>AT5G54910.1 |  DEAD/DEAH box helicase putative 
ATGGTAAAAATTAAGAAGACTAAGGGAATGAGGAAGCAGATTCGTCTCAACGAAGTCGAA 
GAAATAAATCTTCTGAAGCAGTGGATCGAATCACAGAAACCGGATTCAGGATTCAATCCA 
CTTTCATTGCGTCCTCTTCCTAAAGATTCGAAGATCGGAAAGTCCGAAGACGGCAAAAAC 
GGCACCGTTTTCTCTCGGTATGCAGGTGTGAGGAAGTTTGCTCAGTTACCTATATCGGAT 
AAAACGAAAAGAGGATTGAAAGATGCGAAATACGTTGATATGACTGATGTTCAGAGTGCT 
GCTATTCCTCATGCTTTATGTGGAAGAGATATTCTTGGTGCTGCTAGAACTGGGTCTGGC 
AAAACTCTGGCTTTTGTTATTCCGGTAAAGTTTCGATTTTTCGATAGAGTTTATTGCTGT 
GTGTGTAGCTTTGTATCTTGATCAGCTTTGATTTTTGATAGATGCTAATGGATTATTTTT 
GTGTGTTTTAGATTCTGGAGAAGTTACATAGGGAGAGATGGAGTCCTGAAGATGGTGTGG 
GATGTATAATTATATCTCCAACAAGGGAATTGGCAGCCCAGACATTCGGTGTTTTGAATA 
AAGTAGGAAAGTTTCATAAGTTTAGTGCGGGGCTCTTAATTGGTGGTCGTGAAGGAGTTG 
ATGTTGAGAAGGAGAGAGTTCATGAGATGAATATTTTGGTGTGTGCTCCTGGTAGGCTTC 
TTCAGCACATGGATGAGACTCCAAACTTCGAATGTCCACAGCTTCAGGTAATGATGACCA 
TATTTGTTTATGTTTTCACTATCCTTATTTTAATGAAATGTTTCAGCTACAGAACATTTG 
GGCATTTTGTGTTGTTAACTCTATAATACTTGTCCATGATGCCTTTCTCCTACACGTTTA 
TGAACATTAGGATGGTTATATTTGCAAATAAGGATACCGTAAAACCACTTCGACTATGTT 
TCTGTCTGCCAAATTTCTTCAGTCTTATTGTTTACAAATGCCTAGTAAGTGTTCTCTTTT 
GCTGCAGATTCTGATTTTAGATGAGGCCGACCGTGTCCTTGATTCTGCGTTCAAGGGGCA 
GTTGGATCCTATAATCTCACAGTTGCCTAAGCACAGACAAACTTTGCTTTTCTCTGCAAC 
TCAAACTAAGAAAGTCAAGGATCTAGCAAGACTCAGTTTGAGAGATCCTGAGTACATTAG 
TGTACATGCAGAGGCGGTTACAGCTACTCCAACTTCCTTGATGCAGACTGTGATGATTGT 
CCCAGTTGAAAAGAAATTAGACATGTTATGGAGTTTCATCAAAACTCACCTTAATTCCAG 
GATTCTTGTTTTCCTCTCCACCAAGAAACAGGTTATATTATATTACCTCTCTTCCTCTTT 
GAATAATCTACATGGAGATAGTGTGTTCACTTTCATTCTGCCACTTTCTTCTATCTTGAG 
ATTGACAAACGGATCACAATCCTGGCAGGTCAAATTTGTGCATGAAGCATTCAACAAGCT 
CCGGCCTGGAATACCTTTGAAGAGTCTTCATGGAAAAATGAGTCAGGAAAAAAGGATGGG 
AGTGTACTCTCAGTTCATTGAGAGACAATCAGTTCTGTTCTGTACTGATGTTCTTGCTAG 
AGGTCTTGATTTTGATAAGGCTGTGGACTGGGTTGTTCAGGTATGAATCCACATCCAGAA 
TTACAAAACTCTATGATCTTGTCGGGCTGAAGTGTGATGTCATCATATTTATTTTATAGG 
TGGATTGTCCTGAAGATGTAGCTTCTTATATTCACCGGGTTGGGCGTACAGCTCGTTTCT 
ATACTCAAGGGAAGTCGCTCCTCTTTCTGACACCTTCAGAGGAAAAAATGATTGAGAAAT 
TACAAGAAGCTAAAGTGCCTATAAAACTCATCAAGGTAGTAGCTCCCGTCCTCAATTTTC 
TTTGAGTTTCGACTGTGGTTGGAAACATTTGACTGTAAAAAAATTTGTCACACAGGCAAA 
CAACCAAAAGTTGCAGGAGGTTTCTAGGCTCTTGGCTGCTTTGTTAGTCAAGTATCCAGA 
TCTTCAAGGTGTTGCTCAGAGAGCCTTCATCACATATTTGAGGTCCATCCACAAAAGAAG 
GGACAAAGAGATTTTTGATGTGTCAAAGCTGTCGATTGAAAACTTTTCTGCTTCACTTGG 
TCTGCCAATGACTCCCAGAATCCGATTCACAAACCTTAAAACGAAGAAAAAGGGGGTATA 
TGAGAGTTCTATCGCTATGGAGATTGAGAATGCACAGGAATATGAAGCACCTCTGGTTGT 
CAAAAAAGATCTTCTTGGTGAAGATTTAGAAGAAGAGGATTTTGCTCTCAAGCCACGTAA 
AGAGGGCAAAGTAGTAGAAAAATCAACCAAGGAAGAAGAAGTTCTCATGTATGGTTTTCG 
CATTCCGTTAACATTTTTTCCATTCATTCGATCCAGTCTTTTCACGCTTAATTATGTGTA 
TAAATTCTGTTGAATTTTCAGACCAGGAAATCGTGTTTTGAAAAACAAGAAGCTGAAGAT 
CAATCTACACAGACCATTTGGGTCGAGGGTTGTGCTTGATGAGGAAGGCAATTCTTTGGC 
TCCCTTAGCAAGTGTAGCTGCTGAAGCAGGGACTGAAGTAGCCCTTGATGAAGGTAAAGG 
AACATGAATCCCTATTATCCTGTTCACACAAACGAGCAATGAATCAGTTTTTAAAAAAGC 
ATGTGTAAATTGGTTGTTGAATTTTGCAGAGAGAATGAATGATTACTATAAGAAAGTGGG 
AGCGGAAATGAGGAAAGCTGATATAGAGGACAAGAAAGTAGACAAGGAAAGGAGGAGGGA 
AAAGAGAATGAAACAGAAGATTAAGAGGAAGAGAGGAGCCATGGAGGATGAAGAAGAAGA 
AGAAGAAGAAGACCATGATGGTTCTGGATCATCAGATGATGAAACTGGAAGAAACAGCAA 
AAGAGCAAAGAAAATCGTCTCTGACAATGAAGAAAATGGAGGAAAAATCAATACAGATTC 
TCTTTCCGTAGCTGATCTTGAAGAAATGGCTCTCAAATTCATAACGCAATGATAAGATCT 
TAATTCGTGTAGTTAATTTACATCAGTTCTGTGGAAAATTTTGTGATTTGTTTCCACCTA 
ACGATTGCACGTTTGTTACCGTCTTACTATGAGGAAAAGAAGG
>AT3G09630.1 |  60S ribosomal protein L4/L1 (RPL4A) 
AGAAAACCCTAATTTCTCAAAGAGTCTAAAGAGACGGAGAGTGAGAGAAGAGAGAAACAT 
TTCGAGACAAATGGCCGCCGCCGCTGCTCGTCCTCTCGTCACCATCCAAACCTTGGATGG 
TGACATGTCCACCGATCAATCCTCCACCGTCGTACTTCCCGACGTCATGACGGCGCCAGT 
TCGACCAGACATCGTTAACTTCGTTCACGCCCAAATCTCCAACAACAGCCGTCAGCCATA 
CGCCGTATCGAAGAAGGCCGGTCACCAGACCTCCGCCGAGTCCTGGGGAACCGGACGTGC 
CGTGTCTCGTATCCCTCGTGTTCCCGGTGGTGGTACTCACCGTGCTGGTCAAGCTGCGTT 
CGGTAACATGTGTCGTGGTGGTCGTATGTTCGCTCCAACCAAGATCTGGCGCCGCTGGCA 
CCGTCGTGTCAATGTCAACATGAAGCGTCACGCAATCGTCTCAGCTATCGCTGCAACTGC 
TGTTCCTGCGCTTGTGATGGCTCGTGGTCACAAGATCGAGAATGTTCCTGAGATGCCTCT 
TGTTGTGAGTGACTCCGCCGAAGCTGTGGAGAAGACCTCAGCTGCGATCAAGGTTTTGAA 
ACAGATCGGTGCTTATGATGATGCTGAGAAGGCAAAGAACAGCATTGGAATCCGTCCTGG 
TAAAGGTAAAATGAGGAACCGTCGTTACATTTCTAGGAAAGGTCCTCTGGTGGTTTATGG 
AACTGAAGGATCTAAGATAGTTAAGGCGTTTAGAAACCTTCCTGGTGTTGAGCTTTGTCA 
TGTGGAGAGGCTTAATTTGTTGAAGCTTGCTCCTGGTGGTCACCTTGGTCGGTTTGTGAT 
CTGGACCAAGTCTGCCTTTGAGAAGCTTGAGTCTATCTATGGTTCGTTTGAGAAGCCATC 
AGAGAAGAAGAAGGGGTATGTGCTTCCTCGTGCAAAGATGGTGAATGCTGATCTTGCCAG 
GATTATCAATTCAGATGAGATTCAGAGTGTTGTGAATCCGATCAAGAAGGATGCGAAGAG 
GGCTGTTCTTAAGAAGAATCCATTGAAGAATCTCAATGTGATGTTGAAGTTGAATCCTTA 
TGCTAAGACCGCGAAGAGGATGTCACTGTTAGCTGAAGCACAGAGAGTTAAGGCTAAGAA 
GGAGAAGCTCGCCAAGAAGAGGAAAACCGTTACCAAGGTAATCTCAATACTTGACTTGTT 
CTCTTATCAACCGTTTTTGGATTGTCTTTGTTTAGTTACTGATTACATTTTGATCTGTGG 
TTGCATTTCATTTGACTTAACTTATATTGCAATTGTTCTAATTGACTGAGTTTGTGTATG 
TTAAGCTATACAATAATCTGTTCCCCTCTGGTTTAGTCTATGACTATAGTAGTCTTTCTT 
TACTAGATCTTACCTTTTCTGTTCTGAATTGTGGTCTAGTAGTTTGTCTTGTAAATCTGT 
TGTGTACGATTCTTTGTCTTGATATTGATTTTAGGTTGAGCTATTAAGCAATTGAATCTC 
TTAGCACTTTCTTGTCCCTTGTGAAAATTGTTCTTCATATGTCCTCTTTTCTAACTCCAC 
TTTGAAATATCTATTTTTCTTACATCAGGAGGAGGCGTTGGCAATCAAAGCAGCAGGCAA 
GTCGTGGTACAAGACTATGATCTCCGACAGTGATTACACCGAGTTTGATAACTTCACCAA 
ATGGCTCGGTGCTAGCCAGTAATAATCTCGTCTGCTTTGGAACACTTTCCATATTTTAGT 
CAAAAGATTTTGGTTTTTTTAATCTGTTTTGTCTTTGGGTGTCTGGATATCAAGTTGAAT 
TATGAACAAGTTTCACTTTTTTACATCTCCATTTCTTACTTCGCCTTTATCAGTTTCATT 
TATTTATCTCTTGCTCCTTCGTTTCCTATGATGATGCTTGTTATGTTATGAACCTACTTA 
AAAACAAGCTGAAGCTTTCTTTGGTTTACCCCAGCAGAAACATTAATCAAG
>AT3G09630.1 |  60S ribosomal protein L4/L1 (RPL4A) 
AGAAAACCCTAATTTCTCAAAGAGTCTAAAGAGACGGAGAGTGAGAGAAGAGAGAAACAT 
TTCGAGACAAATGGCCGCCGCCGCTGCTCGTCCTCTCGTCACCATCCAAACCTTGGATGG 
TGACATGTCCACCGATCAATCCTCCACCGTCGTACTTCCCGACGTCATGACGGCGCCAGT 
TCGACCAGACATCGTTAACTTCGTTCACGCCCAAATCTCCAACAACAGCCGTCAGCCATA 
CGCCGTATCGAAGAAGGCCGGTCACCAGACCTCCGCCGAGTCCTGGGGAACCGGACGTGC 
CGTGTCTCGTATCCCTCGTGTTCCCGGTGGTGGTACTCACCGTGCTGGTCAAGCTGCGTT 
CGGTAACATGTGTCGTGGTGGTCGTATGTTCGCTCCAACCAAGATCTGGCGCCGCTGGCA 
CCGTCGTGTCAATGTCAACATGAAGCGTCACGCAATCGTCTCAGCTATCGCTGCAACTGC 
TGTTCCTGCGCTTGTGATGGCTCGTGGTCACAAGATCGAGAATGTTCCTGAGATGCCTCT 
TGTTGTGAGTGACTCCGCCGAAGCTGTGGAGAAGACCTCAGCTGCGATCAAGGTTTTGAA 
ACAGATCGGTGCTTATGATGATGCTGAGAAGGCAAAGAACAGCATTGGAATCCGTCCTGG 
TAAAGGTAAAATGAGGAACCGTCGTTACATTTCTAGGAAAGGTCCTCTGGTGGTTTATGG 
AACTGAAGGATCTAAGATAGTTAAGGCGTTTAGAAACCTTCCTGGTGTTGAGCTTTGTCA 
TGTGGAGAGGCTTAATTTGTTGAAGCTTGCTCCTGGTGGTCACCTTGGTCGGTTTGTGAT 
CTGGACCAAGTCTGCCTTTGAGAAGCTTGAGTCTATCTATGGTTCGTTTGAGAAGCCATC 
AGAGAAGAAGAAGGGGTATGTGCTTCCTCGTGCAAAGATGGTGAATGCTGATCTTGCCAG 
GATTATCAATTCAGATGAGATTCAGAGTGTTGTGAATCCGATCAAGAAGGATGCGAAGAG 
GGCTGTTCTTAAGAAGAATCCATTGAAGAATCTCAATGTGATGTTGAAGTTGAATCCTTA 
TGCTAAGACCGCGAAGAGGATGTCACTGTTAGCTGAAGCACAGAGAGTTAAGGCTAAGAA 
GGAGAAGCTCGCCAAGAAGAGGAAAACCGTTACCAAGGTAATCTCAATACTTGACTTGTT 
CTCTTATCAACCGTTTTTGGATTGTCTTTGTTTAGTTACTGATTACATTTTGATCTGTGG 
TTGCATTTCATTTGACTTAACTTATATTGCAATTGTTCTAATTGACTGAGTTTGTGTATG 
TTAAGCTATACAATAATCTGTTCCCCTCTGGTTTAGTCTATGACTATAGTAGTCTTTCTT 
TACTAGATCTTACCTTTTCTGTTCTGAATTGTGGTCTAGTAGTTTGTCTTGTAAATCTGT 
TGTGTACGATTCTTTGTCTTGATATTGATTTTAGGTTGAGCTATTAAGCAATTGAATCTC 
TTAGCACTTTCTTGTCCCTTGTGAAAATTGTTCTTCATATGTCCTCTTTTCTAACTCCAC 
TTTGAAATATCTATTTTTCTTACATCAGGAGGAGGCGTTGGCAATCAAAGCAGCAGGCAA 
GTCGTGGTACAAGACTATGATCTCCGACAGTGATTACACCGAGTTTGATAACTTCACCAA 
ATGGCTCGGTGCTAGCCAGTAATAATCTCGTCTGCTTTGGAACACTTTCCATATTTTAGT 
CAAAAGATTTTGGTTTTTTTAATCTGTTTTGTCTTTGGGTGTCTGGATATCAAGTTGAAT 
TATGAACAAGTTTCACTTTTTTACATCTCCATTTCTTACTTCGCCTTTATCAGTTTCATT 
TATTTATCTCTTGCTCCTTCGTTTCCTATGATGATGCTTGTTATGTTATGAACCTACTTA 
AAAACAAGCTGAAGCTTTCTTTGGTTTACCCCAGCAGAAACATTAATCAAG
>AT3G09630.2 |  60S ribosomal protein L4/L1 (RPL4A) 
GCTGAGAGAAAACCCTAATTTCTCAAAGAGTCTAAAGAGACGGAGAGTGAGAGAAGAGAG 
AAACATTTCGAGACAAATGGCCGCCGCCGCTGCTCGTCCTCTCGTCACCATCCAAACCTT 
GGATGGTGACATGTCCACCGATCAATCCTCCACCGTCGTACTTCCCGACGTCATGACGGC 
GCCAGTTCGACCAGACATCGTTAACTTCGTTCACGCCCAAATCTCCAACAACAGCCGTCA 
GCCATACGCCGTATCGAAGAAGGCCGGTCACCAGACCTCCGCCGAGTCCTGGGGAACCGG 
ACGTGCCGTGTCTCGTATCCCTCGTGTTCCCGGTGGTGGTACTCACCGTGCTGGTCAAGC 
TGCGTTCGGTAACATGTGTCGTGGTGGTCGTATGTTCGCTCCAACCAAGATCTGGCGCCG 
CTGGCACCGTCGTGTCAATGTCAACATGAAGCGTCACGCAATCGTCTCAGCTATCGCTGC 
AACTGCTGTTCCTGCGCTTGTGATGGCTCGTGGTCACAAGATCGAGAATGTTCCTGAGAT 
GCCTCTTGTTGTGAGTGACTCCGCCGAAGCTGTGGAGAAGACCTCAGCTGCGATCAAGGT 
TTTGAAACAGATCGGTGCTTATGATGATGCTGAGAAGGCAAAGAACAGCATTGGAATCCG 
TCCTGGTAAAGGTAAAATGAGGAACCGTCGTTACATTTCTAGGAAAGGTCCTCTGGTGGT 
TTATGGAACTGAAGGATCTAAGATAGTTAAGGCGTTTAGAAACCTTCCTGGTGTTGAGCT 
TTGTCATGTGGAGAGGCTTAATTTGTTGAAGCTTGCTCCTGGTGGTCACCTTGGTCGGTT 
TGTGATCTGGACCAAGTCTGCCTTTGAGAAGCTTGAGTCTATCTATGGTTCGTTTGAGAA 
GCCATCAGAGAAGAAGAAGGGGTATGTGCTTCCTCGTGCAAAGATGGTGAATGCTGATCT 
TGCCAGGATTATCAATTCAGATGAGATTCAGAGTGTTGTGAATCCGATCAAGAAGGATGC 
GAAGAGGGCTGTTCTTAAGAAGAATCCATTGAAGAATCTCAATGTGATGTTGAAGTTGAA 
TCCTTATGCTAAGACCGCGAAGAGGATGTCACTGTTAGCTGAAGCACAGAGAGTTAAGGC 
TAAGAAGGAGAAGCTCGCCAAGAAGAGGAAAACCGTTACCAAGGTAATCTCAATACTTGA 
CTTGTTCTCTTATCAACCGTTTTTGGATTGTCTTTGTTTAGTTACTGATTACATTTTGAT 
CTGTGGTTGCATTTCATTTGACTTAACTTATATTGCAATTGTTCTAATTGACTGAGTTTG 
TGTATGTTAAGCTATACAATAATCTGTTCCCCTCTGGTTTAGTCTATGACTATAGTAGTC 
TTTCTTTACTAGATCTTACCTTTTCTGTTCTGAATTGTGGTCTAGTAGTTTGTCTTGTAA 
ATCTGTTGTGTACGATTCTTTGTCTTGATATTGATTTTAGGTTGAGCTATTAAGCAATTG 
AATCTCTTAGCACTTTCTTGTCCCTTGTGAAAATTGTTCTTCATATGTCCTCTTTTCTAA 
CTCCACTTTGAAATATCTATTTTTCTTACATCAGGAGGAGGCGTTGGCAATCAAAGCAGC 
AGGCAAGTCGTGGTACAAGACTATGATCTCCGACAGTGATTACACCGAGTTTGATAACTT 
CACCAAATGGCTCGGTGCTAGCCAGTAATAATCTCGTCTGCTTTGGAACACTTTCCATAT 
TTTAGTCAAAAGATTTTGGTTTTTTTAATCTGTTTTGTCTTTGGGTGTCTGGATATCAAG 
TTGAATTATGAACAAGTTTCACTTTTTTACATCTCCATTTCTTACTTCGCCTTTATCAGT 
TTCATTTATTTATCTCTTGCTCCTTCGTTTCCTATGATGATGCTTGTTATGTTATGAACC 
TACTTAAAAACAAGCTGAAGCTTTCTTTGGTTTACCCCAGCAGAAACATTAATCAAGTTC 
AATTGATCAATATGTCGATTGATTTACTGTTT
>AT3G09630.2 |  60S ribosomal protein L4/L1 (RPL4A) 
GCTGAGAGAAAACCCTAATTTCTCAAAGAGTCTAAAGAGACGGAGAGTGAGAGAAGAGAG 
AAACATTTCGAGACAAATGGCCGCCGCCGCTGCTCGTCCTCTCGTCACCATCCAAACCTT 
GGATGGTGACATGTCCACCGATCAATCCTCCACCGTCGTACTTCCCGACGTCATGACGGC 
GCCAGTTCGACCAGACATCGTTAACTTCGTTCACGCCCAAATCTCCAACAACAGCCGTCA 
GCCATACGCCGTATCGAAGAAGGCCGGTCACCAGACCTCCGCCGAGTCCTGGGGAACCGG 
ACGTGCCGTGTCTCGTATCCCTCGTGTTCCCGGTGGTGGTACTCACCGTGCTGGTCAAGC 
TGCGTTCGGTAACATGTGTCGTGGTGGTCGTATGTTCGCTCCAACCAAGATCTGGCGCCG 
CTGGCACCGTCGTGTCAATGTCAACATGAAGCGTCACGCAATCGTCTCAGCTATCGCTGC 
AACTGCTGTTCCTGCGCTTGTGATGGCTCGTGGTCACAAGATCGAGAATGTTCCTGAGAT 
GCCTCTTGTTGTGAGTGACTCCGCCGAAGCTGTGGAGAAGACCTCAGCTGCGATCAAGGT 
TTTGAAACAGATCGGTGCTTATGATGATGCTGAGAAGGCAAAGAACAGCATTGGAATCCG 
TCCTGGTAAAGGTAAAATGAGGAACCGTCGTTACATTTCTAGGAAAGGTCCTCTGGTGGT 
TTATGGAACTGAAGGATCTAAGATAGTTAAGGCGTTTAGAAACCTTCCTGGTGTTGAGCT 
TTGTCATGTGGAGAGGCTTAATTTGTTGAAGCTTGCTCCTGGTGGTCACCTTGGTCGGTT 
TGTGATCTGGACCAAGTCTGCCTTTGAGAAGCTTGAGTCTATCTATGGTTCGTTTGAGAA 
GCCATCAGAGAAGAAGAAGGGGTATGTGCTTCCTCGTGCAAAGATGGTGAATGCTGATCT 
TGCCAGGATTATCAATTCAGATGAGATTCAGAGTGTTGTGAATCCGATCAAGAAGGATGC 
GAAGAGGGCTGTTCTTAAGAAGAATCCATTGAAGAATCTCAATGTGATGTTGAAGTTGAA 
TCCTTATGCTAAGACCGCGAAGAGGATGTCACTGTTAGCTGAAGCACAGAGAGTTAAGGC 
TAAGAAGGAGAAGCTCGCCAAGAAGAGGAAAACCGTTACCAAGGTAATCTCAATACTTGA 
CTTGTTCTCTTATCAACCGTTTTTGGATTGTCTTTGTTTAGTTACTGATTACATTTTGAT 
CTGTGGTTGCATTTCATTTGACTTAACTTATATTGCAATTGTTCTAATTGACTGAGTTTG 
TGTATGTTAAGCTATACAATAATCTGTTCCCCTCTGGTTTAGTCTATGACTATAGTAGTC 
TTTCTTTACTAGATCTTACCTTTTCTGTTCTGAATTGTGGTCTAGTAGTTTGTCTTGTAA 
ATCTGTTGTGTACGATTCTTTGTCTTGATATTGATTTTAGGTTGAGCTATTAAGCAATTG 
AATCTCTTAGCACTTTCTTGTCCCTTGTGAAAATTGTTCTTCATATGTCCTCTTTTCTAA 
CTCCACTTTGAAATATCTATTTTTCTTACATCAGGAGGAGGCGTTGGCAATCAAAGCAGC 
AGGCAAGTCGTGGTACAAGACTATGATCTCCGACAGTGATTACACCGAGTTTGATAACTT 
CACCAAATGGCTCGGTGCTAGCCAGTAATAATCTCGTCTGCTTTGGAACACTTTCCATAT 
TTTAGTCAAAAGATTTTGGTTTTTTTAATCTGTTTTGTCTTTGGGTGTCTGGATATCAAG 
TTGAATTATGAACAAGTTTCACTTTTTTACATCTCCATTTCTTACTTCGCCTTTATCAGT 
TTCATTTATTTATCTCTTGCTCCTTCGTTTCCTATGATGATGCTTGTTATGTTATGAACC 
TACTTAAAAACAAGCTGAAGCTTTCTTTGGTTTACCCCAGCAGAAACATTAATCAAGTTC 
AATTGATCAATATGTCGATTGATTTACTGTTT
>AT3G09200.1 |  60S acidic ribosomal protein P0 (RPP0B) 
GCTGATACCAAAACCCTAATTTCTTTACGTCAAACTCTCTCTATACACAGAGTTAAATTG 
AGTTTGTGTCTCGTAACTTATCCTGTGAGCGAAAATGGTGAAAGCAACTAAGGCAGAGAA 
GAAGATCGCCTACGATACCAAGCTATGTCAGCTTATCGATGAGTACACCCAGATCTTGGT 
CGTTGCGGCCGATAACGTCGGATCAACTCAGCTTCAGAACATCAGAAAGGGTCTTCGTGG 
AGACTCCGTCGTGCTTATGGGGAAGAACACTATGATGAAGCGTTCCGTTAGGATTCACTC 
TGAGAACACCGGAAACACTGCAATCCTGAATCTGCTTCCTCTCCTTCAGGTAAACTTTCT 
TAGCTTGTCCAAAATGATTGAGATTTTATCGATGTGTTTGTGTTTAGAAAATAATTTGCG 
ATGGTTCTGTGTTCGTTTTTTGTAGGGAAACGTTGGTTTGATCTTTACCAAAGGTGACCT 
CAAGGAAGTGAGCGAGGAGGTTGCTAAGTACAAGGTTTGTTAATTGCTCTTGTTTCATAT 
CTTATTTACAAATGTGTGATTATAGCTTCGGATAGTAAGTATCTGATGCATAGAGGAATC 
ATTTCATGCTTACATTAGTTTATACATGTTCTGAATTTACTTGTGTTGCTTTCGATGGTA 
TCTGATGTATAGTGTAATCATTTCTTGCTTACGTTTCTGTTTATATTGCCTGTGTTCCTA 
TGAGTATTACAGTCATCCCAAGTAGAGCTCATCAATTGTGTAAAAAGTTGATGCTTTCTC 
AATGCGATTGACTTATGTATAATGTTGTTGCTTTCTCAACGTGATTGGATTGTGTAATAT 
GTTGATGCTTTTGCAATATGATTGGGTTAAAATGTTGATACTTTTTCAATGTGATTCGAT 
TGTAATGGAACTTTTCTTATTATGAATCAGGTTGGTGCCCCTGCTCGTGTGGGTTTGGTG 
GCTCCAATTGATGTGGTTGTCCAACCTGGCAACACTGGTCTCGACCCATCCCAAACATCT 
TTCTTCCAGGTTTGTTTTAAACTTACATTTAATGTTTGATTTGATTCGTTTGACGACAAT 
TTGAAGTTAATTGAACATGTATGTGTTTTGGATTGTTTTAGGTGCTTAACATCCCAACCA 
AGATTAACAAGGGTACCGTCGAAATCATCACCCCAGTTGAGCTTATCAAGCAAGGTGACA 
AGGTCGGGTCTTCTGAGGCTGCGCTTCTAGCCAAGCTTGGCATCAGGCCGTTCTCATATG 
GTCTTGTTGTCCAGTCTGTCTATGACAATGGCTCAGTCTTCAGCCCAGAGGTTCTTGATC 
TTACTGAAGACCAACTTGTGGAGAAGTTTGCTTCTGGTATCTCCATGGTCACTTCCTTGG 
CTCTTGCTGTGTCGTACCCTACCCTTGCTGCTGCACCGCATATGTTCATCAATGCGTACA 
AGAATGCCTTGGCTATTGCTGTTGCCACTGAGTACACCTTCCCTCAAGCAGAGAAGGTCA 
AGGAATACTTGAAGGTTAGTATGCATTAAAACTGTGCATCTTTTTCATTTTATTTCGGAA 
GTTTGGAGTACTGATTTTGTTTATGTTAACTCTCTGGAATGCAGGATCCAAGCAAGTTTG 
CTGTTGCTTCAGTAGCTGCGGTGTCTGCTGATGCAGGTGGTGGTGCCCCAGCTGCTGCTA 
AGGTAGAGGAGAAGGAAGAGTCCGACGAAGAAGACTATGGAGGTGATTTCGGTTTGTTCG 
ATGAAGAGTAGATTTTGTCGGTTAAGATCTTACCTTTTTGTCGTGGATTATAAGTGTTGC 
TTTGTTTTTAGTATGTTGGACCTCAATTTTCTTGGTTTTAGCCAATCCAGTTTTATGTTA 
CTACTGTCTTTTATTTTTTGGAAAGATTTCGTTTTCTTATGGTTGCTTTAATATTTTTCA 
ATAATGTCTGGACGATGAATTTGCAATTTATCTATCCGTCGAGAAAGTTAAGAGCTTCTT 
ATACATGACTTTGATAAAATTTGTATGAAGCAGAATCTTCTTAGA
>AT3G09200.1 |  60S acidic ribosomal protein P0 (RPP0B) 
GCTGATACCAAAACCCTAATTTCTTTACGTCAAACTCTCTCTATACACAGAGTTAAATTG 
AGTTTGTGTCTCGTAACTTATCCTGTGAGCGAAAATGGTGAAAGCAACTAAGGCAGAGAA 
GAAGATCGCCTACGATACCAAGCTATGTCAGCTTATCGATGAGTACACCCAGATCTTGGT 
CGTTGCGGCCGATAACGTCGGATCAACTCAGCTTCAGAACATCAGAAAGGGTCTTCGTGG 
AGACTCCGTCGTGCTTATGGGGAAGAACACTATGATGAAGCGTTCCGTTAGGATTCACTC 
TGAGAACACCGGAAACACTGCAATCCTGAATCTGCTTCCTCTCCTTCAGGTAAACTTTCT 
TAGCTTGTCCAAAATGATTGAGATTTTATCGATGTGTTTGTGTTTAGAAAATAATTTGCG 
ATGGTTCTGTGTTCGTTTTTTGTAGGGAAACGTTGGTTTGATCTTTACCAAAGGTGACCT 
CAAGGAAGTGAGCGAGGAGGTTGCTAAGTACAAGGTTTGTTAATTGCTCTTGTTTCATAT 
CTTATTTACAAATGTGTGATTATAGCTTCGGATAGTAAGTATCTGATGCATAGAGGAATC 
ATTTCATGCTTACATTAGTTTATACATGTTCTGAATTTACTTGTGTTGCTTTCGATGGTA 
TCTGATGTATAGTGTAATCATTTCTTGCTTACGTTTCTGTTTATATTGCCTGTGTTCCTA 
TGAGTATTACAGTCATCCCAAGTAGAGCTCATCAATTGTGTAAAAAGTTGATGCTTTCTC 
AATGCGATTGACTTATGTATAATGTTGTTGCTTTCTCAACGTGATTGGATTGTGTAATAT 
GTTGATGCTTTTGCAATATGATTGGGTTAAAATGTTGATACTTTTTCAATGTGATTCGAT 
TGTAATGGAACTTTTCTTATTATGAATCAGGTTGGTGCCCCTGCTCGTGTGGGTTTGGTG 
GCTCCAATTGATGTGGTTGTCCAACCTGGCAACACTGGTCTCGACCCATCCCAAACATCT 
TTCTTCCAGGTTTGTTTTAAACTTACATTTAATGTTTGATTTGATTCGTTTGACGACAAT 
TTGAAGTTAATTGAACATGTATGTGTTTTGGATTGTTTTAGGTGCTTAACATCCCAACCA 
AGATTAACAAGGGTACCGTCGAAATCATCACCCCAGTTGAGCTTATCAAGCAAGGTGACA 
AGGTCGGGTCTTCTGAGGCTGCGCTTCTAGCCAAGCTTGGCATCAGGCCGTTCTCATATG 
GTCTTGTTGTCCAGTCTGTCTATGACAATGGCTCAGTCTTCAGCCCAGAGGTTCTTGATC 
TTACTGAAGACCAACTTGTGGAGAAGTTTGCTTCTGGTATCTCCATGGTCACTTCCTTGG 
CTCTTGCTGTGTCGTACCCTACCCTTGCTGCTGCACCGCATATGTTCATCAATGCGTACA 
AGAATGCCTTGGCTATTGCTGTTGCCACTGAGTACACCTTCCCTCAAGCAGAGAAGGTCA 
AGGAATACTTGAAGGTTAGTATGCATTAAAACTGTGCATCTTTTTCATTTTATTTCGGAA 
GTTTGGAGTACTGATTTTGTTTATGTTAACTCTCTGGAATGCAGGATCCAAGCAAGTTTG 
CTGTTGCTTCAGTAGCTGCGGTGTCTGCTGATGCAGGTGGTGGTGCCCCAGCTGCTGCTA 
AGGTAGAGGAGAAGGAAGAGTCCGACGAAGAAGACTATGGAGGTGATTTCGGTTTGTTCG 
ATGAAGAGTAGATTTTGTCGGTTAAGATCTTACCTTTTTGTCGTGGATTATAAGTGTTGC 
TTTGTTTTTAGTATGTTGGACCTCAATTTTCTTGGTTTTAGCCAATCCAGTTTTATGTTA 
CTACTGTCTTTTATTTTTTGGAAAGATTTCGTTTTCTTATGGTTGCTTTAATATTTTTCA 
ATAATGTCTGGACGATGAATTTGCAATTTATCTATCCGTCGAGAAAGTTAAGAGCTTCTT 
ATACATGACTTTGATAAAATTTGTATGAAGCAGAATCTTCTTAGA
>AT3G09200.2 |  60S acidic ribosomal protein P0 (RPP0B) 
GCTGATACCAAAACCCTAATTTCTTTACGTCAAACTCTCTCTATACACAGAGTTAAATTG 
AGTTTGTGTCTCGTAACTTATCCTGTGAGCGAAAATGGTGAAAGCAACTAAGGCAGAGAA 
GAAGATCGCCTACGATACCAAGCTATGTCAGCTTATCGATGAGTACACCCAGATCTTGGT 
CGTTGCGGCCGATAACGTCGGATCAACTCAGCTTCAGAACATCAGAAAGGGTCTTCGTGG 
AGACTCCGTCGTGCTTATGGGGAAGAACACTATGATGAAGCGTTCCGTTAGGATTCACTC 
TGAGAACACCGGAAACACTGCAATCCTGAATCTGCTTCCTCTCCTTCAGGTAAACTTTCT 
TAGCTTGTCCAAAATGATTGAGATTTTATCGATGTGTTTGTGTTTAGAAAATAATTTGCG 
ATGGTTCTGTGTTCGTTTTTTGTAGGGAAACGTTGGTTTGATCTTTACCAAAGGTGACCT 
CAAGGAAGTGAGCGAGGAGGTTGCTAAGTACAAGGTTTGTTAATTGCTCTTGTTTCATAT 
CTTATTTACAAATGTGTGATTATAGCTTCGGATAGTAAGTATCTGATGCATAGAGGAATC 
ATTTCATGCTTACATTAGTTTATACATGTTCTGAATTTACTTGTGTTGCTTTCGATGGTA 
TCTGATGTATAGTGTAATCATTTCTTGCTTACGTTTCTGTTTATATTGCCTGTGTTCCTA 
TGAGTATTACAGTCATCCCAAGTAGAGCTCATCAATTGTGTAAAAAGTTGATGCTTTCTC 
AATGCGATTGACTTATGTATAATGTTGTTGCTTTCTCAACGTGATTGGATTGTGTAATAT 
GTTGATGCTTTTGCAATATGATTGGGTTAAAATGTTGATACTTTTTCAATGTGATTCGAT 
TGTAATGGAACTTTTCTTATTATGAATCAGGTTGGTGCCCCTGCTCGTGTGGGTTTGGTG 
GCTCCAATTGATGTGGTTGTCCAACCTGGCAACACTGGTCTCGACCCATCCCAAACATCT 
TTCTTCCAGGTTTGTTTTAAACTTACATTTAATGTTTGATTTGATTCGTTTGACGACAAT 
TTGAAGTTAATTGAACATGTATGTGTTTTGGATTGTTTTAGGTGCTTAACATCCCAACCA 
AGATTAACAAGGGTACCGTCGAAATCATCACCCCAGTTGAGCTTATCAAGCAAGGTGACA 
AGGTCGGGTCTTCTGAGGCTGCGCTTCTAGCCAAGCTTGGCATCAGGCCGTTCTCATATG 
GTCTTGTTGTCCAGTCTGTCTATGACAATGGCTCAGTCTTCAGCCCAGAGGTTCTTGATC 
TTACTGAAGACCAACTTGTGGAGAAGTTTGCTTCTGGTATCTCCATGGTCACTTCCTTGG 
CTCTTGCTGTGTCGTACCCTACCCTTGCTGCTGCACCGCATATGTTCATCAATGCGTACA 
AGAATGCCTTGGCTATTGCTGTTGCCACTGAGTACACCTTCCCTCAAGCAGAGAAGGTCA 
AGGAATACTTGAAGGTTAGTATGCATTAAAACTGTGCATCTTTTTCATTTTATTTCGGAA 
GTTTGGAGTACTGATTTTGTTTATGTTAACTCTCTGGAATGCAGGATCCAAGCAAGTTTG 
CTGTTGCTTCAGTAGCTGCGGTGTCTGCTGATGCAGGTGGTGGTGCCCCAGCTGCTGCTA 
AGGTAGAGGAGAAGGAAGAGTCCGACGAAGAAGACTATGGAGGTGATTTCGGTTTGTTCG 
ATGAAGAGTAGATTTTGTCGGTTAAGATCTTACCTTTTTGTCGTGGATTATAAGTGTTGC 
TTTGTTTTTAGTATGTTGGACCTCAATTTTCTTGGTTTTAGCCAATCCAGTTTTATGTTA 
CTACTGTCTTTTATTTTTTGGAAAGATTTCGTTTTCTTATGGTTGCTTTAATATTTTTCA 
ATAATGTCTGGACGATGAATTTGCAATTTATCTATCCGTCGAGAAAGTTAAGAGCTTCTT 
ATACATGACTTTGATAAAATTTGTATGAAGCAGAATCTTCTTAGA
>AT3G09200.2 |  60S acidic ribosomal protein P0 (RPP0B) 
GCTGATACCAAAACCCTAATTTCTTTACGTCAAACTCTCTCTATACACAGAGTTAAATTG 
AGTTTGTGTCTCGTAACTTATCCTGTGAGCGAAAATGGTGAAAGCAACTAAGGCAGAGAA 
GAAGATCGCCTACGATACCAAGCTATGTCAGCTTATCGATGAGTACACCCAGATCTTGGT 
CGTTGCGGCCGATAACGTCGGATCAACTCAGCTTCAGAACATCAGAAAGGGTCTTCGTGG 
AGACTCCGTCGTGCTTATGGGGAAGAACACTATGATGAAGCGTTCCGTTAGGATTCACTC 
TGAGAACACCGGAAACACTGCAATCCTGAATCTGCTTCCTCTCCTTCAGGTAAACTTTCT 
TAGCTTGTCCAAAATGATTGAGATTTTATCGATGTGTTTGTGTTTAGAAAATAATTTGCG 
ATGGTTCTGTGTTCGTTTTTTGTAGGGAAACGTTGGTTTGATCTTTACCAAAGGTGACCT 
CAAGGAAGTGAGCGAGGAGGTTGCTAAGTACAAGGTTTGTTAATTGCTCTTGTTTCATAT 
CTTATTTACAAATGTGTGATTATAGCTTCGGATAGTAAGTATCTGATGCATAGAGGAATC 
ATTTCATGCTTACATTAGTTTATACATGTTCTGAATTTACTTGTGTTGCTTTCGATGGTA 
TCTGATGTATAGTGTAATCATTTCTTGCTTACGTTTCTGTTTATATTGCCTGTGTTCCTA 
TGAGTATTACAGTCATCCCAAGTAGAGCTCATCAATTGTGTAAAAAGTTGATGCTTTCTC 
AATGCGATTGACTTATGTATAATGTTGTTGCTTTCTCAACGTGATTGGATTGTGTAATAT 
GTTGATGCTTTTGCAATATGATTGGGTTAAAATGTTGATACTTTTTCAATGTGATTCGAT 
TGTAATGGAACTTTTCTTATTATGAATCAGGTTGGTGCCCCTGCTCGTGTGGGTTTGGTG 
GCTCCAATTGATGTGGTTGTCCAACCTGGCAACACTGGTCTCGACCCATCCCAAACATCT 
TTCTTCCAGGTTTGTTTTAAACTTACATTTAATGTTTGATTTGATTCGTTTGACGACAAT 
