCTTATTCCTTGGCCTGATGGGACACA 
AGTGATATCAGTGTATGGTGATAGACAACGACATTTTCATATTCTTCCTTTTTTTTTTTT 
CTTCTTTAATGTTATTTATGTTTTTTTACTTGACACTTGGTTTCTTGATATGTCCTGATT 
TGCTTTGACAACAAAAAATGCAGGTTACCGTTGATAGAGTGGTGTTTTGGTTCTGTTTTG 
GTGTGAGCGTATGCCTGGAAATAAGTACAACTGCAGTTCTTCTCATATCCCACTCTCTCG 
AACAGAACGCCTCTTGAGAGATAGAGAGCTTAGAGAGAAGAGGAAGAGCAACCGAGCTCG 
TAATCCTAATGACGTTGCTGGCAGTTCCGAGAACTCTGAGAATGACTTGCGTTTAGAAGG 
TGACAGTTCAAGGCAGTATGTTGAACAGTACTTGGAAGGGGCTGCTGCTGCAATGGCGCA 
CGATGATGCGTGTGAGAGGCAAGAAGTTAGGCCTTATAATAGGCAACGACTACTTGTAGT 
GGCTAACAGGCTCCCAGTTTCTGCCGTGAGAAGAGGTGAAGATTCATGGTCTCTTGAGAT 
CAGTGCTGGTGGTCTAGTCAGTGCTCTCTTAGGTAAGTCATAAATCTCTTATCGTTCCTG 
CTCTCATTTTTAATCACTGGTTCAGTATCCAAGACAGCAATGAACAACATGAAACAAGGT 
TTTAGTAGGCTGACATAAAATTAATGAATGAACTTATGAAGGTGTAAAGGAATTTGAGGC 
CAGATGGATAGGATGGGCTGGAGTTAATGTGCCTGATGAGGTTGGACAGAAGGCACTTAG 
CAAAGCTTTGGCTGAGAAGGTACATAGTAACTCTTGCTCATGTGGCTGCCAATGATAATC 
ACCTTGTGTATACTTGAGTTTTAATTTGTTGTCCTCATGATTATAGACTATGTCATTTGA 
TTTCTTGATTATGTGCTCTTAACTTGCAGAGGTGTATTCCCGTGTTCCTTGATGAAGAGA 
TTGTTCATCAGTACTATAATGGTTACTGCAACAATATTCTGTGGCCTCTGTTTCACTACC 
TTGGACTTCCGCAAGAAGATCGGCTTGCCACAACCAGAAGCTTTCAGTCCCAATTTGCTG 
CATACAAGAAGGCAAACCAAATGTTCGCTGATGTTGTAAATGAGCACTATGAAGAGGGAG 
ATGTCGTCTGGTGCCATGACTATCATCTTATGTTCCTTCCTAAATGCCTTAAGGAGTACA 
ACAGTAAGATGAAAGTTGGATGGTTTCTCCATACACCATTCCCTTCGTCTGAGATACACA 
GGACACTTCCATCACGATCAGAGCTCCTTCGCTCAGTTCTTGCTGCTGATTTAGTTGGGT 
AAAAATCTCTACTAGCTTCTATGTATTGCAAGTGATCTTCCATGGTATTAGCTCCATGTG 
ACAGGTTCAAATCTATGTGTTACTGTTTCAACCAATCTTAAGTGGTTTGTCTGGTTGAGA 
ACTAGTCTAAATATCGAATAATTTATCTCCATGGTACATATATAGAGGTGAAATAGTTAA 
CCATGTGTAGCTTGATATATCTAGGATCTGATTGTTGGTAATGATTCAGTTCTTTTAGGT 
GGTGTAAGAATTTACTTTGACTGTGTATAATTTGGATCCAATGGTAAAAATACTACATTG 
GTTATTTTAGTAATGAGCTGATGGATCTTTATTCTGTTTTCGGAAAGTAACATGACACAT 
TGTTTACTTTACAGCTTCCATACATATGACTATGCAAGGCACTTTGTGAGTGCGTGCACT 
CGTATTCTTGGACTTGAAGGAACACCTGAGGGAGTTGAGGATCAAGGCAGGCTCACTCGT 
GTAGCTGCTGTATGACCATTTCATTACTTTGACCATTTACACTTATCATGCCGCAGTGAT 
AGAAAAGCTAATAATACCTTGTCATTGTTTGAAAGCCTTGTAACAGAATTATGTATTTGC 