TTGAAGTTAATTGAACATGTATGTGTTTTGGATTGTTTTAGGTGCTTAACATCCCAACCA 
AGATTAACAAGGGTACCGTCGAAATCATCACCCCAGTTGAGCTTATCAAGCAAGGTGACA 
AGGTCGGGTCTTCTGAGGCTGCGCTTCTAGCCAAGCTTGGCATCAGGCCGTTCTCATATG 
GTCTTGTTGTCCAGTCTGTCTATGACAATGGCTCAGTCTTCAGCCCAGAGGTTCTTGATC 
TTACTGAAGACCAACTTGTGGAGAAGTTTGCTTCTGGTATCTCCATGGTCACTTCCTTGG 
CTCTTGCTGTGTCGTACCCTACCCTTGCTGCTGCACCGCATATGTTCATCAATGCGTACA 
AGAATGCCTTGGCTATTGCTGTTGCCACTGAGTACACCTTCCCTCAAGCAGAGAAGGTCA 
AGGAATACTTGAAGGTTAGTATGCATTAAAACTGTGCATCTTTTTCATTTTATTTCGGAA 
GTTTGGAGTACTGATTTTGTTTATGTTAACTCTCTGGAATGCAGGATCCAAGCAAGTTTG 
CTGTTGCTTCAGTAGCTGCGGTGTCTGCTGATGCAGGTGGTGGTGCCCCAGCTGCTGCTA 
AGGTAGAGGAGAAGGAAGAGTCCGACGAAGAAGACTATGGAGGTGATTTCGGTTTGTTCG 
ATGAAGAGTAGATTTTGTCGGTTAAGATCTTACCTTTTTGTCGTGGATTATAAGTGTTGC 
TTTGTTTTTAGTATGTTGGACCTCAATTTTCTTGGTTTTAGCCAATCCAGTTTTATGTTA 
CTACTGTCTTTTATTTTTTGGAAAGATTTCGTTTTCTTATGGTTGCTTTAATATTTTTCA 
ATAATGTCTGGACGATGAATTTGCAATTTATCTATCCGTCGAGAAAGTTAAGAGCTTCTT 
ATACATGACTTTGATAAAATTTGTATGAAGCAGAATCTTCTTAGA
>AT2G47610.1 |  60S ribosomal protein L7A (RPL7aA) 
ATCAATGTACATGGTATATATATAAAAGGCAAAACCCTAGAAAACGATACTCTTCGACTC 
AGCCGTCCTTTCGCAGAAACCATTTGGAGTTGGAGCTTTGGACGACGACAATGGTATCAT 
CTCTCTTCCTTCCATCTTCATTTCGTTTCATTTGGGATCTGTTAGTTGTTTGCTTTCATA 
GTAGAATCATCGAATTAGATCCTTCACGATAGAGTTAGTGTTTCCTGGATGCATTCTCGC 
TTGAAGATGAACACACATGGGTTTCGATTTCCTCTCGGTGGTAACACCATCATTGCTTAT 
CTGCTTTGGATTTAGCTTTTGATAGATTTGGTAGTTGATATAGCTTATGAATCCATCTAG 
AAATTTGCGTAGAGAGCAATGTCACAAATGTTCTGTGGTTACTTTATCAATCTAATCACG 
CCACGATTTGGTTTTAGGCCCCGAAGAAAGGAGTGAAGGTAGCTGCTAAGAAGAAGACCG 
CGGTATGTTTCATTTCCAATTCTCTTCTTCTTTTTTAGGTTTTCGAACATTCAATTTGTT 
CTTTGTTGTTGTTTTTTTCTTTCTTGCTGAAGTTTTGTGTTTTGATTTCTGATTTCTCCA 
GGAGAAAGTTTCAAACCCTCTATTCGAGAGGAGGCCTAAGCAATTCGGTATTGGTGGAGC 
TTTACCTCCTAAGAAGGATCTCTCTCGCTACATCAAATGGCCCAAATCCATCCGTCTTCA 
AAGGCAAAAGAGGATCCTGAAGCAGAGGTTGAAGGTCCCTCCAGCTCTTAACCAATTCAC 
CAAGACTCTTGACAAGAATCTTGGTATGTCTATTTCATTCTCAATCTACTCTTCAAACAT 
TTACTACTTGCTGCTGTTAATTTATTATTGAAATATTTACCAGTTCTGGTAAATCTTGTG 
TTGCTGTAACCTTATAAGAAGACTTCGGTGCCTTATTTATATTCGTTATTGATAATTGCA 
GCTACCAGCCTCTTCAAGGTCCTTCTGAAGTACAGGCCAGAAGACAAAGCTGCCAAGAAG 
GAGCGTCTTGTAAAGAAGGCCCAAGCTGAAGCTGAGGGAAAGCCTTCTGAGTCTAAGAAG 
CCCATTGTAGTCAAATACGGCCTCAACCATGTGACCTACCTCATTGAGCAGAACAAGGCC 
CAACTTGTTGTTATTGCTCATGATGTCGACCCAATTGAGTTGGTTGTCTGGTTGCCTGCT 
CTGTGCAGGAAGATGGAAGTCCCGTACTGCATTGTCAAGGGCAAATCTCGTCTTGGAGCG 
GTATGTGTTGTGGGTGATTTCTCTCTAGTTTATAGCCACTAGCATGGAGAGTTAATCTTT 
ATTTCTTTCTCTGACTTTCAGGTTGTTCACCAGAAGACTGCTTCTTGCTTGTGTTTGACC 
ACTGTCAAGAACGAGGACAAGCTAGAGTTCAGCAAAATCCTGGAAGCTATCAAGGTAAAT 
ACTTCTTGTGACCAATAGAATGGTAGATTGTGTGAAACATATTGTTGGAGATTCTTATGA 
TTGTGTTTTTGGGTTTTTGTCTATAGGCCAACTTCAATGACAAGTACGAGGAGTACAGGA 
AGAAATGGGGAGGAGGCATAATGGGATCTAAGTCTCAGGCAAAGACCAAGGCAAAGGAAA 
GAGTTATTGCAAAGGAGGCTGCCCAAAGGATGAATTAAGAGGCTAGCTTCTTTTGTTTGT 
GGTTTGCTCGGATTCGTAAAACTTAATAGAGCTTTTTGTTTAGCTGGTTCTTGAAGTACC 
TCTTTTTTAGTTGAACCCTTTATTATGGATGTTTTGCAATTTCTTGGGACAGTTTCAATG 
TTATTCAAGCTGCTGGATCCTCTTTGGTCTCTCAACCACTTAAAACTTGACAGTGTGAAA 
TTTTAGCCAAATGCTTATTGCATTCTGGAAAGAGTTATAAGTTTAATTCTCAAATT
>AT1G56070.1 |  LOS1 copper ion binding / translation elongation factor/ translation factor nucleic acid binding 
ATAATAAGCTTTAGGCTGCTAGACGCCTGCCTCCTTGCACCTCTTTTCTTTCTCTCGTTC 
TCATCTTTCTCTCTAAGGTTAGTCCCTTGTGTAGATCCTCTCTTCATCGATTCAATTTCA 
TCTTCCTTGGTTTGATTTAGGAATTTTGTCACGATTTGGTGTTTAGATGATGGAGTCTTG 
CTGTTGATCTATGTTTATAGCACTTTGTTTCCATGGTTCTGTTGTTTCTTACCGTTTGTT 
GTGCATCGATCTGGTTTTGGTAGATCCCTCGTAGATAATAATCTGAATATGTCAAAGTTT 
TCTTACAAGTCTGTTGTGTTTTCAGTTTTGATTGATATTGTTATCCATGTAGTAGTCGAT 
CATCCAAAAACTGGTTCAGTGTGATTCTCCGATCATCGCCGCTGATTTTATATTTATCAT 
CATGTATAGATTTGCAGGTTTTATTTTGTTCGTTGTGTGTTTTTGTTCTTTGTTAAATTT 
AACCTCTATGCATTTGATGTACATGTTTTTGTGTTGGTCTCAGTTTCTCTTATTCTGTAT 
AAGCTAAGCTAAAGTCTCCATGGTTAGTGTCTGTTTAGTATTAAAATATTTCAATTTGCT 
AATTCTTTATGTTTTTGTGATGATATTGCAGAGATTTTGTAGGTGACAATCAAAAGTTTG 
ACAAAATGGTAAGACTTTTGTTTTTCTTACATTTATTTACATTATTACTATGTGGATACA 
AGCATATAACGATTTTATGAACTTGCAGGTGAAGTTTACAGCTGATGAGCTTCGAAGGAT 
TATGGACTACAAACACAACATCCGTAATATGTCTGTTATTGCTCATGTCGACCACGGTAT 
AATCTTCATCACTTTTTTTGTACTATTCTTGTCAGTTTTGATCTCTTGTTTGTTTACTGA 
ATTTGCTGGTCGAATTGTAATCTGAATCTAATGCATCTCTTTATATACTAATGTTTATAG 
TCTGTTTTGAAATTAATAGCGTCTCTTATCTGTTTTCTGAGTTTGCTGAACGTTTAAAAA 
AGTTTAAACTAATGCATCTTTATTTCATGATCAACAGGGAAATCCACTCTTACTGATTCT 
TTGGTTGCTGCTGCTGGTATCATTGCCCAAGAGGTTGCTGGTGATGTTCGTATGACTGAT 
ACCAGAGCTGATGAGGCTGAACGTGGTATCACTATCAAGTCCACTGGTATTTCTCTCTAC 
TACGAGATGACTGATGAATCCTTGAAGAGTTTCACTGGAGCCAGAGACGGAAACGAGTAC 
CTCATCAATCTTATTGATTCACCTGGGCACGTTGACTTTTCTTCTGAGGTTACTGCTGCT 
CTCCGTATTACTGATGGTGCTCTTGTGGTGGTCGACTGCATTGAGGGTGTGTGTGTTCAG 
ACTGAGACTGTTCTACGTCAGGCTCTTGGTGAGAGGATTCGACCTGTCTTGACTGTCAAC 
AAGATGGACAGGTGTTTCCTTGAGCTTCAGGTTGATGGTGAGGAGGCTTACCAGACTTTC 
TCGAGGGTTATTGAGAACGCTAATGTCATCATGGCTACATACGAGGATCCTCTCCTTGGT 
GATGTTCAGGTTTACCCAGAGAAGGGAACTGTGGCGTTTTCTGCTGGTCTCCATGGATGG 
GCGTTTACACTGACCAACTTCGCCAAGATGTATGCTTCCAAGTTCGGTGTTGTTGAATCT 
AAGATGATGGAGAGGCTCTGGGGTGAGAATTTCTTTGACCCTGCCACCAGGAAGTGGAGT 
GGCAAAAACACTGGTTCCCCGACCTGCAAGCGTGGGTTTGTTCAGTTCTGCTATGAACCC 
ATCAAGCAAATTATTGCTACTTGCATGAATGACCAGAAGGATAAGTTGTGGCCTATGTTG 
GCGAAGCTTGGTGTCTCAATGAAGAATGATGAGAAGGAGCTTATGGGTAAACCTCTAATG 
AAGCGTGTTATGCAGACTTGGCTCCCTGCAAGTACTGCACTACTTGAGATGATGATCTTT 
CATTTGCCATCTCCCCACACTGCCCAGAGGTACCGTGTTGAGAATCTGTATGAAGGTCCT 
CTTGATGATCAGTATGCAAATGCCATCAGGAACTGTGACCCCAATGGACCTCTCATGCTC 
TACGTATCCAAGATGATTCCAGCCTCTGACAAGGGTAGATTCTTTGCCTTCGGTCGTGTC 
TTTGCTGGTAAGGTTTCTACTGGTATGAAGGTCAGAATCATGGGTCCCAACTATATCCCT 
GGTGAGAAGAAGGATCTGTACACTAAGAGTGTTCAGAGGACTGTCATTTGGATGGGTAAG 
AGGCAAGAGACAGTGGAGGATGTCCCTTGTGGTAACACTGTTGCTATGGTTGGGCTGGAT 
CAGTTCATCACCAAGAATGCTACATTGACTAATGAGAAGGAAGTTGATGCTCACCCCATT 
CGTGCTATGAAGTTTTCTGTGTCTCCTGTTGTTCGTGTTGCTGTTCAGTGTAAGGTTGCG 
TCTGACCTTCCCAAGTTGGTTGAGGGTCTCAAGAGGTTGGCCAAGTCTGATCCTATGGTT 
GTGTGTACAATGGAGGAATCAGGTGAGCACATTGTTGCTGGTGCAGGAGAACTCCATCTT 
GAGATTTGTCTTAAGGATCTTCAGGATGATTTCATGGGTGGTGCTGAAATTATCAAGTCA 
GACCCTGTGGTCTCCTTCCGTGAGACAGTTTGTGATAGATCTACTCGCACAGTTATGAGT 
AAGTCTCCTAACAAGCATAACCGTCTGTACATGGAAGCAAGACCCATGGAGGAAGGTCTA 
GCTGAGGCTATTGATGATGGACGTATTGGCCCAAGGGATGACCCTAAGATCAGATCCAAG 
ATCTTGGCTGAGGAGTTTGGATGGGACAAGGATCTTGCAAAGAAGATCTGGGCTTTTGGA 
CCTGAAACCACAGGGCCTAACATGGTTGTCGATATGTGTAAGGGAGTTCAGTACCTTAAC 
GAAATCAAGGATTCAGTTGTTGCTGGTTTCCAGTGGGCGTCCAAGGAAGGTCCTCTTGCT 
GAAGAGAACATGAGAGGTATCTGTTTTGAGGTATGTGATGTGGTGCTTCACTCTGATGCC 
ATCCACAGAGGAGGTGGTCAGGTTATCCCCACAGCCAGAAGGGTCATATACGCTTCCCAG 
ATCACAGCTAAGCCCAGACTTTTGGAGCCGGTTTACATGGTTGAGATCCAGGCACCAGAG 
GGAGCTCTTGGAGGAATCTACAGTGTGCTGAATCAGAAGCGTGGACACGTGTTCGAGGAG 
ATGCAGAGGCCAGGAACTCCCTTGTACAACATCAAGGCATACCTGCCTGTTGTGGAGTCT 
TTCGGATTCTCAAGTCAGCTTAGGGCAGCAACCTCAGGACAGGCATTCCCACAGTGTGTG 
TTTGATCATTGGGAAATGATGTCTTCTGACCCTCTTGAGCCAGGTACTCAGGCTTCAGTT 
TTGGTGGCTGATATCAGGAAGAGGAAGGGATTGAAGGAAGCGATGACTCCACTATCTGAG 
TTCGAAGACAAGCTTTAAGCTTCACCAAGACTCGTACTAGCCTTTTTCCCAATGGTTGCT 
ACTCTCTCTATCTTAATTTTGTCTTGTTTTATTAATACTCTTATGGTATGACGGATTGTG 
AAGACTTTTCTCTCGCCATCCCCTGAATGTTTTTTACTTTTTTCCTAGTTGAGAACTTTG 
TTATTGTGTTCGCAAATATCTTGGTTTTGATTCTGTCTTGCTCTTTTTTTTTATATTCTT 
TTCTCTTCCGATCATTCATATATTCATGCATATTATTTAGGTTACTTACCGGAACACAGG 
ATGTAATTGTGTTAAGTCTCAGACTGTTTTATC
>AT3G49010.1 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
ATAAGTAGGGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGAT 
TTTTCTAAGTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGT 
TGATTTGTTATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGT 
AATATTACACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTT 
ACTGTATTACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAG 
AGTTTGAGATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAA 
TACTTCAAGATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCT 
TTTGTTTTTGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATC 
ATTTGATTTAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGC 
ACAACAATGTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACAT 
GGTTCAACCAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAAC 
ACTTCTGATATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTA 
TGTTATGTTGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTC 
TGGACCTCTCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAAC 
CGGTAAAGGATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTA 
TTCATATAACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATT 
ATTGAACTTAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTT 
CCTGCTGAACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGT 
ATCATGTTTCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGT 
ATCCCAAAGAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGA 
TCTTTGGAGGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTC 
ATTTTCCCGCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTT 
CAGTTGTTTAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTG 
TGTGTTAGGCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAG 
ACTACTTGCCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAA 
TGAAGTCTTTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCG 
GAGCTAGAGCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTT 
CTTAGGTAGAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACT 
GTCTTTTCTTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTC 
TTGATTTATGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCG 
TATGTTTTTTTC
>AT3G49010.1 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
ATAAGTAGGGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGAT 
TTTTCTAAGTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGT 
TGATTTGTTATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGT 
AATATTACACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTT 
ACTGTATTACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAG 
AGTTTGAGATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAA 
TACTTCAAGATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCT 
TTTGTTTTTGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATC 
ATTTGATTTAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGC 
ACAACAATGTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACAT 
GGTTCAACCAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAAC 
ACTTCTGATATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTA 
TGTTATGTTGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTC 
TGGACCTCTCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAAC 
CGGTAAAGGATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTA 
TTCATATAACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATT 
ATTGAACTTAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTT 
CCTGCTGAACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGT 
ATCATGTTTCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGT 
ATCCCAAAGAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGA 
TCTTTGGAGGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTC 
ATTTTCCCGCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTT 
CAGTTGTTTAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTG 
TGTGTTAGGCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAG 
ACTACTTGCCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAA 
TGAAGTCTTTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCG 
GAGCTAGAGCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTT 
CTTAGGTAGAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACT 
GTCTTTTCTTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTC 
TTGATTTATGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCG 
TATGTTTTTTTC
>AT3G49010.1 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
ATAAGTAGGGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGAT 
TTTTCTAAGTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGT 
TGATTTGTTATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGT 
AATATTACACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTT 
ACTGTATTACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAG 
AGTTTGAGATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAA 
TACTTCAAGATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCT 
TTTGTTTTTGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATC 
ATTTGATTTAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGC 
ACAACAATGTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACAT 
GGTTCAACCAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAAC 
ACTTCTGATATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTA 
TGTTATGTTGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTC 
TGGACCTCTCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAAC 
CGGTAAAGGATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTA 
TTCATATAACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATT 
ATTGAACTTAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTT 
CCTGCTGAACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGT 
ATCATGTTTCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGT 
ATCCCAAAGAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGA 
TCTTTGGAGGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTC 
ATTTTCCCGCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTT 
CAGTTGTTTAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTG 
TGTGTTAGGCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAG 
ACTACTTGCCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAA 
TGAAGTCTTTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCG 
GAGCTAGAGCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTT 
CTTAGGTAGAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACT 
GTCTTTTCTTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTC 
TTGATTTATGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCG 
TATGTTTTTTTC
>AT3G49010.1 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
ATAAGTAGGGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGAT 
TTTTCTAAGTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGT 
TGATTTGTTATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGT 
AATATTACACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTT 
ACTGTATTACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAG 
AGTTTGAGATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAA 
TACTTCAAGATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCT 
TTTGTTTTTGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATC 
ATTTGATTTAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGC 
ACAACAATGTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACAT 
GGTTCAACCAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAAC 
ACTTCTGATATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTA 
TGTTATGTTGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTC 
TGGACCTCTCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAAC 
CGGTAAAGGATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTA 
TTCATATAACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATT 
ATTGAACTTAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTT 
CCTGCTGAACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGT 
ATCATGTTTCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGT 
ATCCCAAAGAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGA 
TCTTTGGAGGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTC 
ATTTTCCCGCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTT 
CAGTTGTTTAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTG 
TGTGTTAGGCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAG 
ACTACTTGCCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAA 
TGAAGTCTTTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCG 
GAGCTAGAGCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTT 
CTTAGGTAGAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACT 
GTCTTTTCTTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTC 
TTGATTTATGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCG 
TATGTTTTTTTC
>AT3G49010.1 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
ATAAGTAGGGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGAT 
TTTTCTAAGTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGT 
TGATTTGTTATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGT 
AATATTACACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTT 
ACTGTATTACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAG 
AGTTTGAGATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAA 
TACTTCAAGATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCT 
TTTGTTTTTGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATC 
ATTTGATTTAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGC 
ACAACAATGTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACAT 
GGTTCAACCAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAAC 
ACTTCTGATATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTA 
TGTTATGTTGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTC 
TGGACCTCTCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAAC 
CGGTAAAGGATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTA 
TTCATATAACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATT 
ATTGAACTTAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTT 
CCTGCTGAACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGT 
ATCATGTTTCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGT 
ATCCCAAAGAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGA 
TCTTTGGAGGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTC 
ATTTTCCCGCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTT 
CAGTTGTTTAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTG 
TGTGTTAGGCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAG 
ACTACTTGCCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAA 
TGAAGTCTTTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCG 
GAGCTAGAGCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTT 
CTTAGGTAGAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACT 
GTCTTTTCTTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTC 
TTGATTTATGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCG 
TATGTTTTTTTC
>AT3G49010.2 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
GGATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCT 
CTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAG 
GGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAA 
GTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGT 
TATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTAC 
ACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATT 
ACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAG 
ATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAA 
GATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTT 
TGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATT 
TAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAAT 
GTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAAC 
CAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGA 
TATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGT 
TGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTC 
TCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAG 
GATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATA 
ACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACT 
TAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGA 
ACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTT 
TCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAA 
GAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGA 
GGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCC 
GCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTT 
TAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAG 
GCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTG 
CCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCT 
TTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGA 
GCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTA 
GAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTC 
TTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTA 
TGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTT 
TTTC
>AT3G49010.2 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
GGATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCT 
CTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAG 
GGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAA 
GTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGT 
TATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTAC 
ACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATT 
ACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAG 
ATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAA 
GATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTT 
TGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATT 
TAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAAT 
GTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAAC 
CAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGA 
TATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGT 
TGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTC 
TCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAG 
GATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATA 
ACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACT 
TAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGA 
ACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTT 
TCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAA 
GAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGA 
GGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCC 
GCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTT 
TAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAG 
GCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTG 
CCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCT 
TTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGA 
GCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTA 
GAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTC 
TTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTA 
TGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTT 
TTTC
>AT3G49010.2 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
GGATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCT 
CTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAG 
GGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAA 
GTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGT 
TATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTAC 
ACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATT 
ACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAG 
ATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAA 
GATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTT 
TGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATT 
TAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAAT 
GTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAAC 
CAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGA 
TATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGT 
TGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTC 
TCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAG 
GATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATA 
ACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACT 
TAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGA 
ACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTT 
TCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAA 
GAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGA 
GGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCC 
GCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTT 
TAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAG 
GCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTG 
CCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCT 
TTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGA 
GCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTA 
GAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTC 
TTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTA 
TGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTT 
TTTC
>AT3G49010.2 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
GGATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCT 
CTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAG 
GGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAA 
GTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGT 
TATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTAC 
ACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATT 
ACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAG 
ATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAA 
GATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTT 
TGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATT 
TAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAAT 
GTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAAC 
CAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGA 
TATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGT 
TGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTC 
TCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAG 
GATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATA 
ACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACT 
TAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGA 
ACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTT 
TCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAA 
GAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGA 
GGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCC 
GCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTT 
TAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAG 
GCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTG 
CCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCT 
TTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGA 
GCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTA 
GAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTC 
TTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTA 
TGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTT 
TTTC
>AT3G49010.2 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
GGATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCT 
CTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAG 
GGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAA 
GTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGT 
TATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTAC 
ACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATT 
ACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAG 
ATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAA 
GATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTT 
TGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATT 
TAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAAT 
GTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAAC 
CAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGA 
TATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGT 
TGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTC 
TCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAG 
GATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATA 
ACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACT 
TAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGA 
ACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTT 
TCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAA 
GAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGA 
GGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCC 
GCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTT 
TAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAG 
GCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTG 
CCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCT 
TTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGA 
GCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTA 
GAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTC 
TTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTA 
TGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTT 
TTTC
>AT3G49010.3 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
AGTTTTCGCTCCTCTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTT 
TGTGTATAAGTAGGGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTG 
TAGATTTTTCTAAGTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCG 
TCCGTTGATTTGTTATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAA 
TGAGTAATATTACACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACA 
TCCTTACTGTATTACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCT 
TTAAGAGTTTGAGATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTT 
TGAAATACTTCAAGATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGAT 
GGTCTTTTGTTTTTGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTT 
TCATCATTTGATTTAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAAT 
GAAGCACAACAATGTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAA 
GACATGGTTCAACCAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATG 
TCAACACTTCTGATATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCT 
TATTATGTTATGTTGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCA 
ACTTCTGGACCTCTCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTC 
AGAACCGGTAAAGGATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTC 
ATTTATTCATATAACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTA 
TGATTATTGAACTTAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTT 
CATTTCCTGCTGAACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTA 
TCGGTATCATGTTTCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTG 
CTGGTATCCCAAAGAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGA 
ACCGATCTTTGGAGGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGT 
TAGTCATTTTCCCGCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTA 
TGGTTCAGTTGTTTAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTC 
GTTTGTGTGTTAGGCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCA 
AGGAGACTACTTGCCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTC 
AGAAATGAAGTCTTTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCA 
TGCCGGAGCTAGAGCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCG 
TTCTTCTTAGGTAGAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATC 
AGACTGTCTTTTCTTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGC 
TTCTCTTGATTTATGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTA 
TTTCGTATGTTTTTTTC
>AT3G49010.3 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
AGTTTTCGCTCCTCTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTT 
TGTGTATAAGTAGGGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTG 
TAGATTTTTCTAAGTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCG 
TCCGTTGATTTGTTATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAA 
TGAGTAATATTACACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACA 
TCCTTACTGTATTACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCT 
TTAAGAGTTTGAGATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTT 
TGAAATACTTCAAGATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGAT 
GGTCTTTTGTTTTTGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTT 
TCATCATTTGATTTAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAAT 
GAAGCACAACAATGTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAA 
GACATGGTTCAACCAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATG 
TCAACACTTCTGATATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCT 
TATTATGTTATGTTGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCA 
ACTTCTGGACCTCTCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTC 
AGAACCGGTAAAGGATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTC 
ATTTATTCATATAACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTA 
TGATTATTGAACTTAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTT 
CATTTCCTGCTGAACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTA 
TCGGTATCATGTTTCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTG 
CTGGTATCCCAAAGAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGA 
ACCGATCTTTGGAGGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGT 
TAGTCATTTTCCCGCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTA 
TGGTTCAGTTGTTTAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTC 
GTTTGTGTGTTAGGCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCA 
AGGAGACTACTTGCCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTC 
AGAAATGAAGTCTTTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCA 
TGCCGGAGCTAGAGCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCG 
TTCTTCTTAGGTAGAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATC 
AGACTGTCTTTTCTTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGC 
TTCTCTTGATTTATGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTA 
TTTCGTATGTTTTTTTC
>AT3G49010.3 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
AGTTTTCGCTCCTCTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTT 
TGTGTATAAGTAGGGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTG 
TAGATTTTTCTAAGTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCG 
TCCGTTGATTTGTTATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAA 
TGAGTAATATTACACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACA 
TCCTTACTGTATTACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCT 
TTAAGAGTTTGAGATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTT 
TGAAATACTTCAAGATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGAT 
GGTCTTTTGTTTTTGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTT 
TCATCATTTGATTTAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAAT 
GAAGCACAACAATGTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAA 
GACATGGTTCAACCAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATG 
TCAACACTTCTGATATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCT 
TATTATGTTATGTTGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCA 
ACTTCTGGACCTCTCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTC 
AGAACCGGTAAAGGATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTC 
ATTTATTCATATAACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTA 
TGATTATTGAACTTAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTT 
CATTTCCTGCTGAACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTA 
TCGGTATCATGTTTCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTG 
CTGGTATCCCAAAGAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGA 
ACCGATCTTTGGAGGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGT 
TAGTCATTTTCCCGCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTA 
TGGTTCAGTTGTTTAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTC 
GTTTGTGTGTTAGGCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCA 
AGGAGACTACTTGCCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTC 
AGAAATGAAGTCTTTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCA 
TGCCGGAGCTAGAGCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCG 
TTCTTCTTAGGTAGAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATC 
AGACTGTCTTTTCTTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGC 
TTCTCTTGATTTATGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTA 
TTTCGTATGTTTTTTTC
>AT3G49010.3 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
AGTTTTCGCTCCTCTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTT 
TGTGTATAAGTAGGGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTG 
TAGATTTTTCTAAGTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCG 
TCCGTTGATTTGTTATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAA 
TGAGTAATATTACACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACA 
TCCTTACTGTATTACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCT 
TTAAGAGTTTGAGATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTT 
TGAAATACTTCAAGATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGAT 
GGTCTTTTGTTTTTGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTT 
TCATCATTTGATTTAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAAT 
GAAGCACAACAATGTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAA 
GACATGGTTCAACCAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATG 
TCAACACTTCTGATATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCT 
TATTATGTTATGTTGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCA 
ACTTCTGGACCTCTCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTC 
AGAACCGGTAAAGGATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTC 
ATTTATTCATATAACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTA 
TGATTATTGAACTTAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTT 
CATTTCCTGCTGAACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTA 
TCGGTATCATGTTTCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTG 
CTGGTATCCCAAAGAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGA 
ACCGATCTTTGGAGGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGT 
TAGTCATTTTCCCGCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTA 
TGGTTCAGTTGTTTAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTC 
GTTTGTGTGTTAGGCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCA 
AGGAGACTACTTGCCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTC 
AGAAATGAAGTCTTTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCA 
TGCCGGAGCTAGAGCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCG 
TTCTTCTTAGGTAGAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATC 
AGACTGTCTTTTCTTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGC 
TTCTCTTGATTTATGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTA 
TTTCGTATGTTTTTTTC
>AT3G49010.3 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
AGTTTTCGCTCCTCTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTT 
TGTGTATAAGTAGGGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTG 
TAGATTTTTCTAAGTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCG 
TCCGTTGATTTGTTATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAA 
TGAGTAATATTACACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACA 
TCCTTACTGTATTACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCT 
TTAAGAGTTTGAGATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTT 
TGAAATACTTCAAGATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGAT 
GGTCTTTTGTTTTTGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTT 
TCATCATTTGATTTAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAAT 
GAAGCACAACAATGTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAA 
GACATGGTTCAACCAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATG 
TCAACACTTCTGATATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCT 
TATTATGTTATGTTGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCA 
ACTTCTGGACCTCTCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTC 
AGAACCGGTAAAGGATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTC 
ATTTATTCATATAACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTA 
TGATTATTGAACTTAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTT 
CATTTCCTGCTGAACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTA 
TCGGTATCATGTTTCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTG 
CTGGTATCCCAAAGAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGA 
ACCGATCTTTGGAGGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGT 
TAGTCATTTTCCCGCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTA 
TGGTTCAGTTGTTTAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTC 
GTTTGTGTGTTAGGCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCA 
AGGAGACTACTTGCCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTC 
AGAAATGAAGTCTTTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCA 
TGCCGGAGCTAGAGCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCG 
TTCTTCTTAGGTAGAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATC 
AGACTGTCTTTTCTTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGC 
TTCTCTTGATTTATGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTA 
TTTCGTATGTTTTTTTC
>AT3G49010.4 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
GGATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCT 
CTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAG 
GGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAA 
GTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGT 
TATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTAC 
ACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATT 
ACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAG 
ATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAA 
GATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTT 
TGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATT 
TAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAAT 
GTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAAC 
CAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGA 
TATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGT 
TGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTC 
TCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAG 
GATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATA 
ACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACT 
TAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGA 
ACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTT 
TCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAA 
GAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGA 
GGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCC 
GCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTT 
TAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAG 
GCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTG 
CCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCT 
TTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGA 
GCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTA 
GAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTC 
TTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTA 
TGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTT 
TTTC
>AT3G49010.4 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
GGATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCT 
CTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAG 
GGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAA 
GTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGT 
TATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTAC 
ACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATT 
ACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAG 
ATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAA 
GATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTT 
TGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATT 
TAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAAT 
GTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAAC 
CAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGA 
TATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGT 
TGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTC 
TCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAG 
GATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATA 
ACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACT 
TAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGA 
ACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTT 
TCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAA 
GAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGA 
GGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCC 
GCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTT 
TAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAG 
GCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTG 
CCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCT 
TTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGA 
GCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTA 
GAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTC 
TTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTA 
TGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTT 
TTTC
>AT3G49010.4 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
GGATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCT 
CTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAG 
GGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAA 
GTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGT 
TATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTAC 
ACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATT 
ACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAG 
ATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAA 
GATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTT 
TGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATT 
TAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAAT 
GTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAAC 
CAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGA 
TATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGT 
TGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTC 
TCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAG 
GATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATA 
ACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACT 
TAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGA 
ACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTT 
TCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAA 
GAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGA 
GGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCC 
GCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTT 
TAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAG 
GCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTG 
CCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCT 
TTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGA 
GCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTA 
GAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTC 
TTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTA 
TGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTT 
TTTC
>AT3G49010.4 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
GGATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCT 
CTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAG 
GGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAA 
GTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGT 
TATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTAC 
ACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATT 
ACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAG 
ATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAA 
GATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTT 
TGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATT 
TAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAAT 
GTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAAC 
CAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGA 
TATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGT 
TGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTC 
TCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAG 
GATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATA 
ACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACT 
TAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGA 
ACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTT 
TCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAA 
GAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGA 
GGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCC 
GCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTT 
TAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAG 
GCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTG 
CCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCT 
TTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGA 
GCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTA 
GAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTC 
TTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTA 
TGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTT 
TTTC
>AT3G49010.4 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
GGATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCT 
CTCTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAG 
GGTTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAA 
GTTCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGT 
TATTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTAC 
ACTTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATT 
ACGACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAG 
ATTGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAA 
GATTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTT 
TGAAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATT 
TAAAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAAT 
GTTATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAAC 
CAGCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGA 
TATTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGT 
TGTACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTC 
TCCGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAG 
GATTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATA 
ACTATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACT 
TAGTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGA 
ACATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTT 
TCATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAA 
GAAGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGA 
GGGTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCC 
GCGTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTT 
TAATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAG 
GCTGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTG 
CCTATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCT 
TTCAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGA 
GCCAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTA 
GAAGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTC 
TTTCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTA 
TGGAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTT 
TTTC
>AT3G49010.5 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
ATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCTCT 
CTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAGGG 
TTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAAGT 
TCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGTTA 
TTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTACAC 
TTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATTAC 
GACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAGAT 
TGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAAGA 
TTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTTTG 
AAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATTTA 
AAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAATGT 
TATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAACCA 
GCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGATA 
TTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGTTG 
TACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTCTC 
CGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAGGA 
TTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATAAC 
TATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACTTA 
GTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGAAC 
ATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTTTC 
ATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAAGA 
AGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGAGG 
GTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCCGC 
GTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTTTA 
ATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAGGC 
TGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTGCC 
TATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCTTT 
CAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGAGC 
CAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTAGA 
AGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTCTT 
TCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTATG 
GAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTTTT 
TC
>AT3G49010.5 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
ATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCTCT 
CTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAGGG 
TTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAAGT 
TCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGTTA 
TTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTACAC 
TTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATTAC 
GACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAGAT 
TGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAAGA 
TTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTTTG 
AAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATTTA 
AAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAATGT 
TATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAACCA 
GCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGATA 
TTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGTTG 
TACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTCTC 
CGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAGGA 
TTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATAAC 
TATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACTTA 
GTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGAAC 
ATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTTTC 
ATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAAGA 
AGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGAGG 
GTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCCGC 
GTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTTTA 
ATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAGGC 
TGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTGCC 
TATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCTTT 
CAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGAGC 
CAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTAGA 
AGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTCTT 
TCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTATG 
GAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTTTT 
TC
>AT3G49010.5 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
ATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCTCT 
CTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAGGG 
TTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAAGT 
TCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGTTA 
TTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTACAC 
TTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATTAC 
GACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAGAT 
TGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAAGA 
TTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTTTG 
AAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATTTA 
AAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAATGT 
TATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAACCA 
GCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGATA 
TTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGTTG 
TACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTCTC 
CGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAGGA 
TTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATAAC 
TATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACTTA 
GTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGAAC 
ATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTTTC 
ATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAAGA 
AGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGAGG 
GTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCCGC 
GTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTTTA 
ATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAGGC 
TGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTGCC 
TATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCTTT 
CAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGAGC 
CAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTAGA 
AGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTCTT 
TCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTATG 
GAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTTTT 
TC
>AT3G49010.5 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
ATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCTCT 
CTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAGGG 
TTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAAGT 
TCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGTTA 
TTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTACAC 
TTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATTAC 
GACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAGAT 
TGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAAGA 
TTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTTTG 
AAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATTTA 
AAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAATGT 
TATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAACCA 
GCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGATA 
TTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGTTG 
TACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTCTC 
CGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAGGA 
TTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATAAC 
TATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACTTA 
GTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGAAC 
ATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTTTC 
ATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAAGA 
AGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGAGG 
GTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCCGC 
GTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTTTA 
ATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAGGC 
TGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTGCC 
TATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCTTT 
CAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGAGC 
CAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTAGA 
AGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTCTT 
TCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTATG 
GAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTTTT 
TC
>AT3G49010.5 |  ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1) structural constituent of ribosome 
ATATACTTCAGTCTAGAGCCGCGCAAGAAGACGATTCTCTCTGTGAGTTTTCGCTCCTCT 
CTACTTGTCGTCTCTCTGATTATCTTCGTTGCTACTGTCTCGTTTTGTGTATAAGTAGGG 
TTCTTGCTTGTTTTCTCTCATCGTGTGTTCTGCTGCTAGCTCCTGTAGATTTTTCTAAGT 
TCCTTGTTTTGTTCATTTCGAGTTTTATTGATCTGATATAAATCGTCCGTTGATTTGTTA 
TTTTGTTATGCTTTATTGATTTTGCAGAAAGTATCGTCCTTGGAATGAGTAATATTACAC 
TTTCAGTGATGAAACTTTTCGTTTATTTGATTGGTTTTGATAACATCCTTACTGTATTAC 
GACTGTTAATGTAATGTGCATACAAACTCTCGAAACTTTGATTCTTTAAGAGTTTGAGAT 
TGTCACAAGTCTCACCTTTAGTATAGATTTAATAAGAGTGATCTTTGAAATACTTCAAGA 
TTCGTATCTGTTTTACTCTATTTATGTTCTCTATATCTTTGAGATGGTCTTTTGTTTTTG 
AAGTTTGAGGTTTTATCATTTGATTTCCTTGAGCTGTTTAAAGTTTCATCATTTGATTTA 
AAGTGTGTCTGATTGATGTTTTTTGGCAGCTTGAGTTGAAGAAATGAAGCACAACAATGT 
TATCCCCAATGGTCACTTCAAAAAGCACTGGCAGAATTATGTCAAGACATGGTTCAACCA 
GCCTGCCAGGAAAACCAGAAGAAGAATTGGTTAGTAGTAGTAATGTCAACACTTCTGATA 
TTGTCATGTTTCGTTTTAAGTTTACACTACAATCTCTTTGGGTCTTATTATGTTATGTTG 