TTCGGATTTCAGTTTCCAATTGGCATAGATTCTGATCGGTTTATACGAGCACTTGAGGTC 
CCCGAAGTCATACAACACATGAAGGAATTGAAAGAAAGATTTGCTGGCAGAAAGGTACGA 
AAGAGCCAGTTCCCATGAGAAACCCCTAACTGTGTTACAATCTGTTTGAAATCTCTTCTC 
AAGCAAGTCAATGAAAGTATCACATAAAAGTGTTTATTTGACTCTCTTTACTTAATTTTT 
TCTGTTGACAGGTGATGTTAGGTGTTGATCGTCTTGACATGATCAAAGGGATTCCACAAA 
AGATTCTGGCATTCGAAAAATTTCTCGAGGAAAATGCAAACTGGCGTGATAAAGTGGTCT 
TATTGCAAATTGCGGTGCCAACAAGAACTGACGTTCCTGAGTGTAGGTTTTCTTTCTTGG 
AGTCTCTTTATAATTTAGCTTCACTCGTGAAACAATACAAAACATCTGCTAAAATGTCCC 
TTTTAGTTTATTTATAGCTTGTTCTAGTCACCCATTGCTAATGGATGCTCTTCGGGATGT 
ATATTTCCTTCTCATACAGATCAAAAACTCACAAGCCAAGTTCATGAAATTGTTGGACGC 
ATTAATGGTCGTTTTGGGACACTGACTGCAGTTCCAATACATCATCTGGTCTGTTTTTAA 
ACTCTTTATGCTTGGTCAGCGAGTTGGATATTATGATTTCTCACGAGCTGTAGTTTCTTT 
TTTTTTTTCTCCAATGGAAAATGATCTGTGATAATGTTGAATGTTAGTACTCTATGGCAC 
TTAGCATTTTGTGAGTTGCATCCTTAGGGATTGAAAATGGTCTTAGCAGACCATTATTTC 
TGGTATCATTGATAGAGAAAATATCATCTGCATCATGCTACATATTCGGTGTTCTGGATC 
TTATAGTTTTGAAAATTCAACTCTGACGTAATGCTGATAAAATTCTCATTCCCTCTCAGG 
ATCGGTCTCTGGACTTTCATGCTTTATGTGCACTTTATGCCGTCACAGGTAATCGTATGG 
CTACCTGGTTACATTTTGTATGGCATTCTACTTTACAACTCTCAAAAATGTTACTTTCTG 
CCATCTGATAACTTTCTTTGACTTTCTTGCTTCAGATGTTGCGCTTGTAACATCTTTGAG 
AGATGGGATGAATCTTGTCAGTTATGAGTTTGTTGCTTGCCAAGAGGCCAAAAAGGGCGT 
CCTCATTCTCAGTGAAGTAATAACTCTTACTTTGCAGCTTTTTAATAAAGTTATAATTTA 
AGAGATTAATATATGAGAGTACATTGCATTTGTTTTACAGTTTGCAGGTGCTGCACAGTC 
TCTGGGTGCTGGAGCTATTCTTGTGAATCCTTGGAACATCACAGAAGTTGCTGCCTCCAT 
TGGACAAGCCCTAAACATGACAGCTGAAGAAAGAGAGAAAAGACATCGCCATAATTTTCA 
TCATGTCAAAACTCACACTGCTCAAGAATGGGCTGAAACTTTTGTCAGGTATGGAAATCA 
AATCAATTGTGTCTCATTGATTTGTTCAAATGAAAATTATATTATCTGAGAATTCCTTAA 
TGAAATGCAACTCTTAAAAAATCTGCAGTGAACTAAATGACACTGTAATTGAGGCGCAAC 
TACGAATTAGTAAAGTCCCACCAGAGCTTCCACAGCATGATGCAATTCAACGGTATTCAA 
AGTCCAACAACAGGCTTCTAATCCTGGTAAGTTCTATATAATCCATTTATCTACCGTATA 
GAGTTATGTTTTGGGAGCTGCCTTTAAAGCTTTAATGATCTTGTAACTGTAAATACATTC 
AGGGTTTCAATGCAACATTGACTGAACCAGTGGATAATCAAGGGAGAAGAGGTGATCAAA 
TAAAGGAGATGGATCTTAATCTACACCCTGAGCTTAAAGGGCCCTTAAAGGCATTATGCA 