TACACAGCGAGGCAAAAGAAGGCTGTGAAGATCTTCCCTCGTCCAACTTCTGGACCTCTC 
CGCCCTGTTGTGCATGGTCAGACTCTTAAGTACAACATGAAGGTCAGAACCGGTAAAGGA 
TTCACTCTTGAAGAGCTCAAGGTTTGTAATTTCTATCTCTCTTTCATTTATTCATATAAC 
TATCAAGTTTCATTTCTTGCTATATATCGATGGGATTGTTGGTTATGATTATTGAACTTA 
GTTGGTTGGATTATCTATTTGTTTACATATATAGCTATCGTGTTTCATTTCCTGCTGAAC 
ATTGTTGTGATTGTTGATTGAAATTGGCTGGATTTTTCTTTACTATCGGTATCATGTTTC 
ATTTCTTGCTGAACATTGATCTGATTGTTTGATTAATATAGGCTGCTGGTATCCCAAAGA 
AGTTGGCGCCTACAATTGGTATTGCTGTTGACCATCGTCGCAAGAACCGATCTTTGGAGG 
GTCTTCAAACAAATGTCCAGAGGCTGAAAACCTACAAGACCAAGTTAGTCATTTTCCCGC 
GTCGTGCCCGCAAGGTCAAGGTAATCATTATAAACAATTGGTCTATGGTTCAGTTGTTTA 
ATGAATTGTTGGATTTGGTACTGATTTCGTACTTGTTCTGTTTTCGTTTGTGTGTTAGGC 
TGGTGACTCTACACCAGAAGAGTTGGCTAATGCTACCCAAGTTCAAGGAGACTACTTGCC 
TATTGTACGTGAGAAGCCTACCATGGAACTCGTCAAGCTGACTTCAGAAATGAAGTCTTT 
CAAGGCTTTTGACAAGATACGCCTTGAGCGCACTAACAAGAGGCATGCCGGAGCTAGAGC 
CAAGAGAGCCGCAGAGGCTGAGAAAGAAGAGAAGAAGTGAGGTCGTTCTTCTTAGGTAGA 
AGAAACTTTTATCTTATCAACTTTTGGAACTGAATTTTGTGTATCAGACTGTCTTTTCTT 
TCATCAGTTTTTATCCTTAAATCTTTGATTTTGCTGCTACCTTGCTTCTCTTGATTTATG 
GAAAAGACCGTATCTCACATCTCTACTTGCTATAGTTTCCTCTTATTTCGTATGTTTTTT 
TC
>AT5G60390.1 |  elongation factor 1-alpha / EF-1-alpha 
TAGGGTGCGCTCTCATATTTCTCACATTTTCGTAGCCGCAAGACTCCTTTCAGATTCTTA 
CTTGCAGGTTAGATATTTTCTCTCTTTAGTGTCTCCGATCTTCATCTTCTTATGATTATT 
GTAGCTGTTTAGGGTTTAGATTCTTAGTTTTAGCTCTATATTGACTGTGATTATCGCTTA 
TTCTTTGCTGTTGTTATACTGCTTTTGATTCTCTAGCTTTAGATCCGTTTACTCGTCGAT 
CAATATTGTTCCTATTGAGTCTGATGTATAATCCTCTGATTAATTGATAGCGTTTAGTTT 
TGATATCGTCTTCGCATGTTTTTTATCATGTCGATCTGTATCTGCTCTGGTTATAGTTGA 
TTCTGATGTATTTGGTTGGTGATGTTCCTTAGATTTGATATACCTGTTGTCTCGTGGTTT 
GATATGATAGCTCAACTGGTGATATGTGGTTTTGTTTCAGTGGATCTGTGTTTGATTATA 
TTGTTGACGTTTTGGTTGTTGTATAGTTGATGGTTGATGTATTTTTGTTGATTCTGATGT 
TTCGATTTTTGTTTTTGTTTTGACAGCTATGGGTAAAGAGAAGTTTCACATTAACATTGT 
GGTCATTGGTCATGTTGATTCTGGAAAATCGACCACAACTGGTCACTTGATCTATAAGCT 
TGGTGGTATTGACAAGCGTGTCATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAA 
GAGGTCCTTCAAGTACGCATGGGTGTTGGACAAACTTAAGGCCGAGCGTGAGCGTGGTAT 
TACCATCGATATTGCTCTATGGAAGTTCGAGACCACCAAGTACTACTGCACAGTCATTGA 
TGCCCCAGGACATCGTGATTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGATTG 
TGCTGTTCTTATCATTGACTCCACCACTGGAGGTTTTGAGGCTGGTATCTCTAAGGATGG 
TCAGACCCGTGAGCACGCTCTTCTTGCTTTCACCCTTGGTGTCAAGCAGATGATTTGCTG 
TTGTAACAAGGTAATATAACTTTCGTATTCATCATTGTATCTGCTTTTGTGATTGATTGA 
TTCGTTTTATTTGTTGCTAACTTGCGTCTTTTTCTATTTTCGCCTAACAGATGGATGCCA 
CCACCCCCAAATACTCCAAGGCTAGGTACGATGAAATCATCAAGGAGGTGTCTTCATACC 
TGAAGAAGGTCGGATACAACCCTGACAAAATCCCATTTGTGCCAATCTCTGGATTCGAGG 
GAGACAACATGATTGAGAGGTCAACCAACCTTGACTGGTACAAGGGACCAACTCTTCTTG 
AGGCTCTTGACCAGATCAACGAGCCCAAGAGGCCATCAGACAAGCCCCTTCGTCTTCCAC 
TTCAGGATGTCTACAAGATTGGTGGTATTGGAACGGTGCCAGTGGGACGTGTTGAGACTG 
GTATGATCAAGCCTGGTATGGTTGTTACCTTTGCTCCCACAGGGTTGACCACTGAGGTTA 
AGTCTGTTGAGATGCACCACGAGTCTCTTCTTGAGGCACTTCCCGGTGACAATGTTGGAT 
TCAATGTCAAGAATGTTGCTGTCAAGGATCTTAAGAGAGGATACGTTGCCTCTAACTCCA 
AGGATGATCCAGCTAAGGGTGCCGCCAACTTCACCTCCCAGGTCATCATCATGAACCACC 
CTGGTCAGATTGGTAACGGTTACGCCCCAGTTCTCGATTGCCACACCTCTCACATTGCAG 
TCAAGTTCTCTGAGATCTTGACCAAGATTGACAGGCGTTCTGGTAAGGAGATTGAGAAGG 
AGCCCAAGTTTTTGAAGAATGGTGACGCTGGTATGGTTAAGATGACCCCAACCAAGCCCA 
TGGTTGTTGAGACTTTCTCCGAGTACCCACCTTTGGGACGTTTCGCTGTTAGGGACATGA 
GGCAGACCGTTGCTGTTGGTGTTATTAAGAGCGTGGACAAGAAGGACCCAACTGGAGCCA 
AGGTCACCAAGGCTGCAGTGAAGAAGGGTGCCAAATGATGAGACTTTCGTTATGATCGAC 
TCTCTTATGGTTTTCTTTGGTTCTTAAAACTTTGATGGCGTTTGAGCCTTTTTCTTTTTT 
CTCTTTATTTCTGTGACTTTCTCTCTCCCTCCTTTTTGGATATCTCTGAGACTTTTTATT 
ATGGTTTTCAATTATGCAGTTTCCGGATAATTTTGCTTGAAACTTATTTAGGAGTTGTGT 
TACAAAGTTGCTGTCTTTCTTTGTTCTTGTTTAAACAATCATTCAGAGATCAACCCAACC 
ATACTTAGCGTTTTAAGATCTATGTAAGAGATAGGGTTCTATAGTTTCGTTAGAATTAAC 
TTGTGCTTAGTGTTTTCTGACAA
>AT5G60390.1 |  elongation factor 1-alpha / EF-1-alpha 
TAGGGTGCGCTCTCATATTTCTCACATTTTCGTAGCCGCAAGACTCCTTTCAGATTCTTA 
CTTGCAGGTTAGATATTTTCTCTCTTTAGTGTCTCCGATCTTCATCTTCTTATGATTATT 
GTAGCTGTTTAGGGTTTAGATTCTTAGTTTTAGCTCTATATTGACTGTGATTATCGCTTA 
TTCTTTGCTGTTGTTATACTGCTTTTGATTCTCTAGCTTTAGATCCGTTTACTCGTCGAT 
CAATATTGTTCCTATTGAGTCTGATGTATAATCCTCTGATTAATTGATAGCGTTTAGTTT 
TGATATCGTCTTCGCATGTTTTTTATCATGTCGATCTGTATCTGCTCTGGTTATAGTTGA 
TTCTGATGTATTTGGTTGGTGATGTTCCTTAGATTTGATATACCTGTTGTCTCGTGGTTT 
GATATGATAGCTCAACTGGTGATATGTGGTTTTGTTTCAGTGGATCTGTGTTTGATTATA 
TTGTTGACGTTTTGGTTGTTGTATAGTTGATGGTTGATGTATTTTTGTTGATTCTGATGT 
TTCGATTTTTGTTTTTGTTTTGACAGCTATGGGTAAAGAGAAGTTTCACATTAACATTGT 
GGTCATTGGTCATGTTGATTCTGGAAAATCGACCACAACTGGTCACTTGATCTATAAGCT 
TGGTGGTATTGACAAGCGTGTCATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAA 
GAGGTCCTTCAAGTACGCATGGGTGTTGGACAAACTTAAGGCCGAGCGTGAGCGTGGTAT 
TACCATCGATATTGCTCTATGGAAGTTCGAGACCACCAAGTACTACTGCACAGTCATTGA 
TGCCCCAGGACATCGTGATTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGATTG 
TGCTGTTCTTATCATTGACTCCACCACTGGAGGTTTTGAGGCTGGTATCTCTAAGGATGG 
TCAGACCCGTGAGCACGCTCTTCTTGCTTTCACCCTTGGTGTCAAGCAGATGATTTGCTG 
TTGTAACAAGGTAATATAACTTTCGTATTCATCATTGTATCTGCTTTTGTGATTGATTGA 
TTCGTTTTATTTGTTGCTAACTTGCGTCTTTTTCTATTTTCGCCTAACAGATGGATGCCA 
CCACCCCCAAATACTCCAAGGCTAGGTACGATGAAATCATCAAGGAGGTGTCTTCATACC 
TGAAGAAGGTCGGATACAACCCTGACAAAATCCCATTTGTGCCAATCTCTGGATTCGAGG 
GAGACAACATGATTGAGAGGTCAACCAACCTTGACTGGTACAAGGGACCAACTCTTCTTG 
AGGCTCTTGACCAGATCAACGAGCCCAAGAGGCCATCAGACAAGCCCCTTCGTCTTCCAC 
TTCAGGATGTCTACAAGATTGGTGGTATTGGAACGGTGCCAGTGGGACGTGTTGAGACTG 
GTATGATCAAGCCTGGTATGGTTGTTACCTTTGCTCCCACAGGGTTGACCACTGAGGTTA 
AGTCTGTTGAGATGCACCACGAGTCTCTTCTTGAGGCACTTCCCGGTGACAATGTTGGAT 
TCAATGTCAAGAATGTTGCTGTCAAGGATCTTAAGAGAGGATACGTTGCCTCTAACTCCA 
AGGATGATCCAGCTAAGGGTGCCGCCAACTTCACCTCCCAGGTCATCATCATGAACCACC 
CTGGTCAGATTGGTAACGGTTACGCCCCAGTTCTCGATTGCCACACCTCTCACATTGCAG 
TCAAGTTCTCTGAGATCTTGACCAAGATTGACAGGCGTTCTGGTAAGGAGATTGAGAAGG 
AGCCCAAGTTTTTGAAGAATGGTGACGCTGGTATGGTTAAGATGACCCCAACCAAGCCCA 
TGGTTGTTGAGACTTTCTCCGAGTACCCACCTTTGGGACGTTTCGCTGTTAGGGACATGA 
GGCAGACCGTTGCTGTTGGTGTTATTAAGAGCGTGGACAAGAAGGACCCAACTGGAGCCA 
AGGTCACCAAGGCTGCAGTGAAGAAGGGTGCCAAATGATGAGACTTTCGTTATGATCGAC 
TCTCTTATGGTTTTCTTTGGTTCTTAAAACTTTGATGGCGTTTGAGCCTTTTTCTTTTTT 
CTCTTTATTTCTGTGACTTTCTCTCTCCCTCCTTTTTGGATATCTCTGAGACTTTTTATT 
ATGGTTTTCAATTATGCAGTTTCCGGATAATTTTGCTTGAAACTTATTTAGGAGTTGTGT 
TACAAAGTTGCTGTCTTTCTTTGTTCTTGTTTAAACAATCATTCAGAGATCAACCCAACC 
ATACTTAGCGTTTTAAGATCTATGTAAGAGATAGGGTTCTATAGTTTCGTTAGAATTAAC 
TTGTGCTTAGTGTTTTCTGACAA
>AT5G60390.1 |  elongation factor 1-alpha / EF-1-alpha 
TAGGGTGCGCTCTCATATTTCTCACATTTTCGTAGCCGCAAGACTCCTTTCAGATTCTTA 
CTTGCAGGTTAGATATTTTCTCTCTTTAGTGTCTCCGATCTTCATCTTCTTATGATTATT 
GTAGCTGTTTAGGGTTTAGATTCTTAGTTTTAGCTCTATATTGACTGTGATTATCGCTTA 
TTCTTTGCTGTTGTTATACTGCTTTTGATTCTCTAGCTTTAGATCCGTTTACTCGTCGAT 
CAATATTGTTCCTATTGAGTCTGATGTATAATCCTCTGATTAATTGATAGCGTTTAGTTT 
TGATATCGTCTTCGCATGTTTTTTATCATGTCGATCTGTATCTGCTCTGGTTATAGTTGA 
TTCTGATGTATTTGGTTGGTGATGTTCCTTAGATTTGATATACCTGTTGTCTCGTGGTTT 
GATATGATAGCTCAACTGGTGATATGTGGTTTTGTTTCAGTGGATCTGTGTTTGATTATA 
TTGTTGACGTTTTGGTTGTTGTATAGTTGATGGTTGATGTATTTTTGTTGATTCTGATGT 
TTCGATTTTTGTTTTTGTTTTGACAGCTATGGGTAAAGAGAAGTTTCACATTAACATTGT 
GGTCATTGGTCATGTTGATTCTGGAAAATCGACCACAACTGGTCACTTGATCTATAAGCT 
TGGTGGTATTGACAAGCGTGTCATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAA 
GAGGTCCTTCAAGTACGCATGGGTGTTGGACAAACTTAAGGCCGAGCGTGAGCGTGGTAT 
TACCATCGATATTGCTCTATGGAAGTTCGAGACCACCAAGTACTACTGCACAGTCATTGA 
TGCCCCAGGACATCGTGATTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGATTG 
TGCTGTTCTTATCATTGACTCCACCACTGGAGGTTTTGAGGCTGGTATCTCTAAGGATGG 
TCAGACCCGTGAGCACGCTCTTCTTGCTTTCACCCTTGGTGTCAAGCAGATGATTTGCTG 
TTGTAACAAGGTAATATAACTTTCGTATTCATCATTGTATCTGCTTTTGTGATTGATTGA 
TTCGTTTTATTTGTTGCTAACTTGCGTCTTTTTCTATTTTCGCCTAACAGATGGATGCCA 
CCACCCCCAAATACTCCAAGGCTAGGTACGATGAAATCATCAAGGAGGTGTCTTCATACC 
TGAAGAAGGTCGGATACAACCCTGACAAAATCCCATTTGTGCCAATCTCTGGATTCGAGG 
GAGACAACATGATTGAGAGGTCAACCAACCTTGACTGGTACAAGGGACCAACTCTTCTTG 
AGGCTCTTGACCAGATCAACGAGCCCAAGAGGCCATCAGACAAGCCCCTTCGTCTTCCAC 
TTCAGGATGTCTACAAGATTGGTGGTATTGGAACGGTGCCAGTGGGACGTGTTGAGACTG 
GTATGATCAAGCCTGGTATGGTTGTTACCTTTGCTCCCACAGGGTTGACCACTGAGGTTA 
AGTCTGTTGAGATGCACCACGAGTCTCTTCTTGAGGCACTTCCCGGTGACAATGTTGGAT 
TCAATGTCAAGAATGTTGCTGTCAAGGATCTTAAGAGAGGATACGTTGCCTCTAACTCCA 
AGGATGATCCAGCTAAGGGTGCCGCCAACTTCACCTCCCAGGTCATCATCATGAACCACC 
CTGGTCAGATTGGTAACGGTTACGCCCCAGTTCTCGATTGCCACACCTCTCACATTGCAG 
TCAAGTTCTCTGAGATCTTGACCAAGATTGACAGGCGTTCTGGTAAGGAGATTGAGAAGG 
AGCCCAAGTTTTTGAAGAATGGTGACGCTGGTATGGTTAAGATGACCCCAACCAAGCCCA 
TGGTTGTTGAGACTTTCTCCGAGTACCCACCTTTGGGACGTTTCGCTGTTAGGGACATGA 
GGCAGACCGTTGCTGTTGGTGTTATTAAGAGCGTGGACAAGAAGGACCCAACTGGAGCCA 
AGGTCACCAAGGCTGCAGTGAAGAAGGGTGCCAAATGATGAGACTTTCGTTATGATCGAC 
TCTCTTATGGTTTTCTTTGGTTCTTAAAACTTTGATGGCGTTTGAGCCTTTTTCTTTTTT 
CTCTTTATTTCTGTGACTTTCTCTCTCCCTCCTTTTTGGATATCTCTGAGACTTTTTATT 
ATGGTTTTCAATTATGCAGTTTCCGGATAATTTTGCTTGAAACTTATTTAGGAGTTGTGT 
TACAAAGTTGCTGTCTTTCTTTGTTCTTGTTTAAACAATCATTCAGAGATCAACCCAACC 
ATACTTAGCGTTTTAAGATCTATGTAAGAGATAGGGTTCTATAGTTTCGTTAGAATTAAC 
TTGTGCTTAGTGTTTTCTGACAA
>AT5G60390.2 |  elongation factor 1-alpha / EF-1-alpha 
TAGGGTGCGCTCTCATATTTCTCACATTTTCGTAGCCGCAAGACTCCTTTCAGATTCTTA 
CTTGCAGGTTAGATATTTTCTCTCTTTAGTGTCTCCGATCTTCATCTTCTTATGATTATT 
GTAGCTGTTTAGGGTTTAGATTCTTAGTTTTAGCTCTATATTGACTGTGATTATCGCTTA 
TTCTTTGCTGTTGTTATACTGCTTTTGATTCTCTAGCTTTAGATCCGTTTACTCGTCGAT 
CAATATTGTTCCTATTGAGTCTGATGTATAATCCTCTGATTAATTGATAGCGTTTAGTTT 
TGATATCGTCTTCGCATGTTTTTTATCATGTCGATCTGTATCTGCTCTGGTTATAGTTGA 
TTCTGATGTATTTGGTTGGTGATGTTCCTTAGATTTGATATACCTGTTGTCTCGTGGTTT 
GATATGATAGCTCAACTGGTGATATGTGGTTTTGTTTCAGTGGATCTGTGTTTGATTATA 
TTGTTGACGTTTTGGTTGTTGTATAGTTGATGGTTGATGTATTTTTGTTGATTCTGATGT 
TTCGATTTTTGTTTTTGTTTTGACAGCTATGGGTAAAGAGAAGTTTCACATTAACATTGT 
GGTCATTGGTCATGTTGATTCTGGAAAATCGACCACAACTGGTCACTTGATCTATAAGCT 
TGGTGGTATTGACAAGCGTGTCATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAA 
GAGGTCCTTCAAGTACGCATGGGTGTTGGACAAACTTAAGGCCGAGCGTGAGCGTGGTAT 
TACCATCGATATTGCTCTATGGAAGTTCGAGACCACCAAGTACTACTGCACAGTCATTGA 
TGCCCCAGGACATCGTGATTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGATTG 
TGCTGTTCTTATCATTGACTCCACCACTGGAGGTTTTGAGGCTGGTATCTCTAAGGATGG 
TCAGACCCGTGAGCACGCTCTTCTTGCTTTCACCCTTGGTGTCAAGCAGATGATTTGCTG 
TTGTAACAAGGTAATATAACTTTCGTATTCATCATTGTATCTGCTTTTGTGATTGATTGA 
TTCGTTTTATTTGTTGCTAACTTGCGTCTTTTTCTATTTTCGCCTAACAGATGGATGCCA 
CCACCCCCAAATACTCCAAGGCTAGGTACGATGAAATCATCAAGGAGGTGTCTTCATACC 
TGAAGAAGGTCGGATACAACCCTGACAAAATCCCATTTGTGCCAATCTCTGGATTCGAGG 
GAGACAACATGATTGAGAGGTCAACCAACCTTGACTGGTACAAGGGACCAACTCTTCTTG 
AGGCTCTTGACCAGATCAACGAGCCCAAGAGGCCATCAGACAAGCCCCTTCGTCTTCCAC 
TTCAGGATGTCTACAAGATTGGTGGTATTGGAACGGTGCCAGTGGGACGTGTTGAGACTG 
GTATGATCAAGCCTGGTATGGTTGTTACCTTTGCTCCCACAGGGTTGACCACTGAGGTTA 
AGTCTGTTGAGATGCACCACGAGTCTCTTCTTGAGGCACTTCCCGGTGACAATGTTGGAT 
TCAATGTCAAGAATGTTGCTGTCAAGGATCTTAAGAGAGGATACGTTGCCTCTAACTCCA 
AGGATGATCCAGCTAAGGGTGCCGCCAACTTCACCTCCCAGGTCATCATCATGAACCACC 
CTGGTCAGATTGGTAACGGTTACGCCCCAGTTCTCGATTGCCACACCTCTCACATTGCAG 
TCAAGTTCTCTGAGATCTTGACCAAGATTGACAGGCGTTCTGGTAAGGAGATTGAGAAGG 
AGCCCAAGTTTTTGAAGAATGGTGACGCTGGTATGGTTAAGATGACCCCAACCAAGCCCA 
TGGTTGTTGAGACTTTCTCCGAGTACCCACCTTTGGGACGTTTCGCTGTTAGGGACATGA 
GGCAGACCGTTGCTGTTGGTGTTATTAAGAGCGTGGACAAGAAGGACCCAACTGGAGCCA 
AGGTCACCAAGGCTGCAGTGAAGAAGGGTGCCAAATGATGAGACTTTCGTTATGATCGAC 
TCTCTTATGGTTTTCTTTGGTTCTTAAAACTTTGATGGCGTTTGAGCCTTTTTCTTTTTT 
CTCTTTATTTCTGTGACTTTCTCTCTCCCTCCTTTTTGGATATCTCTGAGACTTTTTATT 
ATGGTTTTCAATTATGCAGTTTCCGGATAATTTTGCTTGAAACTTATTTAGGAGTTGTGT 
TACAAAGTTGCTGTCTTTCTTTGTTCTTGTTTAAACAATCATTCAGAGATCAACCCAACC 
ATACTTAGCGTTTTAAGATCTATGTAAGAGATAGGGTTCTATAGTTTCGTTAGAATTAAC 
TTGTGCTTAGTGTTTTCTGACAA
>AT5G60390.2 |  elongation factor 1-alpha / EF-1-alpha 
TAGGGTGCGCTCTCATATTTCTCACATTTTCGTAGCCGCAAGACTCCTTTCAGATTCTTA 
CTTGCAGGTTAGATATTTTCTCTCTTTAGTGTCTCCGATCTTCATCTTCTTATGATTATT 
GTAGCTGTTTAGGGTTTAGATTCTTAGTTTTAGCTCTATATTGACTGTGATTATCGCTTA 
TTCTTTGCTGTTGTTATACTGCTTTTGATTCTCTAGCTTTAGATCCGTTTACTCGTCGAT 
CAATATTGTTCCTATTGAGTCTGATGTATAATCCTCTGATTAATTGATAGCGTTTAGTTT 
TGATATCGTCTTCGCATGTTTTTTATCATGTCGATCTGTATCTGCTCTGGTTATAGTTGA 
TTCTGATGTATTTGGTTGGTGATGTTCCTTAGATTTGATATACCTGTTGTCTCGTGGTTT 
GATATGATAGCTCAACTGGTGATATGTGGTTTTGTTTCAGTGGATCTGTGTTTGATTATA 
TTGTTGACGTTTTGGTTGTTGTATAGTTGATGGTTGATGTATTTTTGTTGATTCTGATGT 
TTCGATTTTTGTTTTTGTTTTGACAGCTATGGGTAAAGAGAAGTTTCACATTAACATTGT 
GGTCATTGGTCATGTTGATTCTGGAAAATCGACCACAACTGGTCACTTGATCTATAAGCT 
TGGTGGTATTGACAAGCGTGTCATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAA 
GAGGTCCTTCAAGTACGCATGGGTGTTGGACAAACTTAAGGCCGAGCGTGAGCGTGGTAT 
TACCATCGATATTGCTCTATGGAAGTTCGAGACCACCAAGTACTACTGCACAGTCATTGA 
TGCCCCAGGACATCGTGATTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGATTG 
TGCTGTTCTTATCATTGACTCCACCACTGGAGGTTTTGAGGCTGGTATCTCTAAGGATGG 
TCAGACCCGTGAGCACGCTCTTCTTGCTTTCACCCTTGGTGTCAAGCAGATGATTTGCTG 
TTGTAACAAGGTAATATAACTTTCGTATTCATCATTGTATCTGCTTTTGTGATTGATTGA 
TTCGTTTTATTTGTTGCTAACTTGCGTCTTTTTCTATTTTCGCCTAACAGATGGATGCCA 
CCACCCCCAAATACTCCAAGGCTAGGTACGATGAAATCATCAAGGAGGTGTCTTCATACC 
TGAAGAAGGTCGGATACAACCCTGACAAAATCCCATTTGTGCCAATCTCTGGATTCGAGG 
GAGACAACATGATTGAGAGGTCAACCAACCTTGACTGGTACAAGGGACCAACTCTTCTTG 
AGGCTCTTGACCAGATCAACGAGCCCAAGAGGCCATCAGACAAGCCCCTTCGTCTTCCAC 
TTCAGGATGTCTACAAGATTGGTGGTATTGGAACGGTGCCAGTGGGACGTGTTGAGACTG 
GTATGATCAAGCCTGGTATGGTTGTTACCTTTGCTCCCACAGGGTTGACCACTGAGGTTA 
AGTCTGTTGAGATGCACCACGAGTCTCTTCTTGAGGCACTTCCCGGTGACAATGTTGGAT 
TCAATGTCAAGAATGTTGCTGTCAAGGATCTTAAGAGAGGATACGTTGCCTCTAACTCCA 
AGGATGATCCAGCTAAGGGTGCCGCCAACTTCACCTCCCAGGTCATCATCATGAACCACC 
CTGGTCAGATTGGTAACGGTTACGCCCCAGTTCTCGATTGCCACACCTCTCACATTGCAG 
TCAAGTTCTCTGAGATCTTGACCAAGATTGACAGGCGTTCTGGTAAGGAGATTGAGAAGG 
AGCCCAAGTTTTTGAAGAATGGTGACGCTGGTATGGTTAAGATGACCCCAACCAAGCCCA 
TGGTTGTTGAGACTTTCTCCGAGTACCCACCTTTGGGACGTTTCGCTGTTAGGGACATGA 
GGCAGACCGTTGCTGTTGGTGTTATTAAGAGCGTGGACAAGAAGGACCCAACTGGAGCCA 
AGGTCACCAAGGCTGCAGTGAAGAAGGGTGCCAAATGATGAGACTTTCGTTATGATCGAC 
TCTCTTATGGTTTTCTTTGGTTCTTAAAACTTTGATGGCGTTTGAGCCTTTTTCTTTTTT 
CTCTTTATTTCTGTGACTTTCTCTCTCCCTCCTTTTTGGATATCTCTGAGACTTTTTATT 
ATGGTTTTCAATTATGCAGTTTCCGGATAATTTTGCTTGAAACTTATTTAGGAGTTGTGT 
TACAAAGTTGCTGTCTTTCTTTGTTCTTGTTTAAACAATCATTCAGAGATCAACCCAACC 
ATACTTAGCGTTTTAAGATCTATGTAAGAGATAGGGTTCTATAGTTTCGTTAGAATTAAC 
TTGTGCTTAGTGTTTTCTGACAA
>AT5G60390.2 |  elongation factor 1-alpha / EF-1-alpha 
TAGGGTGCGCTCTCATATTTCTCACATTTTCGTAGCCGCAAGACTCCTTTCAGATTCTTA 
CTTGCAGGTTAGATATTTTCTCTCTTTAGTGTCTCCGATCTTCATCTTCTTATGATTATT 
GTAGCTGTTTAGGGTTTAGATTCTTAGTTTTAGCTCTATATTGACTGTGATTATCGCTTA 
TTCTTTGCTGTTGTTATACTGCTTTTGATTCTCTAGCTTTAGATCCGTTTACTCGTCGAT 
CAATATTGTTCCTATTGAGTCTGATGTATAATCCTCTGATTAATTGATAGCGTTTAGTTT 
TGATATCGTCTTCGCATGTTTTTTATCATGTCGATCTGTATCTGCTCTGGTTATAGTTGA 
TTCTGATGTATTTGGTTGGTGATGTTCCTTAGATTTGATATACCTGTTGTCTCGTGGTTT 
GATATGATAGCTCAACTGGTGATATGTGGTTTTGTTTCAGTGGATCTGTGTTTGATTATA 
TTGTTGACGTTTTGGTTGTTGTATAGTTGATGGTTGATGTATTTTTGTTGATTCTGATGT 
TTCGATTTTTGTTTTTGTTTTGACAGCTATGGGTAAAGAGAAGTTTCACATTAACATTGT 
GGTCATTGGTCATGTTGATTCTGGAAAATCGACCACAACTGGTCACTTGATCTATAAGCT 
TGGTGGTATTGACAAGCGTGTCATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAA 
GAGGTCCTTCAAGTACGCATGGGTGTTGGACAAACTTAAGGCCGAGCGTGAGCGTGGTAT 
TACCATCGATATTGCTCTATGGAAGTTCGAGACCACCAAGTACTACTGCACAGTCATTGA 
TGCCCCAGGACATCGTGATTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGATTG 
TGCTGTTCTTATCATTGACTCCACCACTGGAGGTTTTGAGGCTGGTATCTCTAAGGATGG 
TCAGACCCGTGAGCACGCTCTTCTTGCTTTCACCCTTGGTGTCAAGCAGATGATTTGCTG 
TTGTAACAAGGTAATATAACTTTCGTATTCATCATTGTATCTGCTTTTGTGATTGATTGA 
TTCGTTTTATTTGTTGCTAACTTGCGTCTTTTTCTATTTTCGCCTAACAGATGGATGCCA 
CCACCCCCAAATACTCCAAGGCTAGGTACGATGAAATCATCAAGGAGGTGTCTTCATACC 
TGAAGAAGGTCGGATACAACCCTGACAAAATCCCATTTGTGCCAATCTCTGGATTCGAGG 
GAGACAACATGATTGAGAGGTCAACCAACCTTGACTGGTACAAGGGACCAACTCTTCTTG 
AGGCTCTTGACCAGATCAACGAGCCCAAGAGGCCATCAGACAAGCCCCTTCGTCTTCCAC 
TTCAGGATGTCTACAAGATTGGTGGTATTGGAACGGTGCCAGTGGGACGTGTTGAGACTG 
GTATGATCAAGCCTGGTATGGTTGTTACCTTTGCTCCCACAGGGTTGACCACTGAGGTTA 
AGTCTGTTGAGATGCACCACGAGTCTCTTCTTGAGGCACTTCCCGGTGACAATGTTGGAT 
TCAATGTCAAGAATGTTGCTGTCAAGGATCTTAAGAGAGGATACGTTGCCTCTAACTCCA 
AGGATGATCCAGCTAAGGGTGCCGCCAACTTCACCTCCCAGGTCATCATCATGAACCACC 
CTGGTCAGATTGGTAACGGTTACGCCCCAGTTCTCGATTGCCACACCTCTCACATTGCAG 
TCAAGTTCTCTGAGATCTTGACCAAGATTGACAGGCGTTCTGGTAAGGAGATTGAGAAGG 
AGCCCAAGTTTTTGAAGAATGGTGACGCTGGTATGGTTAAGATGACCCCAACCAAGCCCA 
TGGTTGTTGAGACTTTCTCCGAGTACCCACCTTTGGGACGTTTCGCTGTTAGGGACATGA 
GGCAGACCGTTGCTGTTGGTGTTATTAAGAGCGTGGACAAGAAGGACCCAACTGGAGCCA 
AGGTCACCAAGGCTGCAGTGAAGAAGGGTGCCAAATGATGAGACTTTCGTTATGATCGAC 
TCTCTTATGGTTTTCTTTGGTTCTTAAAACTTTGATGGCGTTTGAGCCTTTTTCTTTTTT 
CTCTTTATTTCTGTGACTTTCTCTCTCCCTCCTTTTTGGATATCTCTGAGACTTTTTATT 
ATGGTTTTCAATTATGCAGTTTCCGGATAATTTTGCTTGAAACTTATTTAGGAGTTGTGT 
TACAAAGTTGCTGTCTTTCTTTGTTCTTGTTTAAACAATCATTCAGAGATCAACCCAACC 
ATACTTAGCGTTTTAAGATCTATGTAAGAGATAGGGTTCTATAGTTTCGTTAGAATTAAC 
TTGTGCTTAGTGTTTTCTGACAA
>AT5G60390.3 |  elongation factor 1-alpha / EF-1-alpha 
GCGCTCTCATATTTCTCACATTTTCGTAGCCGCAAGACTCCTTTCAGATTCTTACTTGCA 
GGTTAGATATTTTCTCTCTTTAGTGTCTCCGATCTTCATCTTCTTATGATTATTGTAGCT 
GTTTAGGGTTTAGATTCTTAGTTTTAGCTCTATATTGACTGTGATTATCGCTTATTCTTT 
GCTGTTGTTATACTGCTTTTGATTCTCTAGCTTTAGATCCGTTTACTCGTCGATCAATAT 
TGTTCCTATTGAGTCTGATGTATAATCCTCTGATTAATTGATAGCGTTTAGTTTTGATAT 
CGTCTTCGCATGTTTTTTATCATGTCGATCTGTATCTGCTCTGGTTATAGTTGATTCTGA 
TGTATTTGGTTGGTGATGTTCCTTAGATTTGATATACCTGTTGTCTCGTGGTTTGATATG 
ATAGCTCAACTGGTGATATGTGGTTTTGTTTCAGTGGATCTGTGTTTGATTATATTGTTG 
ACGTTTTGGTTGTTGTATAGTTGATGGTTGATGTATTTTTGTTGATTCTGATGTTTCGAT 
TTTTGTTTTTGTTTTGACAGCTATGGGTAAAGAGAAGTTTCACATTAACATTGTGGTCAT 
TGGTCATGTTGATTCTGGAAAATCGACCACAACTGGTCACTTGATCTATAAGCTTGGTGG 
TATTGACAAGCGTGTCATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTC 
CTTCAAGTACGCATGGGTGTTGGACAAACTTAAGGCCGAGCGTGAGCGTGGTATTACCAT 
CGATATTGCTCTATGGAAGTTCGAGACCACCAAGTACTACTGCACAGTCATTGATGCCCC 
AGGACATCGTGATTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGATTGTGCTGT 
TCTTATCATTGACTCCACCACTGGAGGTTTTGAGGCTGGTATCTCTAAGGATGGTCAGAC 
CCGTGAGCACGCTCTTCTTGCTTTCACCCTTGGTGTCAAGCAGATGATTTGCTGTTGTAA 
CAAGGTAATATAACTTTCGTATTCATCATTGTATCTGCTTTTGTGATTGATTGATTCGTT 
TTATTTGTTGCTAACTTGCGTCTTTTTCTATTTTCGCCTAACAGATGGATGCCACCACCC 
CCAAATACTCCAAGGCTAGGTACGATGAAATCATCAAGGAGGTGTCTTCATACCTGAAGA 
AGGTCGGATACAACCCTGACAAAATCCCATTTGTGCCAATCTCTGGATTCGAGGGAGACA 
ACATGATTGAGAGGTCAACCAACCTTGACTGGTACAAGGGACCAACTCTTCTTGAGGCTC 
TTGACCAGATCAACGAGCCCAAGAGGCCATCAGACAAGCCCCTTCGTCTTCCACTTCAGG 
ATGTCTACAAGATTGGTGGTATTGGAACGGTGCCAGTGGGACGTGTTGAGACTGGTATGA 
TCAAGCCTGGTATGGTTGTTACCTTTGCTCCCACAGGGTTGACCACTGAGGTTAAGTCTG 
TTGAGATGCACCACGAGTCTCTTCTTGAGGCACTTCCCGGTGACAATGTTGGATTCAATG 
TCAAGAATGTTGCTGTCAAGGATCTTAAGAGAGGATACGTTGCCTCTAACTCCAAGGATG 
ATCCAGCTAAGGGTGCCGCCAACTTCACCTCCCAGGTCATCATCATGAACCACCCTGGTC 
AGATTGGTAACGGTTACGCCCCAGTTCTCGATTGCCACACCTCTCACATTGCAGTCAAGT 
TCTCTGAGATCTTGACCAAGATTGACAGGCGTTCTGGTAAGGAGATTGAGAAGGAGCCCA 
AGTTTTTGAAGAATGGTGACGCTGGTATGGTTAAGATGACCCCAACCAAGCCCATGGTTG 
TTGAGACTTTCTCCGAGTACCCACCTTTGGGACGTTTCGCTGTTAGGGACATGAGGCAGA 
CCGTTGCTGTTGGTGTTATTAAGAGCGTGGACAAGAAGGACCCAACTGGAGCCAAGGTCA 
CCAAGGCTGCAGTGAAGAAGGGTGCCAAATGATGAGACTTTCGTTATGATCGACTCTCTT 
ATGGTTTTCTTTGGTTCTTAAAACTTTGATGGCGTTTGAGCCTTTTTCTTTTTTCTCTTT 
ATTTCTGTGACTTTCTCTCTCCCTCCTTTTTGGATATCTCTGAGACTTTTTATTATGGTT 
TTCAATTATGCAGTTTCCGGATAATTTTGCTTG
>AT5G60390.3 |  elongation factor 1-alpha / EF-1-alpha 
GCGCTCTCATATTTCTCACATTTTCGTAGCCGCAAGACTCCTTTCAGATTCTTACTTGCA 
GGTTAGATATTTTCTCTCTTTAGTGTCTCCGATCTTCATCTTCTTATGATTATTGTAGCT 
GTTTAGGGTTTAGATTCTTAGTTTTAGCTCTATATTGACTGTGATTATCGCTTATTCTTT 
GCTGTTGTTATACTGCTTTTGATTCTCTAGCTTTAGATCCGTTTACTCGTCGATCAATAT 
TGTTCCTATTGAGTCTGATGTATAATCCTCTGATTAATTGATAGCGTTTAGTTTTGATAT 
CGTCTTCGCATGTTTTTTATCATGTCGATCTGTATCTGCTCTGGTTATAGTTGATTCTGA 
TGTATTTGGTTGGTGATGTTCCTTAGATTTGATATACCTGTTGTCTCGTGGTTTGATATG 
ATAGCTCAACTGGTGATATGTGGTTTTGTTTCAGTGGATCTGTGTTTGATTATATTGTTG 
ACGTTTTGGTTGTTGTATAGTTGATGGTTGATGTATTTTTGTTGATTCTGATGTTTCGAT 
TTTTGTTTTTGTTTTGACAGCTATGGGTAAAGAGAAGTTTCACATTAACATTGTGGTCAT 
TGGTCATGTTGATTCTGGAAAATCGACCACAACTGGTCACTTGATCTATAAGCTTGGTGG 
TATTGACAAGCGTGTCATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTC 
CTTCAAGTACGCATGGGTGTTGGACAAACTTAAGGCCGAGCGTGAGCGTGGTATTACCAT 
CGATATTGCTCTATGGAAGTTCGAGACCACCAAGTACTACTGCACAGTCATTGATGCCCC 
AGGACATCGTGATTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGATTGTGCTGT 
TCTTATCATTGACTCCACCACTGGAGGTTTTGAGGCTGGTATCTCTAAGGATGGTCAGAC 
CCGTGAGCACGCTCTTCTTGCTTTCACCCTTGGTGTCAAGCAGATGATTTGCTGTTGTAA 
CAAGGTAATATAACTTTCGTATTCATCATTGTATCTGCTTTTGTGATTGATTGATTCGTT 
TTATTTGTTGCTAACTTGCGTCTTTTTCTATTTTCGCCTAACAGATGGATGCCACCACCC 
CCAAATACTCCAAGGCTAGGTACGATGAAATCATCAAGGAGGTGTCTTCATACCTGAAGA 
AGGTCGGATACAACCCTGACAAAATCCCATTTGTGCCAATCTCTGGATTCGAGGGAGACA 
ACATGATTGAGAGGTCAACCAACCTTGACTGGTACAAGGGACCAACTCTTCTTGAGGCTC 
TTGACCAGATCAACGAGCCCAAGAGGCCATCAGACAAGCCCCTTCGTCTTCCACTTCAGG 
ATGTCTACAAGATTGGTGGTATTGGAACGGTGCCAGTGGGACGTGTTGAGACTGGTATGA 
TCAAGCCTGGTATGGTTGTTACCTTTGCTCCCACAGGGTTGACCACTGAGGTTAAGTCTG 
TTGAGATGCACCACGAGTCTCTTCTTGAGGCACTTCCCGGTGACAATGTTGGATTCAATG 
TCAAGAATGTTGCTGTCAAGGATCTTAAGAGAGGATACGTTGCCTCTAACTCCAAGGATG 
ATCCAGCTAAGGGTGCCGCCAACTTCACCTCCCAGGTCATCATCATGAACCACCCTGGTC 
AGATTGGTAACGGTTACGCCCCAGTTCTCGATTGCCACACCTCTCACATTGCAGTCAAGT 
TCTCTGAGATCTTGACCAAGATTGACAGGCGTTCTGGTAAGGAGATTGAGAAGGAGCCCA 
AGTTTTTGAAGAATGGTGACGCTGGTATGGTTAAGATGACCCCAACCAAGCCCATGGTTG 
TTGAGACTTTCTCCGAGTACCCACCTTTGGGACGTTTCGCTGTTAGGGACATGAGGCAGA 
CCGTTGCTGTTGGTGTTATTAAGAGCGTGGACAAGAAGGACCCAACTGGAGCCAAGGTCA 
CCAAGGCTGCAGTGAAGAAGGGTGCCAAATGATGAGACTTTCGTTATGATCGACTCTCTT 
ATGGTTTTCTTTGGTTCTTAAAACTTTGATGGCGTTTGAGCCTTTTTCTTTTTTCTCTTT 
ATTTCTGTGACTTTCTCTCTCCCTCCTTTTTGGATATCTCTGAGACTTTTTATTATGGTT 
TTCAATTATGCAGTTTCCGGATAATTTTGCTTG
>AT5G60390.3 |  elongation factor 1-alpha / EF-1-alpha 
GCGCTCTCATATTTCTCACATTTTCGTAGCCGCAAGACTCCTTTCAGATTCTTACTTGCA 
GGTTAGATATTTTCTCTCTTTAGTGTCTCCGATCTTCATCTTCTTATGATTATTGTAGCT 
GTTTAGGGTTTAGATTCTTAGTTTTAGCTCTATATTGACTGTGATTATCGCTTATTCTTT 
GCTGTTGTTATACTGCTTTTGATTCTCTAGCTTTAGATCCGTTTACTCGTCGATCAATAT 
TGTTCCTATTGAGTCTGATGTATAATCCTCTGATTAATTGATAGCGTTTAGTTTTGATAT 
CGTCTTCGCATGTTTTTTATCATGTCGATCTGTATCTGCTCTGGTTATAGTTGATTCTGA 
TGTATTTGGTTGGTGATGTTCCTTAGATTTGATATACCTGTTGTCTCGTGGTTTGATATG 
ATAGCTCAACTGGTGATATGTGGTTTTGTTTCAGTGGATCTGTGTTTGATTATATTGTTG 
ACGTTTTGGTTGTTGTATAGTTGATGGTTGATGTATTTTTGTTGATTCTGATGTTTCGAT 
TTTTGTTTTTGTTTTGACAGCTATGGGTAAAGAGAAGTTTCACATTAACATTGTGGTCAT 
TGGTCATGTTGATTCTGGAAAATCGACCACAACTGGTCACTTGATCTATAAGCTTGGTGG 
TATTGACAAGCGTGTCATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTC 
CTTCAAGTACGCATGGGTGTTGGACAAACTTAAGGCCGAGCGTGAGCGTGGTATTACCAT 
CGATATTGCTCTATGGAAGTTCGAGACCACCAAGTACTACTGCACAGTCATTGATGCCCC 
AGGACATCGTGATTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGATTGTGCTGT 
TCTTATCATTGACTCCACCACTGGAGGTTTTGAGGCTGGTATCTCTAAGGATGGTCAGAC 
CCGTGAGCACGCTCTTCTTGCTTTCACCCTTGGTGTCAAGCAGATGATTTGCTGTTGTAA 
CAAGGTAATATAACTTTCGTATTCATCATTGTATCTGCTTTTGTGATTGATTGATTCGTT 
TTATTTGTTGCTAACTTGCGTCTTTTTCTATTTTCGCCTAACAGATGGATGCCACCACCC 
CCAAATACTCCAAGGCTAGGTACGATGAAATCATCAAGGAGGTGTCTTCATACCTGAAGA 
AGGTCGGATACAACCCTGACAAAATCCCATTTGTGCCAATCTCTGGATTCGAGGGAGACA 
ACATGATTGAGAGGTCAACCAACCTTGACTGGTACAAGGGACCAACTCTTCTTGAGGCTC 
TTGACCAGATCAACGAGCCCAAGAGGCCATCAGACAAGCCCCTTCGTCTTCCACTTCAGG 
ATGTCTACAAGATTGGTGGTATTGGAACGGTGCCAGTGGGACGTGTTGAGACTGGTATGA 
TCAAGCCTGGTATGGTTGTTACCTTTGCTCCCACAGGGTTGACCACTGAGGTTAAGTCTG 
TTGAGATGCACCACGAGTCTCTTCTTGAGGCACTTCCCGGTGACAATGTTGGATTCAATG 
TCAAGAATGTTGCTGTCAAGGATCTTAAGAGAGGATACGTTGCCTCTAACTCCAAGGATG 
ATCCAGCTAAGGGTGCCGCCAACTTCACCTCCCAGGTCATCATCATGAACCACCCTGGTC 
AGATTGGTAACGGTTACGCCCCAGTTCTCGATTGCCACACCTCTCACATTGCAGTCAAGT 
TCTCTGAGATCTTGACCAAGATTGACAGGCGTTCTGGTAAGGAGATTGAGAAGGAGCCCA 
AGTTTTTGAAGAATGGTGACGCTGGTATGGTTAAGATGACCCCAACCAAGCCCATGGTTG 
TTGAGACTTTCTCCGAGTACCCACCTTTGGGACGTTTCGCTGTTAGGGACATGAGGCAGA 
CCGTTGCTGTTGGTGTTATTAAGAGCGTGGACAAGAAGGACCCAACTGGAGCCAAGGTCA 
CCAAGGCTGCAGTGAAGAAGGGTGCCAAATGATGAGACTTTCGTTATGATCGACTCTCTT 
ATGGTTTTCTTTGGTTCTTAAAACTTTGATGGCGTTTGAGCCTTTTTCTTTTTTCTCTTT 
ATTTCTGTGACTTTCTCTCTCCCTCCTTTTTGGATATCTCTGAGACTTTTTATTATGGTT 
TTCAATTATGCAGTTTCCGGATAATTTTGCTTG
>AT3G11964.1 |  RNA binding 
ATGGTTGTACCGCAGAAGAAATTTGCTAATGGAAAACGTAATGATTCTACAAAGTCCTTT 
AAACCAATGAAGAAACCGTTTAAGAAGACCAAGGACGATGTAGCTGCTAGGTCTGAAGCC 
ATGGCTCTTCAGCTCGAAGATGTTCCCGACTTTCCTCGAGGTTTGATTTTCCCCCTCATA 
ATTTCTATTGTTATACAATAAACTATTCAATTCTGCTTCCTTTTGTTATTACTCGGTGTC 
ACGAATCCCAAACATTTGATTAGGTAGCTAAAAATGAAGTTGCTAGCTTCATTTTCTCTC 
CTTCAGTTACTTATCGTTAATATGATTTAATTGATTTTCAGGTGGAGGTACTTCTCTGAG 
TAAAAAAGAGCGTGAGAAACTTTATGAAGAAGTCGATGCTGAGTTTGACGCTGATGAGCG 
TGTTTCTAAGAAGAGTAAAGGGGGTAAGTCTAAAAAGAGAATCCCTAGCGATTTAGACGA 
CTTGGGTTTGCTTTTTGGCGGCGGCCTTCATGGAAAACGGCCAAGATATGCCAATAAGAT 
TACCACTAAGGTATATTACTCGCAACCGTCTTAGTCAGAATTGGTTAAGAGACTTATCCT 
TGTAACATTTTACATTCCACATCGTTCACTTTTGTTACTTTCATTGGGTTTTAGTGATTT 
AAATCAGATTCATTTCTTTTCTTCATCCTGGAACAAATTATTTGTGTACATTCTACTAAA 
CTTCAGAATTTATAGCTTGATCAACGTTATTGGAAAACAACCTTAACCTAGATTGATCAA 
GGTCCATAGATTACATTGACTAGATTTCTGAATGAATGTCCTCTGACGCTTTATCTACAT 
AGATAGTTCTTACATCAGTTGCTGATGCCTGCTTTACAATTTTTAAACACTTGTGCATTC 
TTCAGATGATGCCATAACCTATGCCATTTTAGCTTTCTATTGACATCCATCTATACTCAT 
AACCATGGTTGCGTGGTTTTACTGTCCTAGAAGATTTCTTAATCATATTATACCTGTACT 
TTTCATGTGCTGACTTTTATGTGAATAAATGTTCAGAATATTTCCCCAGGAATGAAACTT 
TTGGGAGTTGTTACTGAAGTAAACCAGAAGGATATTGTAATTAGTCTTCCAGGGGGCTTA 
CGCGGATTAGTTCGTGCAAGCGAGGTATCAGATTTTACAGATCGTGGGATTGAGGTAACT 
GCTGTAGGCTATAATTGGCTGTTTAAGCTCCCTGTACGATGGTCATCTTGGCCCTTTTCC 
ATTATTGTTTCTGCAATCTGATTAGAGTTGGTCCTCTCTTTGTAAACCAGGACGATGAAA 
ATGAACTCCTTGGAGACATTTTTTCTGTGGGTCAGCTTGTTCCCTGCATTGTATTGGAGT 
TAGATGATGATAAGAAGGAGGCGGGCAAAAGGAAAATATGGCTTTCATTGCGACTTTCTT 
TGTTGCACAAGGGATTCAGTTTTGATTCCTTTCAACTAGGGATGGTATGTCAAAGTTTGG 
TTCACTTTCCTTTAATTTTGTAATTATGTACTACTTGGGAGCTCTGCCTTAGTTAATATT 
TTCATATGTATTTCTGCGTACGGGTATGCAAGTTTATTTGCATACCTAAGCGATTTAAAA 
ATCCTAAACGAGTAGGGAGATTTCATGGCTGACTGAGCTTAGGCTTTATTTTTTGCATAT 
GCTAGCAGTTTTTAATGAAATTAAGCTATATATTTGCTATTCTGAACTGGGGTCATACTT 
TGCAACTCAGTTTTTTATTGCTGATAGTTGTTAACCTTGTAGCTCTTCTATATAGGTTAT 
GATGTGTTGTTTGAAAATAATTATCTTATATTTCATTCCATATGCTTGTTCAGGTGTTCT 
CTGCAAACGTGAAAAGCATCGAAGACCATGGTTCTATCCTTCATTTTGGATTACCTTCTA 
TCACAGGATTTATCGAAATAAGCGACGATGGTAAGTAACCTGGTTGACCTACTACTGGCC 
TCTTAGCTCTTTGTCTCACTTTGAACTTTTAAATATGATTTCATCAGGGGAATGATATTC 
AGTTTACCTCTTAATGTACATCATGATAAAAATGGGCTGTATATGTCCAACTTAGGGAAA 
TACTTTAGAGGATCCTAATGCAAGTTTCTTGGCTTTCTGCTTCTGCTTCTGACCATCTTT 
GAAAAATTTCATCTTCCTTTTTCTGAAATTTCTAGGAAACCAGGAGTCAGGAATGAAGAC 
TGGGCAGCTTATTCAGGGTGTGGTTACAAAGATCGATAGAGACCGTAAAATTGTTCATCT 
TAGTTCTGACCCAGATTCAGTGGCAAAGTGTCTGGTATGTCCTGAACCTTGAACATTCTG 
TTGCAAATTACCGAGTGAAGGTTCCTTAATTTACACAAACTTAACCACATGAATACCATT 
TTGCAGACCAAGGATCTTAGTGGCATGTCGTTTGATCTTCTCATCCCAGGAATGATGGTT 
AATGCTCGCGTGCAATCAGTCCTCGAGAATGGGATACTGTTTGATTTTCTTACGTACTTT 
AATGGAACGGTGAGTTACTAATGATTTTGATCTTGTATATTATTGCTTGAACTGGAATGG 
TCTCGTTCATGTTCAACCCTAAATCTTGTTGATACTTTTGAGTTACGTTTCTCATTGATG 
TGCAGGTTGATCTCTTCCACCTAAAAAATCCATTATCTAACAAAAGCTGGAAAGATGAGT 
ATAATCAGAATAAGACGGTATGCATTTTGGTGTCACGCTTTTCTGATTCTTCTATTTGCT 
GTGTTTCTATTATATATGTCATGATTGTCATCATAGTTTGCAGATCTTCTAGTCCCACAT 
CCATGTTTGTTTATGCCTTGGCGTTTTCTTGTTATCTCTGTAGTTAGAATTTCCATGCTT 
ATTTGCAAGGAGTATAGTTAAGGGGTGTTCAATTTTGGTAAATCAAATCAAACAAAAACA 
GAATAGAAATCATCCAAAACTGATTGGTTTCACTTCTTCTATATCTAAAAAACCATAACT 
AAGGGTACTATGGCTAAAAAACCAACTTTGAACCGTATCGTAAATCTAATCAAACCAATC 
TGAATAAGATTCAAATTCTATATTTCCTAAGTTGAATTGCTTGTCCAGAGCAGTTGTTAC 
AAAAAACCTAATAGGTACAATGTTACTTCAAACTTACATCTCCTTCCTAATGAGTGTTGG 
TTATGCATACATTTCCTTCTATTTGGATGTTTAACACAACTTGTTTTCTTTGATTACCAT 
AGGTTTGGTAAAAGGCTGAAATAGTCCTTGTTCTGCAATAAATTCTTTCTCTCTACTGCT 
GAAAGTTTGTTTTATATGCTTTGTAATTTTTTTTTAACTTGTATAAAATGCTCCTGTTTT 
TCAGGTTAATGCTAGAATATTGTTTATCGATCCATCATCTCGAGCTGTTGGTTTGACATT 
GAGCCCTCATGTTGTTTGTAACAAGGCTCCTCCATTGGTAAGTTACTAATTCCATGCGCT 
TCCACTGATATATAATGACTAAAGGAATTTGATTTGACAGCTACTTTATGGTTTAATGAC 
TGGTCAGTGATTGTAACATCAGAATTTCTTACATCCACGATTTTTACCACTGCCTAGCAT 
ACTTAAGCCTTTGATACCTGAGACAGCATGGATCTATGGGTTTAGTGGTCGTGTCTACCT 
GTCTTTGCTCTTTTCTAAAAATATTTTTGTAAAATTTGTATTGGCTCTTTACAGCATGTC 
TTTAGCGGAGACATATTCGACGAAGCAAAAGTAGTTCGTATTGATAAATCAGGCCTTCTT 
CTGGAACTTCCCTCTAAGCCCACACCAACTCCAGCATACGTTAGCGTAATGTCCAATTAC 
CTATCCTTATTTTTGAAAAGATTGAGCTTTTTGATGTCCTTTGTTAACTTGAGGTTTAAC 
GTTGCTGCAGACATATGATGCCGCCGGAGATGAAGTAACGAAACTGGAAAAGAAGTTTAA 
GGAAGGAAATCACATCCGTGTTCGAGTACTCGGCCTTAAGCAGATGGAGGGGTTGGCCGT 
AGGGACTTTAAAGGTATCCTACTGCCAGATATGCTAAAAGATTGTTCTTTTAGTTTCGAT 
TATTCATTTCAACCTCTGTATTGCAATCTAAAAGCAAATAGGCAGTAGTTTGGTGCGGAA 
TCATACGTTTATACCCTCTATTGGGACATGTATGTTTTTTTGCTCCTGTTTTACATTGGT 
TTGTTTCTTTCTTTTCATGTTGTTTTTATATTGAGCAGGAAAGCGCCTTTGAAGGTCCAG 
TTTTCACCCACTCTGATGTCAAGCCTGGTATGGTGACAAAGGCAAAAGTCATATCTGTTG 
ATACATTTGGTGCCATTGTCCAATTTTCGGGTGGTCTCAAAGCAATGTGCCCACTTCGGC 
ATATGTCTGAGTTTGAAGTTACGAAGCCTAGGAAAAAGTTCAAGGTTGGTTACATTGATC 
GTACATGATTAATTTGCAACATTGTTGCGGCATGCCTAAGTTTTGAATGATGTTCTATTT 
CAGGTTGGAGCTGAATTAGTATTCCGTGTGCTTGGCTGCAAATCAAAGAGAATAACTGTT 
ACCTACAAAAAAACACTTGTAAGTTTTCTTATGATAGTGAATCTGATTTTGTTAAATTGT 
TTACATATTCCTTGATATGTCTAGTTTTGTTGGTTTATGGAGGCTTATAATTGTTCAAAT 
CATTTCCCTCTTATAATCTATGTAATAAAATGCATCTCGTTTTTATTATCGTTCCTTCTT 
TTATTTTCTTCTGCTGATTCAAGGTTTTACTTTTTACACTTGTGTCCATTTCTTTCTGGT 
TAAAAATGGAAAATAAGTTTCTTCTTTATTAAACCATTTCACTTAACTATGGACGAAAAA 
TATTTGGAGGGACTTTTGTCTCAATTTGTATCTCTTTTGGAGGTTAGGACTTAGGAGTGG 
AGAAGCTCTATTGCTATTTACTTTCAGTCATCTATTGCTACCGTTTCAATTCTGTTCTCA 
TGCAGTAAATATGAAATGTTTATTCTTTTTCAGGTGAAGTCTAAACTTCCAATTTTGAGT 
TCTTACACTGATGCAACTGAAGGGCTAGTGACGCATGGCTGGATAACAAAGATCGAAAAG 
CATGGATGCTTTGTTCGCTTCTATAATGGAGTGCAAGGATTTGTTCCCAGGTCATTGCTG 
CACCCTTTTGTTGTATTTGAACTGCCGTTTTCTTTCAGTTCTGGTTTCCTTATACTGATA 
TTCTACACAGATGTTTTTCCCCCTCATAAAGGCTTTGGTTAAGTTTTTCTGTTTTGATGG 
TCGTAAATTAATAATGCTATACTGACTTTGATTAAACAGATTTGAACTTGGTTTAGAGCC 
TGGAAGTGATCCAGATTCAGTGTTTCATGTTGGGGAGGTTGTCAAATGTAGAGTAACTAG 
TGCAGTTCATGGTACCCAAAGGATCACCCTTAGTTTCATGATAAAGCCATCAAGGTTTTC 
CCTATTTTAATCTGATATTCATCTCGCATAAAGGCTGTCTTGATATCCTTAAATTCTGTA 
GCTCAAATTTGTGTAAATCATTTGTGACAGTGTTTCTGAAGACGATTCGATCAAGTTAGG 
TAGCATTGTATCAGGGATAATTGATACTATAACTAGTCAGGCAGTCATTGTCCGTGTTAA 
ATCCAAAAGTGTTGTCAAGGGTACAATTTCTGCTGAACATTTAGCTGATCATCATGGTAT 
GTGTTTTGACCCACACAAGCGTTCATTTTGGTTTTGCTTTTATTCATCTGTTTCTGAGTT 
ACTTTTTGTGATGTAGAGCAAGCAAAATTAATAATGTCACTTTTAAGACCTGGATATGAG 
CTTGATAAGCTGCTGGTACTAGGTATGTTATTTACTAGCTACTTTTCAGAACTTTGTTTT 
CTTTATGTACATATCCTTAACGCATTTAAAGGAGACTGTCTAAACGTTCACAGTTCTAGA 
ATTTTATTTACCTCTCAGTGGTTGCTGATGGATTGTAGAGAGAGAAACATTTTTATGAGA 
GTAGTTCTTTCTCCAAGTGATTATTTAGTTCGGCTTCATATCTCTGGTTATGTAGTATCA 
AAAACTAATCAAAACATCTAGTTCAAGGAAGGCGGAGTAATAAGTTAACTATTTTAGTGG 
TTGATGATACCTTATAGTTACATGTGGAGTAATAATTTTAGTTTATCTTAGACATTGAAG 
GCAACAATATGGCTCTCTCTTCAAAATATTCTCTCATTAAGTTAGCTGAAGAGCTTCCTT 
CGGATTTTAATCAGCTCCAGCCAAACTCAGTGGTTCATGTGAGTAGTTGCGCCTTTTAAA 
TTTAGTAACTTCTTAGTGGATGAATTCGTTCATAAACTCACATTTACTTTTGATGAATTC 
GTATACAGGGTTATGTTTGTAACTTGATTGAAAATGGCTGTTTTGTCCGTTTTCTTGGTC 
GGTTGACTGGTTTCGCCCCAAGAAGCAAGGTGGATTGTTTTTTACTATGAATTTTCTTTG 
TCAAATGTTTGTTTGTATATTTTGTTTCTTGAAGTTTGTTTCTTTTTCTTTTCAAGGCAA 
TTGACGACCCCAAGGCAGATGTGTCAGAATCCTTCTTTGTTGGACAATCAGTTCGGGCTA 
ATATAGTTGATGTATGTGAACACTGGACTAAAGGCCTTAGATTAAGTTTGTTGAAGATGT 
TATAAGGTCTTGATCAGTTGTAATATTTTTCAGGTCAATCAAGAAAAAAGTAGGATAACT 
CTTTCATTGAAACAGTCATCTTGCGCATCTGTAGATGCTTCTTTTGTCCAAGAGTACTTC 
CTCATGGATGAGAAGGTGGTGTTCTTGAGACATATCTTTTTCTTTTTATTGGGCTAAAGA 
ACTCAATGTAATCTGTTATGTACTGCATTTTTATTGAGCTTGTGTCAGGATATTTCGAAT 
GGGTCTGCATAACACTGGCTAGCACTGTACTTCATGTGATTTTTAAGAAGGATTGATTTC 
TAACAGTTACTGTTTATTTGTCCAGATATCGGACCTGCAATCATCTGATATTACTAAAAG 
TGACTGTAGCTGGGTTGAGAAATTCTCAATTGGGAGTTTGATCAAGGGAACCATACAGGA 
ACAAAATGATCTTGGTGTGGTGGTGAATTTTGACAATATTAATAACGTCCTTGGTTTTAT 
ACCTCAGCATCATAGTAAGTCATTTTGGAGAATCTGTTTCTCGGTACAGTTTCGTATGGA 
TTGCATCTGATTTAGACATCTCTACATAGTCTTTGTCTGATACATTATGTTTTCTTCTTG 
TAGTGGGTGGAGCTACTTTGGTACCCGGTTCTGTTGTCAATGCAGTTGTTCTTGATATAT 
CTAGGGCAGAGAGACTAGTTGATTTGTCTTTGAGGCCTGAGCTCTTGAACAACTTAACCA 
AAGAGGTGTCCAACAGTTCAAAAAAGGTTTCACTCTAAGAAGATATATTCTCGCAAAGTT 
TTGTTTTATTCAAGTTTTCTCCCATGCTCATCGTGGTTCGCATAAGTCTAAATTGGGCTA 
CGGCTTATATCATGTTGTGTTTTATCTTGCTCCAGAAACGTAAAAGAGGAATCTCCAAGG 
AACTTGAAGTCCACCAGAGGGTCAGTGCTGTTGTAGAGATTGTGAAGGAGCAACACTTGG 
TAAGTATATAATTGCATTAAGTTGATAATTAGTGCATGTTACATTGTTACTCAGAGCTGC 
CCTTTTTTCCAGGTTTTGTCGATTCCAGAGCATGGTTACACTATAGGATATGCATCAGTA 
TCAGACTATAACACTCAGAAGTTGCCAGTGAAACAATTTTCCACTGGACAAAGGTGAGCT 
TGCTAGTCGTCCATTTTTGGCCAATCTTTTACTTATTTAATTTGCTTCCCTTTGTCATGG 
TTCCTAATTTCCCATATACTCTTTGCCCTGCCCAACTAAACTAATAAAATTTGAATTTGT 
ATATACATCCACTGGCAGCTCATTGTACCTTTTATTGGCAATAGACATAGCTGTCCTTAC 
TGTTGTAGTTACTTGATGGGAGCTAAGTATTTTTTGATTATTTTCTATGGGCAGTGTTGT 
TGCTTCTGTTAAGGCTGTGCAAAACCCTTTAACGTCTGGGAGGTTGCTTTTACTTCTTGA 
CTCTGTTTCCGGCACTTCTGAGACTTCCCGTTCTAAGAGGGCAAAGAAGAAATCCAGCTG 
TGAAGTTGGTTCTGTTGTCCACGCCGAGGTTACTATCGCCCTTCCTTCTTAAGTCTTTTT 
TTTTTTTTTAGTTGTGTCTATGCCACCATAACTTCTGCTGCCTCATACTAACAGCTTATA 
CTTATCAGATTACTGAAATAAAGCCTTTTGAACTTAGAGTAAACTTTGGCAACAGTTTCC 
GAGGGAGAATCCACATAACTGAGGTTCTTGTGTTGCTTACCATCATCATTTTAGATTGTA 
ATACTCGTTCTTCAATACTTGGTGAACGAAGATTTTCTTATATATCTCAACTATGGATTG 
AATAGGTAAATGATGCGAGTACAAGTGATGAACCTTTTGCCAAATTCAGAGTTGGGCAAT 
CAATTTCTGCAAGGGTTGTTGCAAAGCCGTGTCATACTGATATTAAAAAGACTCAACTTT 
GGGAGCTTTCTGTAAAGCCTGCAATGCTTAAAGGTAATCCAAGAGAATTGAAAAATTCTA 
CCAATCATATAGACCATTGACTCCCATTAGAATATACATTGCAGAACAGTCACATACCCT 
TAGGGTTTAAAACGGTTTTAGTCAGTCTATTCTAGCAACTTGTGGGATGGTGATATATGA 
ATGGTGTAATAATTTTATTCTACGTGAATTATCTTATTTAGGATTTCCTCTAGCTATTAT 
GTTTTTCAAAAAAAAAAAAAATCATTAACCAATGTATGCCACATGTATGCTTGTATATAT 
ATCTTACATAAGAAATATTTGCTCACACAAGATCATGATATAGTCTCCGTGTCTTTCTTT 
CTTGTTGTTGCAATTTAATTAGATTCCAGTGAGTTTAATGACACACAAGAGAGTGAACAA 
CTTGAGTTTGCTGCTGGACAATGTGTCATTGGATATGTCTACAAAGTGGATAAGGAATGG 
GTTTGGTTAGCAGTATCTCGCAACGTGACAGCACGCATATTCATATTAGACACATCATGC 
AAAGCTCATGAACTTGAAGAGTTTGAAAGGCGTTTTCCCATCGGTAAAGCTGTTTCAGGC 
TATGTTTTGACGTACAATAAAGAGAAAAAAACATTACGGTTGGTTCAGCGTCCACTACTG 
TTTATCCACAAAAGCATTGCCAATGGTGGAGGCAGCAAAACGGATAAACCAGACAGTAGC 
ATTCCTGGTGATGATGATACTCTATTTATTCATGAAGGAGACATTCTGGGTGGAAGAATT 
TCTAAGATACTTCCTGGTGTTGGTGGACTTCGTGTGCAATTAGGTCCTTATGTATTCGGG 
AGAGTTCATTTTACTGAAATCAATGATTCATGGGTCCCTGATCCATTAGATGGTTTTCGT 
GAAGGCCAGTTTGTCAAATGTAAGGTCTTAGAAATCAGCAGTTCTAGTAAAGGGACTTGG 
CAAATTGAACTGTCATTACGGACCTCACTAGATGGCATGAGTTCTGCTGACCATCTCTCA 
GAAGATTTGAAGAATAAGTAAGTTTTTATTTTGCCTATACTCTTCATTACTGTCTGTGTT 
GCTTTTAATATGGATTAAATCTGTTTGCGTTAAATCAATGCTGGTAAACAGCTCATCACC 
ACTAGACGATAACTATTATTGGGATTTTCTTATGCATTAACTCTATTTGAACTTGAAATT 
CGTATGTTTGTGAAATATTTTCCCAAAATGTTTCTAATTTACTTATTCACCTGATGATTG 
TTTTCACTTTTCAGTGATAATGTTTGTAAGCGTTTTGAGAGGATTGAAGATCTTTCGCCT 
GATATGGGCGTCCAGGTATTTTTGGCCTAATAACCATGACTTTGCAACCTACTTTCCTTA 
TGGTAAAACTTATGTTAATTTCAAACTTTTACAGGGTTATGTCAAAAATACGATGTCGAA 
AGGTTGTTTTATTATACTTTCAAGGACAGTGGAGGCAAAAGTTCGACTGTCAAATTTATG 
TGATACGTTTGTTAAGGAACCCGAAAAGGAATTTCCAGTAGGAAAACTTGTGACTGGCAG 
GTAATGCAAGCTTCCTGTCAAATAGATATTTTATAATATACTTTATTTTCTGCTCTAACC 
AATATACATTGTAGGGTTTTAAATGTGGAGCCTTTATCCAAGCGGATAGAAGTCACTTTG 
AAGACAGTAAATGCTGGTGGGCGGCCAAAATCTGAATCTTATGACTTGAAGAAACTCCAT 
GTTGGAGATATGATTTCTGGGAGAATCAGACGTGTGGAGCCCTTTGGCTTATTCATTGAC 
ATTGATCAAACTGGCATGGTAATGATCTACTTTTGTGAATTCCTTAAAATCTGTTAAATC 
CAAACTGTATGCTACTTTGCCAAATTATCCTAATAGAGTAACTAGACTGGCAATAATTTA 
CTTCATTACTATCTACCTTTCTTTTTGTGGTAGGTTGGATTATGTCACATATCACAGCTT 
TCTGATGATCGTATGGAGAATGTACAAGCCAGATATAAGGCTGGGGAGAGCGTCCGCGCA 
AAGATTTTGAAGGTAGGTGGTCTTTTGTCAGGAATAATAAAGTTCTGTGTAGTATTTTTC 
TTGACTACCACTGTTCCTATTAGCCTTATGCTAAGAGCCCAGTAACTAGTATCTGGAAAA 
TTAACTTGAACATAGCTTTTCTATGATCTATGTTACTCTGGAATGTTAATGCTGTTCTTT 
TTCATTTTGGTGTTTGCTCTAGCTGGACGAGGAAAAGAAGCGTATATCACTCGGAATGAA 
GAGTTCCTATCTTATGAATGGTGATGATGACAAGGCACAACCACTTTCCGAAGACAACAC 
AAGCATGGAATGTGATCCAATCAATGATCCGAAGTCGGAAGTTCTTGCAGCAGTCGATGA 
TTTTGGGTTCCAGGAAACAAGCGGTGGAACTTCTCTGGTTCTTGCCCAAGTAGAATCAAG 
GGCTTCTATCCCTCCGCTTGAGGTTGACCTTGATGACATTGAGGAGACGGACTTTGACAG 
CAGCCAGAATCAGGAGAAACTACTGGGAGCCAATAAAGATGAAAAGAGCAAGAGAAGGGA 
AAAGCAAAAAGACAAAGAGGAAAGGTTGGTTATTTCTTTAGAAACAAAGATGCTTTATAT 
TTGGTTTCAACTCATACTGAAAAATTATACTTGTGTAGAGAGAAGAAAATACAAGCTGCT 
GAAGGAAGATTGCTGGAGCATCATGCACCTGAGAATGCTGATGAATTTGAGAAATTGGTT 
AGAAGCTCTCCAAACAGCAGCTTTGTCTGGATAAAATATATGGCGTTCATGCTCAGCTTG 
GCTGATATTGAGAAAGCCAGGTCTATTGCTGAGAGGTACTTGTTCCTAACCCCTCTGTAT 
CATTCAAAGGGATACATACTGATACAGGTTGAGAGCGGAAACAGTTTTTGGGACCTATAA 
ATATTATATAATTAGATAACCGTCTGGATCTAATATCTGCTTGATAAAGCATTGAAGTTT 
TATGTGATAGTCGCTATATTCGGTTTGTTTATCCTGTCTAAAACTATCTCTACTGAAGGG 
CCTTGAGGACTATAAATATTCGTGAGGAAGAAGAGAAGCTAAACATATGGGTTGCTTACT 
TCAATTTGGAAAATGAACATGGAAATCCACCAGAGGTAGATAGAAGACTCCAACGAAAGC 
TTTTTAGATATTACCAATAATAGGCTTATATATTGCAATTTTACTCGTGTTTGATTTCTC 
ATCTCCAGGAATCTGTTAAGAAAGTGTTTGAAAGGGCCCGTCAATACTGTGACCCAAAGA 
AAGTTTACCTCGCACTCTTGGGCGTGTACGAGAGAACAGAGCAATATAAATTGGCTGATA 
AGCTGCTTGATGAGATGATTAAAAAGTTCAAGCAATCTTGCAAGGTACATGCTGTTTGAT 
CTTTATCTTCTCAAAGCAGAGAAATTTGGCTCGTCACTCACTCTGTTAACAACTTTATCT 
GATGTATCCTTTTTAGATTTGGTTAAGGAAAATACAAAGTTCTCTGAAACAAAACGAGGA 
AGCCATACAATCCGTTGTGAATCGTGCCTTGCTATGTCTTCCCCGCCATAAGCACATAAA 
GTTCATATCACAGACTGCCATCCTTGAGTTCAAATGTGGAGTTGCGGATAGAGGGAGATC 
ACTGTTTGAAGGTGTTCTTAGGGAATACCCAAAAAGAACAGACTTGTGGAGCGTTTATCT 
TGACCAAGTTCGTTATATTCTGCTTCTCCAAAATTTATATTTCATTGTCATCTTTTTTAA 
TTTATAACTTGATGTTTATCTTGTACAGGAGATCCGGCTTGGAGAAGATGATGTAATTAG 
ATCTTTATTCGAGAGAGCCATTAGCTTGAGCTTGCCCCCCAAGAAGATGAAGGTGCCAAA 
TAGTCCTGGTCTCTAAATCTGCTTTATTAAGTGTATTTGATTACTACGGATTTTTAACCA 
TTTTGTTCTCTTGTGTTCTCAGTTTTTGTTCAAGAAGTTCTTGGAATATGAGAAATCTGT 
TGGTGACGAGGAGAGAGTCGAATACGTGAAACAGAGGGCGATGGAGTATGCAAACAGTAC 
CTTGGCCTGA
>AT4G16830.1 |  nuclear RNA-binding protein (RGGA) 
GCCTATTCCAAATTTCCACACATTTTATTTTCATTTCTTAATATTTATTTCCTTATCATT 
TCTTTCTCTCACCAACCAACAAGTTCTCCTTTCTACCCATTTCGTCTCCTTCATTTTGAC 
GTTTTCTTTAGATCTGTTAATAATCCCATCCATGGCTTGGTCTAGTCACTAGTGGTGTTA 
TCTCTCTGTGTGGAATAAAAAGCAAGGTTTTTTAATCACTTGGATTGTTTTAAGATATGG 
CAACTTTGAACCCTTTTGATTTGTTGGATGATGATGCTGAGGATCCAAGCCAGCTCGCTG 
TTGCCATCGAGAAGATTGATAAGTCCAAGAAATCTGGACAGGTTTCGAGCTTGCCTGCTA 
AGTCAGCTCCTAAGCTTCCATCGAAGCCACTTCCTCCTGCTCAAGCCGGTGAGGTTTCTT 
CTCATAAATCAATATTTAATCAGAAAAATTCGATCTTTATTACTGGAGTAAGCTGTCTGT 
GTTATTGTTTGGATTCTCTTGATTATTCATGGAGTTGTGTTTTGTCGGTTGAATGATTGA 
GATTAGTGTATGATTAGTTTTGATGCTGTTGACTAGTGAGAGAGGCAAGGAGTGATGCTC 
CACGTGGTGGTGGAGGCCGTGGAGGATTTAACCGTGGTCGTGGTGGTTACAACCGTGATG 
ATGGTAACAATGGATATTCAGGGGGATACACTAAACCCTCAGGTGAAGGAGATGTTTCAA 
AGTCTTCTTACGAGAGGCGTGGCGGTGGTGGTGCTCCTCGTGGTTCCTTCCGTGGTGAAG 
GTGGTGGACCTGGTGGTGGTCGTCGTGGTGGATTCAGCAATGAGGGTGGTGATGGGGAAC 
GTCCTCGAAGGGCCTTTGAGCGTCGTAGTGGAACTGGCAGAGGGTCAGTCTTATTCTGTT 
GTTGCATAATCTGCCATTGAAATGACTGTGTCAATCTCATAAGTTGGAGTTTATCTTTTG 
GATAGGAGTGACTTCAAGCGTGACGGATCTGGTCGTGGGAATTGGGGAACTCCAGGGGAA 
GAGATAGCTGCGTATGTAATTGTTTATGGTTTATTGCATTTGTTTAAAAAAGTATGTATT 
AATGTGATTGTGATTGGGAATTTGGACTAAAAGAAGTTTTCTCTGGATTTTAAGTGAGAC 
TGAAGCAGTAGCTGGTGTTGAGACTGAGAAGGATGTTGGAGAGAAGCCAGCTGTTGATGA 
TGTAGCTGCTGATGCTAACAAGGAGGATACTGTTGTTGAGGAGAAAGAGCCTGAGGATAA 
GGTAAACAGAGAATAGAATAGAAATGCTAGGCTCCTCTTTACTATACTGGTATCAGTTTT 
TTTTATTTTCACTTATTGTTTATTGACTTGTGTTTCTACAGGAAATGACTCTTGATGAGT 
ATGAGAAAATACTCGAGGAGAAGAAAAAGGCACTTCAATCATTAACTACCTCTGAGAGGA 
AAGTTGATACGAAAGTGTTTGAATCAATGCAACAACTGTCAAACAAGAAGTCTAATGATG 
AAATCTTCATCAAGCTGGTAAGACATATCATGTATCATTTCTTCATTGTCGTCTATTAAC 
TTGCGTCAATGATTCTAAACCTTTCCTTTGACCTATTTCCCAGGGTTCTGATAAGGACAA 
ACGCAAAGATGACAAAGAAGAGAAGGCTAAGAAGGTTTAAATCATTGTCTGAATTGAAAC 
ATATTGTAGAAATCAATAAGTTTGCTTATTGATGTGTGTTCCTGATTGTAAACAGGCTGT 
GAGCATCAATGAGTTTCTGAAGCCAGCAGAGGGTGGGAACTACTACCGAGGAGGTCGTGG 
TGGCCGTGGACGTGGTGGTCGTGGCCGTGGAGGTGTTTCTAGTGGCGAATCTGGTGGTTA 
CCGTAATGAAGCTGCACCGGCAATTGGAGATGCTGCTCAGTTCCCATCTCTTGGGGGCAA 
GTAAGATCCATCCATGATAACGTCCACACTCGTGCATCCTCCTTTAGGATTTTGTGCGAG 
GATTTACTGTTTACTGGTCTCTCGTTGTCAGATGTAAATAATTAGGTGTCGTCGTCAGTT 
TTTAGATTTTATGCAAAACTTTACACTTGTTGGTGTTCTTTACTTTTGAAACAGTACACT 