GTGATCCAAGTACAACCATAGTTGTTCTGAGCGGAAGCAGCAGAAGTGTTTTGGACAAAG 
TATATATCATTTCTCTCTGTCTGTTTCCTGATTTTCTTTTCTTGTTTTAATAATTTTCTC 
TGACTGACTTGGTTTTACTTAACGTAGAACTTTGGAGAGTATGACATGTGGCTGGCAGCA 
GAAAATGGGATGTTCCTAAGGCTTACGAATGGAGAGTGGATGACTACAATGCCAGAACAC 
TTGAACATGGAATGGGTTGATAGCGTAAAGGTAAAAGTATATTAGCGGTTCAATTAAACC 
GCATCTCAAACTCAATAACTTCTTTGCTGAATTCTAGTTACTCTTCTTGCAGCATGTTTT 
CAAGTACTTCACTGAGAGAACTCCCAGGTCACACTTTGAAACTCGCGATACTTCGCTTAT 
TTGGAACTACAAATATGCAGGTACTTGTCTATCTTTTTACCTGATTGTTTTCGGCCTTTT 
CTGATCACGCTGAAACACTGAATATATCATTCTTCCCTGTAGATATCGAATTCGGGAGAC 
TTCAAGCAAGAGATTTGTTACAACACTTATGGACAGGTCCAATCTCTAATGCATCAGTTG 
ATGTTGTCCAAGGAAGCCGCTCTGTGGAAGTCCGTGCAGTTGGTGTCACAAAGGTTGAAA 
AATAAATCGGCTCTAGTCTTTTCTGTCTACTCTATATCACCTTAGCTTCTCACATTCAGG 
ATTCTTTTTTTCCTTAGGGAGCTGCAATTGATCGTATTCTAGGAGAGATAGTGCATAGCA 
AGTCGATGACTACACCAATCGATTACGTCTTGTGCATTGGTCATTTCTTGGGGAAGGTGA 
TATACCACATCTAATTCTTTAGTCTCGAGGGATTTTGATACAAAATATCTCTGACATTGT 
TGTTTTCAGGACGAAGATGTTTACACTTTCTTCGAACCAGAACTTCCATCCGACATGCCA 
GCCATTGCACGATCCAGACCATCATCTGACAGTGGAGCCAAGTCATCATCAGGAGACCGA 
AGACCACCTTCAAAGTCGACACATAACAACAACAAAAGTGGATCAAAATCCTCATCATCC 
TCTAACTCTAACAACAACAACAAGTCCTCACAGAGATCTCTTCAGTCAGAGAGAAAAAGT 
GGATCCAACCATAGCTTAGGAAACTCAAGACGTCCTTCACCAGAGAAGATCTCATGGAAT 
GTGCTTGACCTCAAAGGAGAGAACTACTTCTCTTGCGCTGTGGGTCGTACTCGCACCAAT 
GCTAGATATCTCCTTGGCTCACCTGACGACGTCGTTTGCTTCCTTGAGAAGCTCGCTGAC 
ACCACTTCCTCACCTTAATATCCCGAGACAGTGTCAAGTGAGTTCATGTAACCCAATAAA 
AACTATTGTTTTGTAACAAAAAGCAGCCATTACCAGACTCTTTAGTGGTTTGATTCTAAT 
ATAATAAGAGTAGAGCAACTTATGACACAAATGAGAACAAGCTCTTATTACAT
>AT1G66500.1 |  zinc finger (C2H2-type) family protein 
AGATTCGTTTTATTTTTCAATCGTTTCAATTTCTAAAATTCTCCTCTCTCAACGCAATCA 
CCAAATCCAAATTTAGGGTTTCTTTTCTCTTTCTGCGATCGATCTCTGAAAACTCATAAC 
TGTTGTTTAATCGTGAAGATGGCATCAAACGGATCTTTCTCTGCTCAGAGAAACGCAAAC 
GCTAGAACAACGATGAAGAGAAGAAGCGACAATCGCGGTTACGGTGGCGGAATCGGAGGT 
TATCAAGAGGAGACGAACCGTTACGCGCCGCCGCAAAAACGTTTCAGATCACAAGCGCAA 
CAGCAATTCCGATCTGGTCATAATCCTCTGTATCATCATCATGGTAGTAATAATAATAAC 