CTTCTTAATTTTACCATTTTACTCGTTTTGTGTTTGTTGTTTTCTTATTTATGAAACATG 
TTTTGAGACGGACATATCTAATGTTATCGGGTTTGAGTCTTTACTCTGTC
>AT4G16830.1 |  nuclear RNA-binding protein (RGGA) 
GCCTATTCCAAATTTCCACACATTTTATTTTCATTTCTTAATATTTATTTCCTTATCATT 
TCTTTCTCTCACCAACCAACAAGTTCTCCTTTCTACCCATTTCGTCTCCTTCATTTTGAC 
GTTTTCTTTAGATCTGTTAATAATCCCATCCATGGCTTGGTCTAGTCACTAGTGGTGTTA 
TCTCTCTGTGTGGAATAAAAAGCAAGGTTTTTTAATCACTTGGATTGTTTTAAGATATGG 
CAACTTTGAACCCTTTTGATTTGTTGGATGATGATGCTGAGGATCCAAGCCAGCTCGCTG 
TTGCCATCGAGAAGATTGATAAGTCCAAGAAATCTGGACAGGTTTCGAGCTTGCCTGCTA 
AGTCAGCTCCTAAGCTTCCATCGAAGCCACTTCCTCCTGCTCAAGCCGGTGAGGTTTCTT 
CTCATAAATCAATATTTAATCAGAAAAATTCGATCTTTATTACTGGAGTAAGCTGTCTGT 
GTTATTGTTTGGATTCTCTTGATTATTCATGGAGTTGTGTTTTGTCGGTTGAATGATTGA 
GATTAGTGTATGATTAGTTTTGATGCTGTTGACTAGTGAGAGAGGCAAGGAGTGATGCTC 
CACGTGGTGGTGGAGGCCGTGGAGGATTTAACCGTGGTCGTGGTGGTTACAACCGTGATG 
ATGGTAACAATGGATATTCAGGGGGATACACTAAACCCTCAGGTGAAGGAGATGTTTCAA 
AGTCTTCTTACGAGAGGCGTGGCGGTGGTGGTGCTCCTCGTGGTTCCTTCCGTGGTGAAG 
GTGGTGGACCTGGTGGTGGTCGTCGTGGTGGATTCAGCAATGAGGGTGGTGATGGGGAAC 
GTCCTCGAAGGGCCTTTGAGCGTCGTAGTGGAACTGGCAGAGGGTCAGTCTTATTCTGTT 
GTTGCATAATCTGCCATTGAAATGACTGTGTCAATCTCATAAGTTGGAGTTTATCTTTTG 
GATAGGAGTGACTTCAAGCGTGACGGATCTGGTCGTGGGAATTGGGGAACTCCAGGGGAA 
GAGATAGCTGCGTATGTAATTGTTTATGGTTTATTGCATTTGTTTAAAAAAGTATGTATT 
AATGTGATTGTGATTGGGAATTTGGACTAAAAGAAGTTTTCTCTGGATTTTAAGTGAGAC 
TGAAGCAGTAGCTGGTGTTGAGACTGAGAAGGATGTTGGAGAGAAGCCAGCTGTTGATGA 
TGTAGCTGCTGATGCTAACAAGGAGGATACTGTTGTTGAGGAGAAAGAGCCTGAGGATAA 
GGTAAACAGAGAATAGAATAGAAATGCTAGGCTCCTCTTTACTATACTGGTATCAGTTTT 
TTTTATTTTCACTTATTGTTTATTGACTTGTGTTTCTACAGGAAATGACTCTTGATGAGT 
ATGAGAAAATACTCGAGGAGAAGAAAAAGGCACTTCAATCATTAACTACCTCTGAGAGGA 
AAGTTGATACGAAAGTGTTTGAATCAATGCAACAACTGTCAAACAAGAAGTCTAATGATG 
AAATCTTCATCAAGCTGGTAAGACATATCATGTATCATTTCTTCATTGTCGTCTATTAAC 
TTGCGTCAATGATTCTAAACCTTTCCTTTGACCTATTTCCCAGGGTTCTGATAAGGACAA 
ACGCAAAGATGACAAAGAAGAGAAGGCTAAGAAGGTTTAAATCATTGTCTGAATTGAAAC 
ATATTGTAGAAATCAATAAGTTTGCTTATTGATGTGTGTTCCTGATTGTAAACAGGCTGT 
GAGCATCAATGAGTTTCTGAAGCCAGCAGAGGGTGGGAACTACTACCGAGGAGGTCGTGG 
TGGCCGTGGACGTGGTGGTCGTGGCCGTGGAGGTGTTTCTAGTGGCGAATCTGGTGGTTA 
CCGTAATGAAGCTGCACCGGCAATTGGAGATGCTGCTCAGTTCCCATCTCTTGGGGGCAA 
GTAAGATCCATCCATGATAACGTCCACACTCGTGCATCCTCCTTTAGGATTTTGTGCGAG 
GATTTACTGTTTACTGGTCTCTCGTTGTCAGATGTAAATAATTAGGTGTCGTCGTCAGTT 
TTTAGATTTTATGCAAAACTTTACACTTGTTGGTGTTCTTTACTTTTGAAACAGTACACT 
CTTCTTAATTTTACCATTTTACTCGTTTTGTGTTTGTTGTTTTCTTATTTATGAAACATG 
TTTTGAGACGGACATATCTAATGTTATCGGGTTTGAGTCTTTACTCTGTC
>AT4G16830.1 |  nuclear RNA-binding protein (RGGA) 
GCCTATTCCAAATTTCCACACATTTTATTTTCATTTCTTAATATTTATTTCCTTATCATT 
TCTTTCTCTCACCAACCAACAAGTTCTCCTTTCTACCCATTTCGTCTCCTTCATTTTGAC 
GTTTTCTTTAGATCTGTTAATAATCCCATCCATGGCTTGGTCTAGTCACTAGTGGTGTTA 
TCTCTCTGTGTGGAATAAAAAGCAAGGTTTTTTAATCACTTGGATTGTTTTAAGATATGG 
CAACTTTGAACCCTTTTGATTTGTTGGATGATGATGCTGAGGATCCAAGCCAGCTCGCTG 
TTGCCATCGAGAAGATTGATAAGTCCAAGAAATCTGGACAGGTTTCGAGCTTGCCTGCTA 
AGTCAGCTCCTAAGCTTCCATCGAAGCCACTTCCTCCTGCTCAAGCCGGTGAGGTTTCTT 
CTCATAAATCAATATTTAATCAGAAAAATTCGATCTTTATTACTGGAGTAAGCTGTCTGT 
GTTATTGTTTGGATTCTCTTGATTATTCATGGAGTTGTGTTTTGTCGGTTGAATGATTGA 
GATTAGTGTATGATTAGTTTTGATGCTGTTGACTAGTGAGAGAGGCAAGGAGTGATGCTC 
CACGTGGTGGTGGAGGCCGTGGAGGATTTAACCGTGGTCGTGGTGGTTACAACCGTGATG 
ATGGTAACAATGGATATTCAGGGGGATACACTAAACCCTCAGGTGAAGGAGATGTTTCAA 
AGTCTTCTTACGAGAGGCGTGGCGGTGGTGGTGCTCCTCGTGGTTCCTTCCGTGGTGAAG 
GTGGTGGACCTGGTGGTGGTCGTCGTGGTGGATTCAGCAATGAGGGTGGTGATGGGGAAC 
GTCCTCGAAGGGCCTTTGAGCGTCGTAGTGGAACTGGCAGAGGGTCAGTCTTATTCTGTT 
GTTGCATAATCTGCCATTGAAATGACTGTGTCAATCTCATAAGTTGGAGTTTATCTTTTG 
GATAGGAGTGACTTCAAGCGTGACGGATCTGGTCGTGGGAATTGGGGAACTCCAGGGGAA 
GAGATAGCTGCGTATGTAATTGTTTATGGTTTATTGCATTTGTTTAAAAAAGTATGTATT 
AATGTGATTGTGATTGGGAATTTGGACTAAAAGAAGTTTTCTCTGGATTTTAAGTGAGAC 
TGAAGCAGTAGCTGGTGTTGAGACTGAGAAGGATGTTGGAGAGAAGCCAGCTGTTGATGA 
TGTAGCTGCTGATGCTAACAAGGAGGATACTGTTGTTGAGGAGAAAGAGCCTGAGGATAA 
GGTAAACAGAGAATAGAATAGAAATGCTAGGCTCCTCTTTACTATACTGGTATCAGTTTT 
TTTTATTTTCACTTATTGTTTATTGACTTGTGTTTCTACAGGAAATGACTCTTGATGAGT 
ATGAGAAAATACTCGAGGAGAAGAAAAAGGCACTTCAATCATTAACTACCTCTGAGAGGA 
AAGTTGATACGAAAGTGTTTGAATCAATGCAACAACTGTCAAACAAGAAGTCTAATGATG 
AAATCTTCATCAAGCTGGTAAGACATATCATGTATCATTTCTTCATTGTCGTCTATTAAC 
TTGCGTCAATGATTCTAAACCTTTCCTTTGACCTATTTCCCAGGGTTCTGATAAGGACAA 
ACGCAAAGATGACAAAGAAGAGAAGGCTAAGAAGGTTTAAATCATTGTCTGAATTGAAAC 
ATATTGTAGAAATCAATAAGTTTGCTTATTGATGTGTGTTCCTGATTGTAAACAGGCTGT 
GAGCATCAATGAGTTTCTGAAGCCAGCAGAGGGTGGGAACTACTACCGAGGAGGTCGTGG 
TGGCCGTGGACGTGGTGGTCGTGGCCGTGGAGGTGTTTCTAGTGGCGAATCTGGTGGTTA 
CCGTAATGAAGCTGCACCGGCAATTGGAGATGCTGCTCAGTTCCCATCTCTTGGGGGCAA 
GTAAGATCCATCCATGATAACGTCCACACTCGTGCATCCTCCTTTAGGATTTTGTGCGAG 
GATTTACTGTTTACTGGTCTCTCGTTGTCAGATGTAAATAATTAGGTGTCGTCGTCAGTT 
TTTAGATTTTATGCAAAACTTTACACTTGTTGGTGTTCTTTACTTTTGAAACAGTACACT 
CTTCTTAATTTTACCATTTTACTCGTTTTGTGTTTGTTGTTTTCTTATTTATGAAACATG 
TTTTGAGACGGACATATCTAATGTTATCGGGTTTGAGTCTTTACTCTGTC
>AT4G16830.2 |  nuclear RNA-binding protein (RGGA) 
TTATTTTCATTTCTTAATATTTATTTCCTTATCATTTCTTTCTCTCACCAACCAACAAGT 
TCTCCTTTCTACCCATTTCGTCTCCTTCATTTTGACGTTTTCTTTAGATCTGTTAATAAT 
CCCATCCATGGCTTGGTCTAGTCACTAGTGGTGTTATCTCTCTGTGTGGAATAAAAAGCA 
AGGTTTTTTAATCACTTGGATTGTTTTAAGATATGGCAACTTTGAACCCTTTTGATTTGT 
TGGATGATGATGCTGAGGATCCAAGCCAGCTCGCTGTTGCCATCGAGAAGATTGATAAGT 
CCAAGAAATCTGGACAGGTTTCGAGCTTGCCTGCTAAGTCAGCTCCTAAGCTTCCATCGA 
AGCCACTTCCTCCTGCTCAAGCCGGTGAGGTTTCTTCTCATAAATCAATATTTAATCAGA 
AAAATTCGATCTTTATTACTGGAGTAAGCTGTCTGTGTTATTGTTTGGATTCTCTTGATT 
ATTCATGGAGTTGTGTTTTGTCGGTTGAATGATTGAGATTAGTGTATGATTAGTTTTGAT 
GCTGTTGACTAGTGAGAGAGGCAAGGAGTGATGCTCCACGTGGTGGTGGAGGCCGTGGAG 
GATTTAACCGTGGTCGTGGTGGTTACAACCGTGATGATGGTAACAATGGATATTCAGGGG 
GATACACTAAACCCTCAGGTGAAGGAGATGTTTCAAAGTCTTCTTACGAGAGGCGTGGCG 
GTGGTGGTGCTCCTCGTGGTTCCTTCCGTGGTGAAGGTGGTGGACCTGGTGGTGGTCGTC 
GTGGTGGATTCAGCAATGAGGGTGGTGATGGGGAACGTCCTCGAAGGGCCTTTGAGCGTC 
GTAGTGGAACTGGCAGAGGGTCAGTCTTATTCTGTTGTTGCATAATCTGCCATTGAAATG 
ACTGTGTCAATCTCATAAGTTGGAGTTTATCTTTTGGATAGGAGTGACTTCAAGCGTGAC 
GGATCTGGTCGTGGGAATTGGGGAACTCCAGGGGAAGAGATAGCTGCGTATGTAATTGTT 
TATGGTTTATTGCATTTGTTTAAAAAAGTATGTATTAATGTGATTGTGATTGGGAATTTG 
GACTAAAAGAAGTTTTCTCTGGATTTTAAGTGAGACTGAAGCAGTAGCTGGTGTTGAGAC 
TGAGAAGGATGTTGGAGAGAAGCCAGCTGTTGATGATGTAGCTGCTGATGCTAACAAGGA 
GGATACTGTTGTTGAGGAGAAAGAGCCTGAGGATAAGGTAAACAGAGAATAGAATAGAAA 
TGCTAGGCTCCTCTTTACTATACTGGTATCAGTTTTTTTTATTTTCACTTATTGTTTATT 
GACTTGTGTTTCTACAGGAAATGACTCTTGATGAGTATGAGAAAATACTCGAGGAGAAGA 
AAAAGGCACTTCAATCATTAACTACCTCTGAGAGGAAAGTTGATACGAAAGTGTTTGAAT 
CAATGCAACAACTGTCAAACAAGAAGTCTAATGATGAAATCTTCATCAAGCTGGTAAGAC 
ATATCATGTATCATTTCTTCATTGTCGTCTATTAACTTGCGTCAATGATTCTAAACCTTT 
CCTTTGACCTATTTCCCAGGGTTCTGATAAGGACAAACGCAAAGATGACAAAGAAGAGAA 
GGCTAAGAAGGTTTAAATCATTGTCTGAATTGAAACATATTGTAGAAATCAATAAGTTTG 
CTTATTGATGTGTGTTCCTGATTGTAAACAGGCTGTGAGCATCAATGAGTTTCTGAAGCC 
AGCAGAGGGTGGGAACTACTACCGAGGAGGTCGTGGTGGCCGTGGACGTGGTGGTCGTGG 
CCGTGGAGGTGTTTCTAGTGGCGAATCTGGTGGTTACCGTAATGAAGCTGCACCGGCAAT 
TGGAGATGCTGCTCAGTTCCCATCTCTTGGGGGCAAGTAAGATCCATCCATGATAACGTC 
CACACTCGTGCATCCTCCTTTAGGATTTTGTGCGAGGATTTACTGTTTACTGGTCTCTCG 
TTGTCAGATGTAAATAATTAGGTGTCGTCGTCAGTTTTTAGATTTTATGCAAAACTTTAC 
ACTTGTTGGTGTTCTTTACTTTTGAAACAGTACACTCTTCTTAATTTTACCATTTTACTC 
GTTTTGTGTTTGTTGTTTTCTTATTTATGAAACATGTTTTGAGACGGACATATCTAATGT 
TATCGGGTTTGAGTCTTTACTCTGTC
>AT4G16830.2 |  nuclear RNA-binding protein (RGGA) 
TTATTTTCATTTCTTAATATTTATTTCCTTATCATTTCTTTCTCTCACCAACCAACAAGT 
TCTCCTTTCTACCCATTTCGTCTCCTTCATTTTGACGTTTTCTTTAGATCTGTTAATAAT 
CCCATCCATGGCTTGGTCTAGTCACTAGTGGTGTTATCTCTCTGTGTGGAATAAAAAGCA 
AGGTTTTTTAATCACTTGGATTGTTTTAAGATATGGCAACTTTGAACCCTTTTGATTTGT 
TGGATGATGATGCTGAGGATCCAAGCCAGCTCGCTGTTGCCATCGAGAAGATTGATAAGT 
CCAAGAAATCTGGACAGGTTTCGAGCTTGCCTGCTAAGTCAGCTCCTAAGCTTCCATCGA 
AGCCACTTCCTCCTGCTCAAGCCGGTGAGGTTTCTTCTCATAAATCAATATTTAATCAGA 
AAAATTCGATCTTTATTACTGGAGTAAGCTGTCTGTGTTATTGTTTGGATTCTCTTGATT 
ATTCATGGAGTTGTGTTTTGTCGGTTGAATGATTGAGATTAGTGTATGATTAGTTTTGAT 
GCTGTTGACTAGTGAGAGAGGCAAGGAGTGATGCTCCACGTGGTGGTGGAGGCCGTGGAG 
GATTTAACCGTGGTCGTGGTGGTTACAACCGTGATGATGGTAACAATGGATATTCAGGGG 
GATACACTAAACCCTCAGGTGAAGGAGATGTTTCAAAGTCTTCTTACGAGAGGCGTGGCG 
GTGGTGGTGCTCCTCGTGGTTCCTTCCGTGGTGAAGGTGGTGGACCTGGTGGTGGTCGTC 
GTGGTGGATTCAGCAATGAGGGTGGTGATGGGGAACGTCCTCGAAGGGCCTTTGAGCGTC 
GTAGTGGAACTGGCAGAGGGTCAGTCTTATTCTGTTGTTGCATAATCTGCCATTGAAATG 
ACTGTGTCAATCTCATAAGTTGGAGTTTATCTTTTGGATAGGAGTGACTTCAAGCGTGAC 
GGATCTGGTCGTGGGAATTGGGGAACTCCAGGGGAAGAGATAGCTGCGTATGTAATTGTT 
TATGGTTTATTGCATTTGTTTAAAAAAGTATGTATTAATGTGATTGTGATTGGGAATTTG 
GACTAAAAGAAGTTTTCTCTGGATTTTAAGTGAGACTGAAGCAGTAGCTGGTGTTGAGAC 
TGAGAAGGATGTTGGAGAGAAGCCAGCTGTTGATGATGTAGCTGCTGATGCTAACAAGGA 
GGATACTGTTGTTGAGGAGAAAGAGCCTGAGGATAAGGTAAACAGAGAATAGAATAGAAA 
TGCTAGGCTCCTCTTTACTATACTGGTATCAGTTTTTTTTATTTTCACTTATTGTTTATT 
GACTTGTGTTTCTACAGGAAATGACTCTTGATGAGTATGAGAAAATACTCGAGGAGAAGA 
AAAAGGCACTTCAATCATTAACTACCTCTGAGAGGAAAGTTGATACGAAAGTGTTTGAAT 
CAATGCAACAACTGTCAAACAAGAAGTCTAATGATGAAATCTTCATCAAGCTGGTAAGAC 
ATATCATGTATCATTTCTTCATTGTCGTCTATTAACTTGCGTCAATGATTCTAAACCTTT 
CCTTTGACCTATTTCCCAGGGTTCTGATAAGGACAAACGCAAAGATGACAAAGAAGAGAA 
GGCTAAGAAGGTTTAAATCATTGTCTGAATTGAAACATATTGTAGAAATCAATAAGTTTG 
CTTATTGATGTGTGTTCCTGATTGTAAACAGGCTGTGAGCATCAATGAGTTTCTGAAGCC 
AGCAGAGGGTGGGAACTACTACCGAGGAGGTCGTGGTGGCCGTGGACGTGGTGGTCGTGG 
CCGTGGAGGTGTTTCTAGTGGCGAATCTGGTGGTTACCGTAATGAAGCTGCACCGGCAAT 
TGGAGATGCTGCTCAGTTCCCATCTCTTGGGGGCAAGTAAGATCCATCCATGATAACGTC 
CACACTCGTGCATCCTCCTTTAGGATTTTGTGCGAGGATTTACTGTTTACTGGTCTCTCG 
TTGTCAGATGTAAATAATTAGGTGTCGTCGTCAGTTTTTAGATTTTATGCAAAACTTTAC 
ACTTGTTGGTGTTCTTTACTTTTGAAACAGTACACTCTTCTTAATTTTACCATTTTACTC 
GTTTTGTGTTTGTTGTTTTCTTATTTATGAAACATGTTTTGAGACGGACATATCTAATGT 
TATCGGGTTTGAGTCTTTACTCTGTC
>AT4G16830.2 |  nuclear RNA-binding protein (RGGA) 
TTATTTTCATTTCTTAATATTTATTTCCTTATCATTTCTTTCTCTCACCAACCAACAAGT 
TCTCCTTTCTACCCATTTCGTCTCCTTCATTTTGACGTTTTCTTTAGATCTGTTAATAAT 
CCCATCCATGGCTTGGTCTAGTCACTAGTGGTGTTATCTCTCTGTGTGGAATAAAAAGCA 
AGGTTTTTTAATCACTTGGATTGTTTTAAGATATGGCAACTTTGAACCCTTTTGATTTGT 
TGGATGATGATGCTGAGGATCCAAGCCAGCTCGCTGTTGCCATCGAGAAGATTGATAAGT 
CCAAGAAATCTGGACAGGTTTCGAGCTTGCCTGCTAAGTCAGCTCCTAAGCTTCCATCGA 
AGCCACTTCCTCCTGCTCAAGCCGGTGAGGTTTCTTCTCATAAATCAATATTTAATCAGA 
AAAATTCGATCTTTATTACTGGAGTAAGCTGTCTGTGTTATTGTTTGGATTCTCTTGATT 
ATTCATGGAGTTGTGTTTTGTCGGTTGAATGATTGAGATTAGTGTATGATTAGTTTTGAT 
GCTGTTGACTAGTGAGAGAGGCAAGGAGTGATGCTCCACGTGGTGGTGGAGGCCGTGGAG 
GATTTAACCGTGGTCGTGGTGGTTACAACCGTGATGATGGTAACAATGGATATTCAGGGG 
GATACACTAAACCCTCAGGTGAAGGAGATGTTTCAAAGTCTTCTTACGAGAGGCGTGGCG 
GTGGTGGTGCTCCTCGTGGTTCCTTCCGTGGTGAAGGTGGTGGACCTGGTGGTGGTCGTC 
GTGGTGGATTCAGCAATGAGGGTGGTGATGGGGAACGTCCTCGAAGGGCCTTTGAGCGTC 
GTAGTGGAACTGGCAGAGGGTCAGTCTTATTCTGTTGTTGCATAATCTGCCATTGAAATG 
ACTGTGTCAATCTCATAAGTTGGAGTTTATCTTTTGGATAGGAGTGACTTCAAGCGTGAC 
GGATCTGGTCGTGGGAATTGGGGAACTCCAGGGGAAGAGATAGCTGCGTATGTAATTGTT 
TATGGTTTATTGCATTTGTTTAAAAAAGTATGTATTAATGTGATTGTGATTGGGAATTTG 
GACTAAAAGAAGTTTTCTCTGGATTTTAAGTGAGACTGAAGCAGTAGCTGGTGTTGAGAC 
TGAGAAGGATGTTGGAGAGAAGCCAGCTGTTGATGATGTAGCTGCTGATGCTAACAAGGA 
GGATACTGTTGTTGAGGAGAAAGAGCCTGAGGATAAGGTAAACAGAGAATAGAATAGAAA 
TGCTAGGCTCCTCTTTACTATACTGGTATCAGTTTTTTTTATTTTCACTTATTGTTTATT 
GACTTGTGTTTCTACAGGAAATGACTCTTGATGAGTATGAGAAAATACTCGAGGAGAAGA 
AAAAGGCACTTCAATCATTAACTACCTCTGAGAGGAAAGTTGATACGAAAGTGTTTGAAT 
CAATGCAACAACTGTCAAACAAGAAGTCTAATGATGAAATCTTCATCAAGCTGGTAAGAC 
ATATCATGTATCATTTCTTCATTGTCGTCTATTAACTTGCGTCAATGATTCTAAACCTTT 
CCTTTGACCTATTTCCCAGGGTTCTGATAAGGACAAACGCAAAGATGACAAAGAAGAGAA 
GGCTAAGAAGGTTTAAATCATTGTCTGAATTGAAACATATTGTAGAAATCAATAAGTTTG 
CTTATTGATGTGTGTTCCTGATTGTAAACAGGCTGTGAGCATCAATGAGTTTCTGAAGCC 
AGCAGAGGGTGGGAACTACTACCGAGGAGGTCGTGGTGGCCGTGGACGTGGTGGTCGTGG 
CCGTGGAGGTGTTTCTAGTGGCGAATCTGGTGGTTACCGTAATGAAGCTGCACCGGCAAT 
TGGAGATGCTGCTCAGTTCCCATCTCTTGGGGGCAAGTAAGATCCATCCATGATAACGTC 
CACACTCGTGCATCCTCCTTTAGGATTTTGTGCGAGGATTTACTGTTTACTGGTCTCTCG 
TTGTCAGATGTAAATAATTAGGTGTCGTCGTCAGTTTTTAGATTTTATGCAAAACTTTAC 
ACTTGTTGGTGTTCTTTACTTTTGAAACAGTACACTCTTCTTAATTTTACCATTTTACTC 
GTTTTGTGTTTGTTGTTTTCTTATTTATGAAACATGTTTTGAGACGGACATATCTAATGT 
TATCGGGTTTGAGTCTTTACTCTGTC
>AT4G16830.3 |  nuclear RNA-binding protein (RGGA) 
GCCTATTCCAAATTTCCACACATTTTATTTTCATTTCTTAATATTTATTTCCTTATCATT 
TCTTTCTCTCACCAACCAACAAGTTCTCCTTTCTACCCATTTCGTCTCCTTCATTTTGAC 
GTTTTCTTTAGATCTGTTAATAATCCCATCCATGGCTTGGTCTAGTCACTAGTGGTGTTA 
TCTCTCTGTGTGGAATAAAAAGCAAGGTTTTTTAATCACTTGGATTGTTTTAAGATATGG 
CAACTTTGAACCCTTTTGATTTGTTGGATGATGATGCTGAGGATCCAAGCCAGCTCGCTG 
TTGCCATCGAGAAGATTGATAAGTCCAAGAAATCTGGACAGGTTTCGAGCTTGCCTGCTA 
AGTCAGCTCCTAAGCTTCCATCGAAGCCACTTCCTCCTGCTCAAGCCGGTGAGGTTTCTT 
CTCATAAATCAATATTTAATCAGAAAAATTCGATCTTTATTACTGGAGTAAGCTGTCTGT 
GTTATTGTTTGGATTCTCTTGATTATTCATGGAGTTGTGTTTTGTCGGTTGAATGATTGA 
GATTAGTGTATGATTAGTTTTGATGCTGTTGACTAGTGAGAGAGGCAAGGAGTGATGCTC 
CACGTGGTGGTGGAGGCCGTGGAGGATTTAACCGTGGTCGTGGTGGTTACAACCGTGATG 
ATGGTAACAATGGATATTCAGGGGGATACACTAAACCCTCAGGTGAAGGAGATGTTTCAA 
AGTCTTCTTACGAGAGGCGTGGCGGTGGTGGTGCTCCTCGTGGTTCCTTCCGTGGTGAAG 
GTGGTGGACCTGGTGGTGGTCGTCGTGGTGGATTCAGCAATGAGGGTGGTGATGGGGAAC 
GTCCTCGAAGGGCCTTTGAGCGTCGTAGTGGAACTGGCAGAGGGTCAGTCTTATTCTGTT 
GTTGCATAATCTGCCATTGAAATGACTGTGTCAATCTCATAAGTTGGAGTTTATCTTTTG 
GATAGGAGTGACTTCAAGCGTGACGGATCTGGTCGTGGGAATTGGGGAACTCCAGGGGAA 
GAGATAGCTGCGTATGTAATTGTTTATGGTTTATTGCATTTGTTTAAAAAAGTATGTATT 
AATGTGATTGTGATTGGGAATTTGGACTAAAAGAAGTTTTCTCTGGATTTTAAGTGAGAC 
TGAAGCAGTAGCTGGTGTTGAGACTGAGAAGGATGTTGGAGAGAAGCCAGCTGTTGATGA 
TGTAGCTGCTGATGCTAACAAGGAGGATACTGTTGTTGAGGAGAAAGAGCCTGAGGATAA 
GGTAAACAGAGAATAGAATAGAAATGCTAGGCTCCTCTTTACTATACTGGTATCAGTTTT 
TTTTATTTTCACTTATTGTTTATTGACTTGTGTTTCTACAGGAAATGACTCTTGATGAGT 
ATGAGAAAATACTCGAGGAGAAGAAAAAGGCACTTCAATCATTAACTACCTCTGAGAGGA 
AAGTTGATACGAAAGTGTTTGAATCAATGCAACAACTGTCAAACAAGAAGTCTAATGATG 
AAATCTTCATCAAGCTGGTAAGACATATCATGTATCATTTCTTCATTGTCGTCTATTAAC 
TTGCGTCAATGATTCTAAACCTTTCCTTTGACCTATTTCCCAGGGTTCTGATAAGGACAA 
ACGCAAAGATGACAAAGAAGAGAAGGCTAAGAAGGTTTAAATCATTGTCTGAATTGAAAC 
ATATTGTAGAAATCAATAAGTTTGCTTATTGATGTGTGTTCCTGATTGTAAACAGGCTGT 
GAGCATCAATGAGTTTCTGAAGCCAGCAGAGGGTGGGAACTACTACCGAGGAGGTCGTGG 
TGGCCGTGGACGTGGTGGTCGTGGCCGTGGAGGTGTTTCTAGTGGCGAATCTGGTGGTTA 
CCGTAATGAAGCTGCACCGGCAATTGGAGATGCTGCTCAGTTCCCATCTCTTGGGGGCAA 
GTAAGATCCATCCATGATAACGTCCACACTCGTGCATCCTCCTTTAGGATTTTGTGCGAG 
GATTTACTGTTTACTGGTCTCTCGTTGTCAGATGTAAATAATTAGGTGTCGTCGTCAGTT 
TTTAGATTTTATGCAAAACTTTACACTTGTTGGTGTTCTTTACTTTTGAAACAGTACACT 
CTTCTTAATTTTACCATTTTACTCGTTTTGTGTTTGTTGTTTTCTTATTTATGAAACATG 
TTTTGAGACGGACATATCTAATGTTATCGGGTTTGAGTCTTTACTCTGTC
>AT4G16830.3 |  nuclear RNA-binding protein (RGGA) 
GCCTATTCCAAATTTCCACACATTTTATTTTCATTTCTTAATATTTATTTCCTTATCATT 
TCTTTCTCTCACCAACCAACAAGTTCTCCTTTCTACCCATTTCGTCTCCTTCATTTTGAC 
GTTTTCTTTAGATCTGTTAATAATCCCATCCATGGCTTGGTCTAGTCACTAGTGGTGTTA 
TCTCTCTGTGTGGAATAAAAAGCAAGGTTTTTTAATCACTTGGATTGTTTTAAGATATGG 
CAACTTTGAACCCTTTTGATTTGTTGGATGATGATGCTGAGGATCCAAGCCAGCTCGCTG 
TTGCCATCGAGAAGATTGATAAGTCCAAGAAATCTGGACAGGTTTCGAGCTTGCCTGCTA 
AGTCAGCTCCTAAGCTTCCATCGAAGCCACTTCCTCCTGCTCAAGCCGGTGAGGTTTCTT 
CTCATAAATCAATATTTAATCAGAAAAATTCGATCTTTATTACTGGAGTAAGCTGTCTGT 
GTTATTGTTTGGATTCTCTTGATTATTCATGGAGTTGTGTTTTGTCGGTTGAATGATTGA 
GATTAGTGTATGATTAGTTTTGATGCTGTTGACTAGTGAGAGAGGCAAGGAGTGATGCTC 
CACGTGGTGGTGGAGGCCGTGGAGGATTTAACCGTGGTCGTGGTGGTTACAACCGTGATG 
ATGGTAACAATGGATATTCAGGGGGATACACTAAACCCTCAGGTGAAGGAGATGTTTCAA 
AGTCTTCTTACGAGAGGCGTGGCGGTGGTGGTGCTCCTCGTGGTTCCTTCCGTGGTGAAG 
GTGGTGGACCTGGTGGTGGTCGTCGTGGTGGATTCAGCAATGAGGGTGGTGATGGGGAAC 
GTCCTCGAAGGGCCTTTGAGCGTCGTAGTGGAACTGGCAGAGGGTCAGTCTTATTCTGTT 
GTTGCATAATCTGCCATTGAAATGACTGTGTCAATCTCATAAGTTGGAGTTTATCTTTTG 
GATAGGAGTGACTTCAAGCGTGACGGATCTGGTCGTGGGAATTGGGGAACTCCAGGGGAA 
GAGATAGCTGCGTATGTAATTGTTTATGGTTTATTGCATTTGTTTAAAAAAGTATGTATT 
AATGTGATTGTGATTGGGAATTTGGACTAAAAGAAGTTTTCTCTGGATTTTAAGTGAGAC 
TGAAGCAGTAGCTGGTGTTGAGACTGAGAAGGATGTTGGAGAGAAGCCAGCTGTTGATGA 
TGTAGCTGCTGATGCTAACAAGGAGGATACTGTTGTTGAGGAGAAAGAGCCTGAGGATAA 
GGTAAACAGAGAATAGAATAGAAATGCTAGGCTCCTCTTTACTATACTGGTATCAGTTTT 
TTTTATTTTCACTTATTGTTTATTGACTTGTGTTTCTACAGGAAATGACTCTTGATGAGT 
ATGAGAAAATACTCGAGGAGAAGAAAAAGGCACTTCAATCATTAACTACCTCTGAGAGGA 
AAGTTGATACGAAAGTGTTTGAATCAATGCAACAACTGTCAAACAAGAAGTCTAATGATG 
AAATCTTCATCAAGCTGGTAAGACATATCATGTATCATTTCTTCATTGTCGTCTATTAAC 
TTGCGTCAATGATTCTAAACCTTTCCTTTGACCTATTTCCCAGGGTTCTGATAAGGACAA 
ACGCAAAGATGACAAAGAAGAGAAGGCTAAGAAGGTTTAAATCATTGTCTGAATTGAAAC 
ATATTGTAGAAATCAATAAGTTTGCTTATTGATGTGTGTTCCTGATTGTAAACAGGCTGT 
GAGCATCAATGAGTTTCTGAAGCCAGCAGAGGGTGGGAACTACTACCGAGGAGGTCGTGG 
TGGCCGTGGACGTGGTGGTCGTGGCCGTGGAGGTGTTTCTAGTGGCGAATCTGGTGGTTA 
CCGTAATGAAGCTGCACCGGCAATTGGAGATGCTGCTCAGTTCCCATCTCTTGGGGGCAA 
GTAAGATCCATCCATGATAACGTCCACACTCGTGCATCCTCCTTTAGGATTTTGTGCGAG 
GATTTACTGTTTACTGGTCTCTCGTTGTCAGATGTAAATAATTAGGTGTCGTCGTCAGTT 
TTTAGATTTTATGCAAAACTTTACACTTGTTGGTGTTCTTTACTTTTGAAACAGTACACT 
CTTCTTAATTTTACCATTTTACTCGTTTTGTGTTTGTTGTTTTCTTATTTATGAAACATG 
TTTTGAGACGGACATATCTAATGTTATCGGGTTTGAGTCTTTACTCTGTC
>AT4G16830.3 |  nuclear RNA-binding protein (RGGA) 
GCCTATTCCAAATTTCCACACATTTTATTTTCATTTCTTAATATTTATTTCCTTATCATT 
TCTTTCTCTCACCAACCAACAAGTTCTCCTTTCTACCCATTTCGTCTCCTTCATTTTGAC 
GTTTTCTTTAGATCTGTTAATAATCCCATCCATGGCTTGGTCTAGTCACTAGTGGTGTTA 
TCTCTCTGTGTGGAATAAAAAGCAAGGTTTTTTAATCACTTGGATTGTTTTAAGATATGG 
CAACTTTGAACCCTTTTGATTTGTTGGATGATGATGCTGAGGATCCAAGCCAGCTCGCTG 
TTGCCATCGAGAAGATTGATAAGTCCAAGAAATCTGGACAGGTTTCGAGCTTGCCTGCTA 
AGTCAGCTCCTAAGCTTCCATCGAAGCCACTTCCTCCTGCTCAAGCCGGTGAGGTTTCTT 
CTCATAAATCAATATTTAATCAGAAAAATTCGATCTTTATTACTGGAGTAAGCTGTCTGT 
GTTATTGTTTGGATTCTCTTGATTATTCATGGAGTTGTGTTTTGTCGGTTGAATGATTGA 
GATTAGTGTATGATTAGTTTTGATGCTGTTGACTAGTGAGAGAGGCAAGGAGTGATGCTC 
CACGTGGTGGTGGAGGCCGTGGAGGATTTAACCGTGGTCGTGGTGGTTACAACCGTGATG 
ATGGTAACAATGGATATTCAGGGGGATACACTAAACCCTCAGGTGAAGGAGATGTTTCAA 
AGTCTTCTTACGAGAGGCGTGGCGGTGGTGGTGCTCCTCGTGGTTCCTTCCGTGGTGAAG 
GTGGTGGACCTGGTGGTGGTCGTCGTGGTGGATTCAGCAATGAGGGTGGTGATGGGGAAC 
GTCCTCGAAGGGCCTTTGAGCGTCGTAGTGGAACTGGCAGAGGGTCAGTCTTATTCTGTT 
GTTGCATAATCTGCCATTGAAATGACTGTGTCAATCTCATAAGTTGGAGTTTATCTTTTG 
GATAGGAGTGACTTCAAGCGTGACGGATCTGGTCGTGGGAATTGGGGAACTCCAGGGGAA 
GAGATAGCTGCGTATGTAATTGTTTATGGTTTATTGCATTTGTTTAAAAAAGTATGTATT 
AATGTGATTGTGATTGGGAATTTGGACTAAAAGAAGTTTTCTCTGGATTTTAAGTGAGAC 
TGAAGCAGTAGCTGGTGTTGAGACTGAGAAGGATGTTGGAGAGAAGCCAGCTGTTGATGA 
TGTAGCTGCTGATGCTAACAAGGAGGATACTGTTGTTGAGGAGAAAGAGCCTGAGGATAA 
GGTAAACAGAGAATAGAATAGAAATGCTAGGCTCCTCTTTACTATACTGGTATCAGTTTT 
TTTTATTTTCACTTATTGTTTATTGACTTGTGTTTCTACAGGAAATGACTCTTGATGAGT 
ATGAGAAAATACTCGAGGAGAAGAAAAAGGCACTTCAATCATTAACTACCTCTGAGAGGA 
AAGTTGATACGAAAGTGTTTGAATCAATGCAACAACTGTCAAACAAGAAGTCTAATGATG 
AAATCTTCATCAAGCTGGTAAGACATATCATGTATCATTTCTTCATTGTCGTCTATTAAC 
TTGCGTCAATGATTCTAAACCTTTCCTTTGACCTATTTCCCAGGGTTCTGATAAGGACAA 
ACGCAAAGATGACAAAGAAGAGAAGGCTAAGAAGGTTTAAATCATTGTCTGAATTGAAAC 
ATATTGTAGAAATCAATAAGTTTGCTTATTGATGTGTGTTCCTGATTGTAAACAGGCTGT 
GAGCATCAATGAGTTTCTGAAGCCAGCAGAGGGTGGGAACTACTACCGAGGAGGTCGTGG 
TGGCCGTGGACGTGGTGGTCGTGGCCGTGGAGGTGTTTCTAGTGGCGAATCTGGTGGTTA 
CCGTAATGAAGCTGCACCGGCAATTGGAGATGCTGCTCAGTTCCCATCTCTTGGGGGCAA 
GTAAGATCCATCCATGATAACGTCCACACTCGTGCATCCTCCTTTAGGATTTTGTGCGAG 
GATTTACTGTTTACTGGTCTCTCGTTGTCAGATGTAAATAATTAGGTGTCGTCGTCAGTT 
TTTAGATTTTATGCAAAACTTTACACTTGTTGGTGTTCTTTACTTTTGAAACAGTACACT 
CTTCTTAATTTTACCATTTTACTCGTTTTGTGTTTGTTGTTTTCTTATTTATGAAACATG 
TTTTGAGACGGACATATCTAATGTTATCGGGTTTGAGTCTTTACTCTGTC
>AT1G74060.1 |  60S ribosomal protein L6 (RPL6B) 
ACTACCCAATTTATTCTCGGCCGGAAAGTCTCTTCTTGATTATCGTCCAGGGATTGCAAC 
AGAGAGAAAGTAACGATGCCGGCGAAACAGAGGACAGCTAAGGTCAACAGGAATCCTGAT 
CTGATCAGGGGAGTTGGTAAATACTCAAGGTCTCAGATGTACCATAAGAGAGGTTTGTGG 
GCAATCAAGGCCAAAAATGGAGGCGTTTTCCCCCGCCACGACGCTAAATCTAAGGTTGAT 
GCTCCGGTGGAGAAGCCACCGAAGTTCTATCCAGCTGAAGACGTGAAGAAACCTCTCCCC 
AACAGGCGCACGGCAAAACCAGCCAAGCTCAGGTACTTAGCTGATACACTGTCTCATTGT 
CTTGGAGTCTGAAATCTAGCTCAATGCAATAGTTGTTTTCTTTGGTTCTTAAGGAGTGCT 
TTGTATGCATTTAAATCTTTGAATCTCCCGAAATTTTTTGACTAGCTTAGTGTTTTGAAA 
TCGTTAATTAGTCATTGTGGTCTGTTCTATTTGGTTTGTGAATTTATCTTGATTTCTGTG 