GTGTCTAGGGTTTCTTCTCAATCATATAACAATTGCGGTGTTGATGTGATTGCTTCTAAT 
TCAAGTTTTGCATTACGTAACAATGATTCTAACACCAACAATTATCAGAAACCCTTTGTT 
GCTGGTTATGGAAACCCTAATCCCCAAATTGTTCCTCTTCCATTACCTTATCGTAAGCTT 
GATGACAATCTCTCTTTAGATTCGTTACCTGATTGGGTTCCGAATTCAAGAACCCTAACT 
CCGAATTATCCTGTTAGGTCATCGAATTTTGTACCAAACACTCCTGTTTTTACGAATGTT 
CAAAATCCGATGAATCATTCGAACATGGTTTCAGTTGTGTCTCAATCTATGCATCAACCA 
ATTGTTTTGAGCAAAGAATTGACTGATTTGCTTAGTCTTCTTAACAATGAGAAAGAGAAG 
AAAACTTTAGAAGCAAGTAATAGTGATTCTTTGCCTGTTGGATTAAGCTTTGATAATCCA 
TCGTCACTTAATGTTCGACATGAATCTGTGATTAAGTCTCTGTATTCTGATATGCCGAGA 
CAATGTTCATCGTGTGGGTTGAGATTCAAGTGTCAAGAAGAGCATAGTAAACACATGGAT 
TGGCATGTAAGGAAGAACAGGTCGGTGAAAACCACTACAAGACTGGGTCAGCAACCGAAG 
AAATCGAGGGGATGGTTAGCAAGTGCATCTTTATGGCTTTGTGCAGCGACGGGAGGAGAG 
ACGGTAGAAGTAGCATCTTTTGGAGGAGAAATGCAGAAGAAGAAAGGAAAGGACGAAGAA 
CCAAAACAACTCATGGTGCCTGCGGATGAAGATCAGAAGAATTGCGCATTATGCGTAGAG 
CCGTTTGAAGAGTTCTTTAGCCATGAAGATGATGATTGGATGTATAAAGATGCAGTCTAC 
TTAACCAAGAATGGTCGTATAGTTCATGTTAAGTGTATGCCTGAACCCCGACCTGCTAAG 
GATTTGAGAGAGCCTTCGAGGGTAATGTCTGTTACAGTTCCATCGGTTGCGAAAGCTATA 
GCCTGCTGATTGAGATTTTTAAGATCTCTGTTTTAGTCATTCGTTTTTTTAAGTAATGTA 
CTTTACTTGAACAAGTTGTAACACAAATACAGTTCTATCAATTGAATCTCCTATTTTACT 
CT
>AT1G73840.1 |  ESP1 (ENHANCED SILENCING PHENOTYPE 1) 
ACAGGTTAAGCTCGGTAGCGATTACCGACGAGAACCATGGCGGGTAAGCAGATCGGCGGA 
GACGGAGGTTTACCGGCAAATCTCGCCGGAATGACTAAAAGTCAGCTCTATGATATTATG 
TCTCAAATGAAGGTTCTCTCTTCTTTCTTTTCTATACTTTTCCGATTATCAGCTATAACA 
CTATCCTTTACGGATTTGAATAGAGAACAATTGATTTCTTCTTCTTTTTTTCGAATTCTG 
TTTTTTTGATCAGTCGAATCTAATTGTGCAGACGTTGATTGATCAAAACCATCAACAAGC 
GAGGGAGATTCTGATTCGGAACCCTCTTTTGACGAAGGCTCTTTTCCAGGTTCTTCTTCA 
CTTCGCTAATCTTTTCCATCTTCTAAATCTGCAATCCGTGTGGTCTTATAAGCAATGAGG 
AATTCTGATTTGGAGCTTCTTACTTGAGTAAATTGATTGGACTAGTTTGGGTTTAGTATT 
GTTGAAGAAGCAGGTAGGTTAACAATTAGGGTTTTGTGTTAGTTTCCAGATATGAACAAT 
CTTTAGGTTTATGCCTCTATTTACAAATAGATTTCAGAATTTGTATATGGTGATGATGAT 
GCTATGTTTGTTGAAATGCCAGGCACAAATCATGCTCGGAATGGTTCAGCCTCCTCAAGT 
GGTATGTACTTGCGTCCTCTTAAGTCATTTTGTTAATAGATTTCATTTCAAGCATCTTAA 
ATTTTACAAAAATCTGTTTCTATTAGACTCCGAAAGTTGAGCCACAAGCTGTACAACAAC 
CTCAACAATCTCATCAATCTATCCCGCCAAAGCCAAACGTTCAAGCTCATATGTCTTCTT 
TCCAAGGCGGTGGCAGTGTACATGAGCCAGCCAATACGATGCAGCCACAAGCCCCGATTC 
GAAAACACCCAACACCACAACCAATGCCTATGCCTCCACCACCGCCTTCTGTTTCTGCAA 
ATAGTGCTCAATCACAGCCTCGTTTTTCGCATCCCCAGCGTCAGGGACATCTGAATCCTG 
CTGTCACTTCTATGTCTCATCCACAGTCTTCTCAAGTTCAAAACGCGCCTCCTCCGGCTT 
CCCATCATCCAACATCCCAGCAACCTCCTTTTCATCATCTTGATATACCAGCTTCCTCCA 
CTCAGTTGCAACAACAACCAATGCACTCTGGTGGAGGTCCTCATGTGGCACAGCAACAGT 
CTAGACCATATCATCATCAATATGGACAAGCTCAAACTGGTCCAAACACTGGATTTCAGC 
ACCATGGCGCACCTACTCAGCATCTTTCTCAACCCATGTATCATGTGAGTCAGAGTTATG 
ACTTATGAGTAGCTATTGTCGGTTTCCTTTTATTTCCCTCATTGTGAATTATGAAGTTTT 
TGACTGACTAGAACTCGTTATTTGAGCCAATTTTGCAGTCAGGCAACAGACCCCCTGCTT 
CCGGTGGACCTCAATTCCCGCAGGGACAGCCACATCTGCCTAGTCAGCCAACATATCAGG 
TATTGATACTCTTACTTTTTGACCTTTAGGCGATATGTTTGATGTTTTGCAGACTGAGTA 
TGAAATTATGTTGCTTTATCTATGTGCTTTCTTCCGAGCACTACACCTTCAACGAGTAGA 
GATTACCCTTTAATGAGAATTCTCTCAAACATCTATCATTGTTATTCTTAATCAGATATG 
AGAAATGATTTCTTCTGGCAATAATTCTTCTCATCTTTTTTCATTGTCAAGCTATCATCA 
TATTTCTAGACTTCTAGTTCTGATTCCGTTAAAATCATGTTCTGCTTTAGATTAATAAAT 
CATCTAAATGGAAACTCTACATCTTTTTGGTTTTGCTTTTGGGTCTCACTGCTTGTAATC 
TTGTTTATTGTTTCAGGGAGGAGGTCAATATCGTGGAGACTACAACAATAACCAATTAGC 
AGGTCTGATGGCTCAAGACAGAGGTCCTTCTTGGATGGCTGGCCAATCAGAGAGCTCGAA 
CATTACTCATCTGCCAGGCTTAGGACCGGTGCCTCCACCAAGCCAAGTTGGGCCTGGAGG 
TGGCCCACCACCTCGCCCTGCACCGGTAATTTATCTTTTAACTGCAAGGCACAGCCATTG 
AACCGCTGTTACTGCTAGGATGTATATTCATGTCGATGACTCTGTAGTTTTATTAGCCCC 
CCCAAATCAATCAAATTCGACGTTCCTTTCCAGTAGATGTTGTAGTTGTCTTTTGCCGGA 
ATTCAAAATGAGAATTTCTGATTACAGAGCAAAGAGCTTTTGTTATTTTTTGCTGATGAT 
TGTGTTTTTCTTACTTGTGCAGATATCTGCAGAGATGGAGAAGGCACTACTTCAACAAGT 
GATGAGCCTTACACCAGAGCAGATCAATCTGCTGCCACCAGAACAGAGAAACCAAGTCCT 
TCAGCTTCAACAGATTCTCCGACAGTGAATCTCATAGATAATCGCTTGGTCTCCTCCATG 
TTAGAACTTTGAAGAGACAGGTTTTGGCTTTGAATGTAAGGCCTGAGTTAAGTTTGGGAT 
AATTTGTAAAAAGAAGAAAAGTAATTAGATTTTTTCAAAGTTCAAGGTATCACTAAATAC 
CTTTGGTCATATCCCCTGGAGAAAATTTATGTGTTCTCTTTGATTTAATGTTCAGTAACA 
ATTTTCTTCCTGAATTTCAAAGTTACGAAATCTTGCTTAC