GAAAGTTTGCCTCTTTTGCTTGTATTTTGTGTTACATTGTTCGGAATTTGTTATGTTGTA 
ATCCGATATTCATATTTCTCTATTGCAGAGCTAGCATCACTCCAGGGACAGTGCTTATCA 
TCCTTGCTGGTAGATTTAAGGGCAAGAGAGTTGTCTTCCTTAAGCAGCTTGCCTCCGGTT 
TGCTTCTTGTGACTGGTGAGTTTTATGCTAATCTACTTTCTTTATTTGCCACATTCTTTA 
TTCGAAATGCAGAACGCCCATTCACTAAACTTGCTTTCTGTATTCTGTATAAAGTTGACA 
TTCCTGTTTTGTTATTGACCTTAGGACCATTCAAGATCAATGGTGTTCCTCTGAGACGTG 
TTAACCAGGCCTATGTCATTGGTACTTCCACAAAGGTTGACATTTCTGGAGTTACCCTCG 
ACAAATTCGATGATAAGTACTTCGGCAAGGTTGCTGAGAAGAAAAAGAAGAAGACTGAAG 
GAGAGTTCTTCGAGGCTGAGAAAGAGGTATCCCAAACATTCTTCTTGTCTTTCTCTAAGA 
GTCATTTGGTTCTCATTTTGTAATAGACGATTAAAGTTCTCTCCTTTATACACTACCCAA 
ATTAAAAGCTATGCGTGACCTCCATATACTTTTTTTCCTTCCGCAGGAGAAGAAAGAGAT 
TCCACAGGGAAAGAAAGATGACCAGAAAGCCGTGGACGCAGCTTTGATCAAAGCTATTGA 
AGCAGTTCCAGAGTTGAAGACTTACCTCGGAGCAAGGTTTTCATTGAAACAAGGAATGAA 
GCCCCATGAGCTTGTTTTCTAGATTTCATTACTTTTTTTCTGAGGTTTCTAGTGTATCTG 
TCTCCTGAAGTTTTACACTCCAACTGGTTGGTTCTGTTCTCGTCCACTGACCAGAGACAT 
AAAATCTTGGCTGCTGCTATCTGGATTTCTGTCTTATATGGATAATTTATCAATCCTGTT 
TTTGAAGGAGAACTTTTCACAAGATTCTAGTAATGCTTAAGT
>AT4G25630.1 |  FIB2 (FIBRILLARIN 2) snoRNA binding 
ATGTATAAAAACACTTGCGAGCGCAGCTTCATCGCCATCGCCATTCTCTCTCTCATCAAA 
AGCTTTTCTCCTTGATTTTCGCATTCTTTAGAGTCTTAACGCAAAGATGAGACCTCCTCT 
AACTGGTAAGAACCCTAGCCGCCTCTTCTCTTTTCTTCATTGCTTGCTTATCAGATTAAC 
AATGGCGAGTGACACTCTTAGCTCGTTTAGTCTTTAAAACTTTATGTCTTTAGCTGAACT 
GATTGTCAACTTTGTTCTTTTTTGCTTAGAACTGTATTGGGTCTGCGTTAGTTCTATCGG 
ATATAGAGTTGATGGTTGGGTTTTATGTTAAACATGGAGTCTCTAATGAATGGTCTTTTG 
TGTTCAGGAAGTGGTGGTGGGTTCAGTGGTGGAAGAGGGCGTGGTGGATACAGTGGTGGT 
AGAGGTGACGGTGGATTCAGTGGTGGTCGAGGTGGCGGTGGTAGAGGAGGAGGAAGAGGT 
TTCAGCGACCGTGGTGGTCGCGGCAGAGGAAGAGGACCACCACGTGGTGGTGCTCGCGGC 
GGCAGAGGACCAGCTGGCCGTGGAGGCATGAAAGGAGGAAGCAAAGTGATTGTGGAACCT 
CACAGACACGCAGGAGTGTTCATTGCAAAGGGTAAAGAAGATGCCCTTGTTACCAAGAAT 
TTGGTTCCTGGTGAAGCTGTCTACAACGAGAAGAGAATCTCTGTTCAGGTATTATAGAGG 
ATTGATTAATTGATTGATGGTTTGTATTTGCACTCCTTTTGATGAATTTGTTTTTAATGG 
TTCTTGTGATTGAATCTGCAGAACGAAGATGGAACCAAGACTGAATACAGAGTTTGGAAT 
CCTTTCCGTTCGAAGTTGGCTGCTGCTATTCTTGGTGGTGTTGATAACATCTGGATTGTA 
AGCATCAGCTTGTGTGAATCTTATTGTTGTTGTTTGCGAGACTTGGTTCATATATTGATT 
GTTGTTCCCGTTTCAATGTAGAAACCTGGTGCTAAAGTTCTATACCTTGGTGCTGCTTCT 
GGAACCACAGTCTCTCATGTGTCTGATCTTGTTGGCCCTGTAAGCAGAACCCGTCCTTTA 
TGTTGTGATTATCAGGTTTTAGACGTGTATTGGAGTTTCTTATATATTGCCTTTGTGATC 
TGATAGGAGGGGTGTGTGTACGCGGTTGAGTTTTCTCATAGAAGTGGTAGAGATTTGGTG 
AACATGGCAAAGAAGAGAACCAATGTTATTCCAATCATCGAGGATGCTAGACACCCAGCT 
AAATACAGAATGCTTGTAGGCATGGTTGATGTTATCTTCTCTGATGTTGCTCAGCCAGAT 
CAGGTTTGCTTCTTTTGTTTAACTCACAATGAATGTCTAAATATTTGCCTCAAAAAGCTT 
GACCCAATACCATTATATGTGTCCTTTGCTTTAAAATGGTGTTTTGATAATTGCAAATGA 
TGATCTTACTTGGATTCCCCTTCAGATCATTATGGGTGATGCAATCTCCAAGTTTCTGAT 
GTACTGAAAATTCTTGTTTTTGTTTTTGTTAAGCTTAATCTTATTTTACTATGTACTTGT 
TTTACAATTTCGTTTTTAAGAACAATACTAAATTTAAATGTCTATTATTGCTCGGTTTTG 
GTTCTCCTGATGTTAAACCTACTTGTTTTCTAAATGCCATTCAGCTTGTGGGTTGCTTCT 
AGTATACTTTATACTGTTTTGTTTATGAAATTTTCTGTGCCATTTAAAACCGTGCAGGCT 
AGGATCTTGGCTTTGAATGCATCATACTTCCTCAAGTCAGGAGGACACTTTGTGATCTCA 
ATAAAGGTGGGTAGCAATCGAAACATTTATTTAATCCATGATCTCTCAAGAGAGAAAGAT 
TAGTGAACATGTATTGTCTCATTTTTGCAGGCAAACTGTATCGACTCCACCGTTCCAGCA 
GAAGCTGTGTTCCAGACTGAAGTGAAGAAGCTTCAACAGGAGCAATTCAAACCAGCTGAG 
CAAGTGACGCTTGAGCCATTTGAGCGTGACCATGCATGTGTCGTTGGTGGCTACCGTATG 
CCTAAGAAGCCAAAGGCTGCTACTGCTGCTTAGAAGTTTTCTACTCTACGCTCTTCCCAG 
TACCTCAGATTTTGCTTTGTCTCGGTCTCTTTAGAATCTGTATGGTTTTAGGGTTTATCT 
TAAATTTTGAGCTTTGTAATCATTTTGAACCCTGGTTATGTTCACTTGGCTTCCAGCGCT 
AACTTTTTCGACAAGTTTTTGATATATGGAACAATTATAATAGAATTTTGTCGACTGAGG 
TTGATTTCTTTAAATAA
>AT1G72440.1 |  EDA25 (embryo sac development arrest 25) 
ATGTCAAAGATAAAGCCTTTGAGTAAATCATCGCAGGACTTGAGTCTTCTCACATCTGAT 
ATCGCATCATTCGCTTCTTCTATTGGCTTAGCTTCTGCTCTTCCTTCTTCGGGTTTCAAC 
GACACTGATTTCCGAAAACCAGCTAAATCCAAAACCCAGAAACGGAAAAAGCCTAAGAAG 
GATCAGCAACACAAGGATGAAGATGAAGAAGGAGAGCCAAAATCGAACATTGGGAATGAA 
AAGGGAAAAGATTTTGGAGCGAGGAAGCAAAACAAAGATGCACCGGTGAAGCAAACGTTA 
CAACCGAAGCCAAAGCCTGGATTCTTATCGATTGATGATGAGAGTACTGGGTACAAGAAA 
AAACGTTTCGATGAATTCAAGAGTTTGCCTAAGTTACCATTGGTGAAAGCGAGTTTATTG 
AGCTCTGAATGGTACAACGATGCAGCTGAGTTTGAGGAGAAGGTGTTTGGTGGCCGGAAA 
GTGGCGGTGGCGAATAAGGAGGATTTTAAGGGTGTGGTGGAGAAGAAGAGAGAATTAGGA 
GAGAGATTGATGTGGCAATACGCAGAGGACTTTGCAACTTCGAAAGGAAAAGGTGGAGAT 
ATGAAGATGGTGATTTCTGCTCAAAAGTCTGGGACAGTTGCTGATAAAATCACTGCCTTT 
GAGATTATGGTTGGAGAGAATCCCATTGCAAATATGAGATCTCTTGATGCCTTATTGGGT 
ATGTTTCTGGTTTTGTTTTTCAATGGTGAAATCCTCTGTAGCATTTTGTTGATGTCTTGT 
TCACATTATCTACTCTGTTCATTGCAGGAATGGTGACCTCAAAGGTTGGAAAAAGATTTG 
CATTTAAGGGTCTTAAGGCTCTATCAGAAATTTTGATCAGGCACATTTTTCTTACTCACA 
CAATGAGCTATGGATTTATGTGTCAGTCTTGCATCTTTTTCTCATTGACTGAGGTTTTTT 
AAATTCTTTCTTCAGGTTATTACCTGATCGCAAGCTGAAGTCACTTTTACAGCGACCTTT 
AAACATCATTCCGGAAAATAAGGATGGTTACTCGCTTTTGCTGTTTTGGTACTGGGAGGA 
TTGCTTGAAACAGAGGTAAAGATCTCAAATCATGCCATGAGGGATGTGTTTAATCACACT 
ATGTCAAAGATCTGTGTCTTCTATCCGTAATTGTTCTGGGTCGATGATTCGTTTAACAGC 
TTAGCATGCTGACTTTGTAGGTATGAGCGCTTCGTCACAGCCCTTGATGAATCATCTAAA 
GATATGCTTCCAGAGCTGAAGGACAAGGCTTTAAAGGTATATATCCTATCACCACTCTGC 
TCGTGCTAGCTTGTTTAGTAGCACTGGTCTCCAGGTTTTGTAAGATTCTTGATGAGCTTT 
AATATTAGAGATTTGAGTATCATCAATGTAATCCTTCTCTGGATGATGCATAACGGCATG 
GTCCGTAGTTTTCTTTTAGCTACAGTGAGTTTTTTTGCTTGGTAACGTGATTCGGATCTT 
TCCTTCAGTAAATTTTTTCTTGTTTGGTTTCAGACAATATATTTCATGTTGACAAGCAAA 
TCAGAACAAGAGCGGAAATTGCTAGTGTCATTGGTGAACAAGGTATTGTTTGTTGTTCAT 
TCAAATATTTGTATCTAATTTAAATTTCTCAGTTGTGATCCCTTTAATTGTTCCATGGAT 
TACTTTATATTATAGTTGGGGGATCCTCAAAACAAGAGTGCATCTAATGCTGATTATCAT 
CTGACAAATCTTTTGGCTGATCATCCTAACATGAAGGTACGGCTATTCAACCTTCCTATG 
CCAGTTTCAGTATTTCGTTTATTAATTGGTTGTTTGGATTCTTCTCTTTGGCTCATGTAA 
TGTTATTTTTTTTCAGGCTGTGGTTATAGATGAAGTTGACTCCTTTCTCTTCCGACCCCA 
TCTTGGGTTACGAGCAAAGTATCATGCTGTATGTCCATTGTTCTCTCTAATTATGTTCAC 
GAGAACCATTTTTCTTTATTTTCTTGCTCTTCTTTTTAAACTGATTCACGCTTATTGTCG 
TCTAAAGTATTGTCTTTGATTTGAATGGGAAACAATTTTACTAAGACTTTAGAAAAGAAA 
AGAAGCATAAACTTATCCATGTTTAGCTTTCTAAACAATGCTCATTAATCTTTGTAAATT 
TCACAGGTTAACTTTTTGAGTCAGATCCGATTGAGCCACAAAGGAGAGGATCCAAAGGTG 
GCAAAACGTCTAATTGATGTATATTTTGCCCTGTTTAAGGTAACTGGCATTGAAGTCAAT 
AAATTTAACATTTCCTTATGATCTTCTTAAAATTTAGTCCCTCCACTTCCACCTTACTTT 
CATGATCTCAGAGACTTCTGCTACCCCTTAGTGTTTTCTTTTGGGGTGGCGTTTGTCATA 
AGTCATAACATGAAATCTTTCACTAGTTGGATATTCACTACAGAAGTGTGTTTGCATTCT 
TGTAGGTTTTAACTACAGAAGCAAATAGGAAACAAGGTGCAGATGACAAAGGAGCCGCTG 
ATAAGAAAAAATCCAACCCAAAGGACACAAAGCAAGAAGTGTCAACTGATTCACCTATTG 
AGTTGGATTCAAGAATTCTATCAGCTCTACTGACGGTTAGTCTGGATGTGTTTTTTTGGT 
GTACATGATGTATGTAATTTTAAAGTATTGAGACTTCACAGATCAACTTATGCTTTAGTA 
CTCCGTAAGTGCAGGGAGTTAACAGAGCTTTTCCATATGTTTCCACTGACGAGGCTGATG 
ATATAATTGAATCCCAGACGCCAGTGCTTTTCAAACTGGTAACCATTTAAAGCTTCATTA 
TAGAAGTTTAGTTTCATAGTTACAACCGAAAATTGATATAGAAAATGGGATTTTGAATAT 
GTAGGTACATTCGGCGAATTTCAATGTAGGAGTCCAATCACTGATGCTTCTTGACAAGAT 
CTCATCCAAGAATAAGATTGTTAGTGACAGGTTTTACCGTGCATTGTACTCGAAACTTCT 
ACTCCCCTCCGCAATGAATTCTTCCAAGGCAAGCTAAACTTTGAACCTTCTGTTTTTCCA 
TGTTCCAATCACGTCATTTTATTCTTAGTTTATGTATGGGTTATAATAACCCTTACAATT 
TGGTAGAGCCCGGAATTGGTTTATGAATGTTGGCATAAGTACATTCATTTATTTATAATC 
TTGTGAAAGCAACTTATATTGTGACAAAAACATCAAGATGTCTGCCCCTGGCATGAACCA 
TAGCATTTTCTTAATGACCGAGTTTACTAAGTTGCCGTTCTTAATTTGCAGGCTGAAATG 
TTTATTGGGCTTCTTCTCAGAGCCATGAAAAATGATATAAATATCAAGCGTGTGGCTGCC 
TTCTCCAAAAGAGTCTTGCAGGTCGGTAACATGAATCATATAAACCATCAACCCCGTCGT 
TTGTAGCTCTAGTTTCATTGACAATGATGACAATATTCGCATCATTGATCCTATACAGGA 
ATCTTGATTCTTTTGTTATTAAATTTTCGATGTCGACACACTGTATAGTAAATTTTTTTG 
TCATCTCTCAAGTGTACTCTTTAACGATTTGAGTAGGTTGCGCTTCAACAGCCACCACAG 
TATGCCTGTGGATGCCTTTTCCTATTATCTGAAGTCTTAAAATCAAGGCCACCTCTATGG 
TAAGCTTTTTTTCGTTCTGTTAACCACATATCCATGGTTTTTAGTTTTTTTACCCAATGA 
TACAATGGGTCCTTCTATTTACGTTGCAGGAAGATGGTGGTCCAGAGGGAATCAGTTGAG 
GAAGAAGAAGATATAGAACATTTTGAGGATGTGATAGAGGGAGATGATGTTGATCCCAAT 
AAGAAAGCAGAGAATGACGAGAATGTTGTTGAAGTTGATCATGATGGTGTCGAAAAGTCA 
AGTAGAGATGGTGATTCTTCTTCAGATGACGAAGAGGCTTTGGCAATCAGGCTATCTGAT 
GAAGAAGATGATAATGCTTCTGATGATTCTGAAGAGCTAATTAGAAACGAAACTCCCCAG 
CTTGAAGAAGTCATGGAGGTTTCTAATGATATGGAAAAAAGAAGCCAACCGCCAATGAGA 
CCGAGTTCTCTTCCTGGAGGATATGATCCTCGTCATAGAGAACCTTCTTACTGGTTAGTT 
AATCTCATCTTTCATCAAAAGCTTAAGTATACTGCTTTTGTCCCCATTAAACAAGCGATA 
CTTGGAACAACGATAATATTTTAAAAACTTTCTTGATATTATAGCCTTATTGGTTGGAAC 
TGAATCCTTGATCTCAAATTAACAGTAACGCAGACCGTGCAAGTTGGTGGGAATTGGGGG 
TTCTTTCAAAACATGCTCACCCCTCGGTTGCTACAATGGCTGGAACCCTTCTCTCAGGAA 
CAAATATTGTTTACAACGGAAACCCGCTGAACGATTTATCTCTAACTGCTTTCTTGGATA 
AATTCATGGAGAAGAAACCAAAGCAAAACACTTGGCATGGTGGTTCCCAGATTGAACCTT 
CCAAGAAGGTAAAAAGCTCATGCTTCAACTATTAAAGCTTTAACCATATTGTTATCTACT 
TTTCCCCTGTAACGTTTTATTTTCTCATCTCATGTTGCAGCTTGACATGTCAAACCGTGT 
GATTGGAGCTGAAATTCTCTCATTAGCAGAAGGAGATGTGGCTCCTGAAGATCTAGTCTT 
CCACAAGTTCTATGTGAACAAGATGACCAGTACGAAGCAGTCAAAGAAAAAGAAGAAGAA 
GAAGCTACCTGAAGAAGAAGCTGCTGAAGAACTTTACGATGTGAATGATGGAGATGGTGG 
AGAAAACTACGATAGTGATGTTGAATTCGAGGCTGGTGATGAGAGTGACAATGAGGAGAT 
TGAGAATATGCTGGATGATGTTGATGATAATGCTGTGGAAGAAGAGGGCGGTGAATATGA 
CTATGATGATCTAGATGGAGTAGCCGGCGAGGATGATGAAGAGCTCGTGGCTGATGTGAG 
CGATGCAGAGATGGACACAGACATGGACATGGACCTGATTGATGATGAAGATGATAACAA 
CGTTGATGATGATGGTACTGGTGATGGTGGTGATGATGATAGTGATGGTGATGATGGTCG 
TAGTAAGAAGAAAAAGAAAGAGAAAAGAAAACGGAAATCTCCATTTGCGAGTCTTGAAGA 
GTACAAGCATTTGATAGACCAAGACGAGAAAGAGGATTCGAAGACTAAAAGAAAAGCAAC 
ATCAGAGCCCACAAAGAAGAAGAAAAAGAAGAAGTCTAAAGCATCAGAGTAAGAAGCAAG 
ACTTGTTGCTTGCTATGCAAGGCTCCTTATGTTGAGTATTATTATTATACTGTGTAACGC 
TGGAGATAGTCACTCCAATTTTGTGGCGTTTGTTTTGTATTTCTTTCTTCCTAATGTTTT 
CATCTTTGAAGAGAATAACTGTACGATTATGT
>AT3G23620.1 |  brix domain-containing protein 
AAAGTTGCTTCCAATTGTGAGGAGGCACTAAAACCCTAGACTCCATATCAATCAATCGAA 
AAACCTTTCTCTCTTCTTTCGGAGCCGTCGCTTGTGAAACTTTCCGGCGATTTAACAGAG 
TCATGATGGAAATACGAACTCCGAAGACTGGCAAAGCCAAGCGTGTTCTCGAAAGCCGAG 
CTCCTAAGTTGGTAAAGTTCTCTTCTTTTTCTCCTTCGTCCTTCTTAAAACCGAGAAGTG 
AATCATGTTGAGAGCTGTCTTCAATGTTGTTTTGACATCTATGAGACTCATGGGTTTTCT 
ATTTGTCGATAAATTTATCAAAGAATCGATTGAAAGTTGCAAACTTTGTATCTGAATTGG 
TTGTTTTTGGAATTTGTAGGTTGAAACTGGGAAGAAGACGTTGATACTTCATGGAACAAA 
GACGAGTGCTACACTTAGCTCTGTAATGACGGAACTCTACCGTTTGAAGAAGGGAGGTGC 
CATCAGATATTCAAGGAGGAATGAGAATATTAGGCCTTTCGAGAGTGGAGGTGAAACTTC 
ATTAGAGTTCTTCTCTCAGAAAACAGATTGTAGCATTTTTGTGGTAAGTTCATAAGCTTT 
GGCAGCTGTTGCATCTTGGTTTTATGGTGTTGCAACTTTGATTCTCCTCTTAACTTAGCT 
ATGAACTGCTAGATAGAACAAAATGTTATTAAGATGATCTATCCTGTGATCTAGATTCAT 
TCTAAGGCATCTCTGCTTCTGTCTTGTTAGTCTATGTGTATTTATTTATGGTGGAAATTG 
GTATGATTGGCTGATGTTATCACAGGCCTTAAGAAGTCATTTGGAAAGGTGTATTGGCAA 
ATTAACTTTGATGCGAGTTCTAACATTGGTGATTGTTTTTATATTGCAGTATGGTTCTCA 
CACGAAGAAACGACCTGACAATCTTGTACTTGGGAGAATGTATGATCACCAAGTCTATGA 
TCTTATAGAAGTTGGGATTGAGAACTTTAAATCCTTGCGGGCGTTTTCGTATGACAAGAA 
ATTCGCACCTCATGAAGGAACAAAGCCTTTCATTTGCTTTATTGGTGAAGGTTTTGAGAA 
TGTATCAGAGCTTAAGCATCTCAAAGAAGTCCTCACTGATCTTTTTCGTGGCGAGGTGAA 
GTGTTTGATTCTTATGACCTACTTTTGCAGCTAATTCCATAACCAGTTTCAATTTTATTC 
TGATTCTATATGGATTTGGCTTATAACAGAATTTGTATATGTCTGCAGGTTGTGGATAAT 
CTAAATCTTACTGGTTTAGACCGCGCTTACGTATGTTCAGCTATATCCCCAACAAAGGTT 
TTCCTTACTCATTGCGCATTGAAGCTTAAAAAGTCAGGATCCATTGTTCCGAGAATGGAG 
CTTGTTGAAGTCGGTCCATCCATGGACTTGGTTATCAGGCGTAATCGTCTTCCTAACGAT 
AGCTTAATGAAAGAAGCAATGAGAACATCCAAGGATAAGCCTAAGAAGAAGGTACTAAAC 
AACATAAAAGTCTAATATTTCTCTTAAAATCGAAAGAGACAGATGACTAATCAATCAATC 
TCTTCTTCTACAGGAGAAAAACGTTGATCAAGATGCAGTACTAGGGAAGACTGGGAAGAT 
TTATATGCCTGATCAGAAGGTAAGAAAGAAAGCGATAAACGCCAATATCCGAATCTGGAG 
ATTATTATTTTTATTATCATCCCAAACTGATATGTTTTCGATCTTTGTGCAGCTGAAAGA 
AATGAAACTGTTCGATAAATCTAAGGGATCGAAGAGAGAGCGGAAAGACGCTAAGCTTAA 
GCATAAGGAAGAGACTGTTGCCAAAAAGATGAAGGTGTCTTCTGAGTGACTCAACAGACC 
ACTCTTGGCTCTGCATCAACAGCTTTCAATATGTGGAAGATGAAATGATTTTGTAGTGTA 
ATGAGCTTGACTTTTATTTTTCCATTAGAATCTATAACTGAATGTTTTCTATACGCTAAT 
ATTTTATTAAGGTGATTTTGTTTTGTTAAAACTCTGCAGCAACAGAAACTGGATATGATA 
AAAACACATTTTTGTCTATCTCTGTTTCCTACTGCAGTACATGCGTAAGACAGCAACTTT 
TTTCCCGTGTTGAATGAGACCACAATTTTTGCC
>AT3G57150.1 |  NAP57 (Arabidopsis thaliana homologue of NAP57) pseudouridine synthase 
GCTACAACTTTTAACGCCTCCTCCTCCATTTTTCAAAACCCTAATCCGACCGGAGCCATG 
GCGGAGGTCGACATCTCACACTCGAAGAAGAAGAAGCAAGACAAAACGGAGAACGATGCC 
GCCGACACCGGAGACTACATGATCAAGCCACAGAGTTTCACTCCAGCCATCGACACTTCT 
CAGTGGCCCATCCTCCTCAAGAACTACGACCGCCTCAACGTCCGTACCGGTCACTACACT 
CCAATCAGCGCCGGTCACTCTCCTCTGAAACGTCCTCTTCAAGAGTATATCAGGTACGGT 
GTCATCAATCTCGATAAACCCGCGAACCCTTCTTCTCACGAGGTCGTTGCTTGGATTAAG 
CGTATCCTCCGTGTTGAGAAAACCGGTCACAGTGGTACTCTTGACCCAAAAGTCACTGGA 
AACCTCATTGTCTGTATTGACCGAGCCACACGGCTTGTGAAATCGCAGCAAGGTGCGGGT 
AAAGAGTACGTTTGTGTTGCTCGGCTTCACTCAGCTGTCCCTGATGTTGCTAAAGTAGCT 
AGAGCTCTTGAATCGCTCACTGGAGCTGTGTTTCAGAGGCCTCCTTTGATCTCTGCTGTT 
AAAAGACAGCTTAGGATTAGGACAATCTATGAAAGCAAGCTGCTTGAGTATGATGCTGAT 
AGGCATTTGGTTGTTTTCTGGGTTTCTTGTGAGGCGGGTACTTACATTAGGACTATGTGT 
GTTCACTTGGGTTTACTTCTTGGGGTTGGTGGGCATATGCAGGAGCTTAGGAGGGTTAGG 
TCTGGGATTTTGGGTGAGAATAATAACATGGTTACTATGCATGATGTGATGGATGCCCAA 
TTTGTGTATGACAACTCCAGAGATGAGTCTTATCTTAGGAGGGTGATTATGCCTCTTGAG 
ATGATATTGACGAGTTACAAGAGACTTGTTGTCAAGGATTCTGCTGTGAATGCTATCTGT 
TATGGTGCTAAGTTGATGATTCCTGGGTTGTTGAGATTCGAGAATGACATTGATGTTGGT 
ACTGAAGTCGTTCTTATGACTACCAAGGGTGAGGCGATTGCCGTTGGGATTGCTGAGATG 
ACAACATCTGTGATGGCTACTTGTGATCATGGTGTGGTAGCTAAGATCAAGCGTGTGGTG 
ATGGATAGAGATACCTACCCGAGGAAGTGGGGATTGGGACCAAGGGCTTCTATGAAGAAG 
AAGCTTATTGCTGATGGGAAATTGGATAAGCATGGGAAGCCTAATGAGAAGACTCCGGTT 
GAGTGGAGCAGGAATGTGGTTTTGCCTACCGGTGGAGATGCTATAATTGCTGGTGCTGCT 
GCTGCTCCTGAGGAGATAAAGGCTGACGCTGAGAATGGAGAAGCAGGGGAAGCGCGTAAG 
CGTAAGCATGATGATAGCAGTGATAGCCCTGCTCCTGTAACAACCAAGAAATCTAAAACC 
AAAGAAGTTGAAGGAGAAGAGGCTGAAGAGAAGGTGAAGTCTTCTAAGAAGAAGAAGAAG 
AAGGATAAGGAAGAGGAGAAAGAAGAGGAAGCCGGGTCTGAGAAGAAGGAAAAGAAGAAG 
AAGAAAGATAAGAAGGAGGAGGTTATAGAAGAGGTAGCTTCACCAAAGTCTGAGAAGAAG 
AAGAAAAAGAAGAGCAAAGACACCGAAGCTGCTGTTGACGCAGAAGATGAATCAGCAGCA 
GAGAAGAGTGAGAAGAAAAAGAAAAAGAAGGATAAGAAGAAGAAGAACAAAGACAGTGAG 
GATGATGAGGAATGAGATGGGTTTGCGTTATGGTGCTTTTTAAGTTTTGAACTCTTTTGA 
TTTTGCGGTATCTATCTACTCTGGAACAAAGTGAGACAAAAGGCATTTTATGCTTGTATT 
CTACGTCTCGCTTACGTTACCAGATTTTATGTTTTTGTAAGGTTAGTTTCAGTTCTAAGC 
AGATTCTCCCTTTAGTTATATGACTGTGGTCTCTCTCTCTGTTTTTGGTCTTTGCCCTTC 
TTGTCTGTCTGTTTGTCTGTTTGGCAACGAGGATAATAATAGACCTAAATCAGTATT
>AT3G56990.1 |  EDA7 (embryo sac development arrest 7) 
TTTTTGGCTTCAATTTTTGCGTTTTCTCTGCAACTCGCCGTCAAGGGTAGAAGAATTAGG 
GGTTCCTGTTCTTAACTGCTTGAAGATGACGTCTTATGGAGATAGACTGAAGTCGACCTC 
CATTAATGGAGTTAAGTTATACAATGTTTCTTCTGCTCCCAATGTTCCTACTTGGCTTAA 
TCCTAAGAAGCAACGAGCTCTCCGCAAAAACCCTCGTAAGTTTCACCTCTTGTTTCTGTC 
TCAGCTCTGAATCGTTAACCCCTTCATAAACCCTGTCTCTTAAAGGCTCGTCCTTTTTTT 
CTGTCTTCGATGTAAGATTATATGCAAAGAGTGGAGCTGATTCAGGAGTTGAAGTTTGAG 
ACTGCCACTACTAGAATCAAAGCGACTCCAGACGGAGAGTATCTGATTGCTTCAGGTGCG 
TTTTCTTTCTTTGTAACTTCGATGCTATTGACAAGAAATAATGTTCTCTTGTGACTTTTC 
ACTGATTTCGTTTTTGTTGAATTAGGCATATATCCACCACAGGTAAAAGTTTATGAGCTA 
AATCAGCTTGCTTTGAAGTTTGAGAGGCATTTGGACTCGGAAATAGTTGATTTCGAGGTA 
CCTTTTATTGCTCCATGAGATGTGTCTTAACACCATTGATAGTAACTATCTTGTTTCTGG 
TTTTTTAGTATTGTGTTTTGTTGGCTCTACAGATATTGGATGATGACTTCTCAAAGCTTG 
CCTTCTTATGTGCTGATCGTTCTATTAATTTACACGCCAAATACGGGAAACACCACACTT 
TACGAATTCCAAGGTACTTTAGCTTTGTTGGTCTATGAGATATATCTTTCGTGGTCTAAA 
GCATTCACATATTTGCAGGATGGGGAGAGATATGACATATGATTCCTGGTCTTGTGATCT 
TCTTTGCGCTGCTTCCTCACCTGATCTATATAGAATCAATTTGGAGCAGGTACTTTCCAG 
TGAATTTATAATAGTTTAGTGTTGTGACCTATCTCAGTCTTTGTTAGAGAATGATTTGTG 
TTTTTTGCCTTCTTTCTGTTTAGGGAAGATTTCTTTCTCCTCTCAGCACTCAATCCCCAG 
CGCTTAATGTCGTTTCTCGAAGGTCTGTATACCGAACTGTCTTTTCTTTCTATTATGTTT 
CTTGATTTCATCTAGGAGAAAATTCGATTCTGGTACTCTAGATTATTATTGCTTACATTT 
GAGCACTATTTTCTTTCCAGCAACCTCCATGGATTAGTTGCTTGTGGTGGTGAGGATGGT 
GCTGTGGAATTTTTTGATATGAGAATGAAATCATCTGCTGCTAGAATTAACGCGGTCACA 
CATGGTGGTGATGCTGCTGCGGTAATTTTTTCTAACTTGTGTTCCAAATAAACAGACTTT 
CTTAGCTTAGACGTCATGTGATTGGTGAAAATTGCATTGATTTCTGATGATCTTGTGCTT 
TAAATTGGCTAATAGGAGGTTACTGCTATAGAGTTTGATGACAGTGAAGGTCTTCAAGTA 
GCTGTCGGGAGTAGCGCGGGAAAGGTTTGATGCTATATTCATTTTTTTATCTGAAAGGTT 
TAAAACATTGGTAGGTCAATTTGATTATATAGATATGTTGTGTTGATTGTGCTGTTCGGT 
ATCTGCAGGTATTCATATACGACTTGCGTACTTCAACTCCCATAAGAGTGAAGGATCACA 
TGTAAGTCTTACTGTGTTTGTATTAACTCAAAATTCTTTGTATATGCTATATCGTTAGGT 
TATTTCCTCAGTGTTCATTGATTTTCTGCAAAACTTGCAGGTACGAGAGCCCAATTTTGA 
ATATTAAGTGGCAACGGACTCTTAATACTCAACAACCTAAGTTGATTACTACCGACAAAC 
ACATTGTTAGAATATGGGATCCAAACACGGTAAGCATCAGATAAGAACAGGTTTAACCTC 
ATAATTTTTTTGAAAAAACAAGAAATATGTCGAGATTTTTGATTCACCATATTCTGTTTT 
GTTATTTTCAATTTGTGTTTATCAGGGAGAAGGTATGACCAGCATTGAACCGACTCAAGG 
AGGAATAAACGACATTTGTGTGTTCCGTGGAAGCGGACTTATGCTTCTTGCTTTAGACTC 
TAGCCTAATCCCATCTTACTTCATACCTGAACTCGGTCCTGCCCCCAAATGGTGTTCTCC 
TCTTGAAAATCTAACGGTAAATTGAAAATTCTTCCTATCCTTTTACAGGTTTACCATTCC 
AGTGATGTCACCATTGTTACAAACACGTTTCTTGTGTTTAATATTGTTCTCAGGAAGAGT 
TGGAGGAAAGTGCACAGACAACTATTTATGATAATTACAAATTTTTGGCAATGGAAGATC 
TGGAGAAGTTGCAGCTAACTCATTTGATTGGAACAGATCTTTTGAAAGCATCTATGCATG 
GATATTTTATTAATTACCATTTGTACAAAAAGGTGAGTCCTTAACATTTTCATAATACTT 
ATACCATCAGAAAAGTCTTTTTTTTTTTTCGGGTCAAATTGGAATAGTCTCTATAATGTT 
TCTTCCTTTCTTTTTACAGGCTTTAGCAGTGATTGAACCTTTTGCATTTGATGATTACTT 
AGAACGTAGGAAGCAAGAGAAGTTAGAAGAGCAGCGTACGCAGAGAATCACAGTTAGTAT 
TTAAAACCTTAGCAGCTATACGTTCACCATTTGTTTGTTTACCGGCTACTTACATACACA 
TCTGTTTCTCTTGTGCTTCCTTCAGAAAAAGAGACGGTTGCCAAAGGTTAACCGAGACCT 
TGCAGCAAGGCTTCATGGGGACGAATCAGAGGAGGAAAATAAAACTGCCGAGGATGGGGA 
GGCCACCAAGAAAGTGCTGAAAAAGAAGAAACCCATACTTACTGACGAGCATTTCGTAGA 
TGGTCGGTTTGGTTCGATGTTCCAAAATCCGGTATTAACATATTCTTTTCAACTTTTTTT 
GTTTGATCTTTTTATTGCTCTATTTCACATCGTATCAAACGTATTCTTGGGAATCTCCTT 
TTGGTTTTCAGGACTTCCAAATTGATAAGGACTCATATGAATATGGTGTCCTACACCCTG 
TTGCTTCTTCGAAGAAGCAACCTTCTCTGTTAGATGAACACTTTGAAGCTGTATCAGATG 
ATGACGAGAACAGTGATTCTGATGCATCACAGCCTTCAGATGACGAGGCCGACGATGGAG 
ACGCAACTAGGCCAAGCAAGAAAGCGAGAACTCCGAAGTTAGTGTCTTTTGACTGCATTC 
CAGGATCTACATTTGACACATTCTATCTTGATTCTTTTGTTTTCTGATGTGGATGATTTG 
GTGTCAGGTTGTATGAAGTGAAAGATGAGCGGCATGCCGCAGCTTATCACAACCGCACTT 
CACTGGCTAAAGAAGATAGTCTTCCTATGGGCGAGCGTGTCAAGGCTATAGAGAACCGGC 
GTGGCAACTTTGGAGGCTCGAAAGATATCAAATTCGGTCCTGGAGGATCACGGGAGTTTT 
CTTTCAAGGCGAGAGGGTCATCAAAGTACAAAGAAGATAGAGACGATGAGTATGAAGATG 
GGCAAAGAAACAAGAGGAGAGGAGTTCAGTCTCTTGGACTGAAATCAACAAATATTAGAG 
GCGGTTTCAGAGGTAGAGGAGGTGGTGGTTTTAGAGGGAGAGGAGGCGGCGGTTCCCGGG 
GAAAAGGTGGCCGTGGTGGTGGGCGTGGAAGAGGCCGGCAATGATAAATGTAGCTTTTCA 
GGGGCTTTATTAGATTTGAAAAATGTGTCACCTACTATTGAGAATCTTGAAACTTAATTG 
ATCACATATACAATTTTGGAATATT
>AT5G37720.1 |  RNA and export factor-binding protein putative 
TTCTCTGCTAAATTCTGTCTGATCTAAAAAATCAACGAACACAAAACTCATCAAAGCTCC 
TCAAAACCCTAAACACAGTCTCTCCATCTTCTTCAATCTCTCTCTCGTTCGGATTCTCAT 
CTCTTCTTCTGGTAATTTCTTCTTCTTCTTCTTCTATCTTCTTGCGAACCATTCGTGCTC 
TTGAACCATCTTACTTGATTAATTTCGTTCTATTCTCATCTGCTTGCACGCAATTATTAG 
TTTTCGTTTCAATAACTATGACTAGGTTAATATAGGATATAGATCTAGGGTTTCAATCGA 
TGTTATGTTTGATTTGAGAACTATAGATTTCCCTCGTAAGTGATCTAGGGTTTATCTGAT 
TAGCTCTCAATCTGATTGGATTGATTTGTTTCTCATGAGCCTTTGTGTTTTTCTACACTG 
GGTAGCTCTAAAATTGCAATTTTGATTGAAATTTATTGTTTGGGTCATTAAGCTAGTGCT 
TGTTTGAGTTAGAAGATAAGCCAGTTTTATGATTATGATATGTTTTTCTTGTTCATGTTT 
TTGGTGGTAACTAAACACTCCTTCTCTAATTTATGCAGGTTTCAGATTGAGTCTTGTTAC 
TGTGTTTCATAAGACTATTGAAGTTAAGATGTCTGGAGCATTGAATATGACTCTTGATGA 
GATTGTTAAGAGGGGTAAAACTGCAAGGTCTGGGGGAAGAGGGATTTCTCGTGGGCGTGG 
TCGTGGACGTGGTGGTGGTGGAAGAGGAGCTGGACCTGCTAGAAGAGGTCCTCTTGCTGT 
GAATGCTCGTCCATCATCTTTCACCATTAACAAGGCAAGCTCAAAATCTGGGATCTTCTA 
TGTGTATGATTTGGAAATCTGAGTTTCTGTGAAGCATTTACTTCATCATACTATATCTAA 
ACGATGGGAGAAGCAGGTTTTCCTGTCCATGCGGAAAGCCTTACTTCTGATGATAGTTTG 
ACATTCTTTAGCATTGAGAACATCGCCTAGGAACATGCTTCTTTCTAGTTCATGGAGATG 
TTTTCATTTAGGAATGCCTCTTACCCCTGCAGTTTCAGTGTACTTTGTGGTTTATGTTGT 
TAATTGTGAGGACTTTGGCAGACAAGTTATTGGTTGCTTTTGCGACAGTACTTAGAACCT 
GAGGAGCTTCAGTAAGATGAAGATCAAAATTTGTTCTTCCAGTACAATTAGACATGTTGT 
GCATTTCCGTCACACAGTTTCAAATCCTCAAAAGATGTGTGGTGTTGTAGTAAATATAGT 
GACTTACCCTCCTAACCCCTACACAGTCTTAACTGTATCATGCATGAAGTTATTGATGAA 
CGTCCTGCTGCATTTGGAATTTCTTCAGCATGCTATGAGCGTCGGTTTTTCTTTTATCAT 
CATAGCCTTGGTACAAAGAATTTGTTTTGGAACCGGAGCATAGTCGGTCAAACTCATTGT 
TCCTCCATTTCATTTGGTTTTCTCATTGGGTGGTTCTTGACTACTCGGTGGAGCTCTTTG 
CTTTGACTGGGTTTCCCTCTTCCAGGCATATGGGTGGTCACTTCTTTGGAATTGTTTTTC 
ATTGACGCTGTTTTTGAAGTTCGACAGACATCTTGTACTGAAATGATTCTGTTCTATTGA 
ATAGCCTGTCCGTAGGGTCAGGAGCTTGCCATGGCAAAGCGGTTTGTTTGAAGATGGCCT 
AAGAGCTGCCGGGGCATCAGGAGTTGAAGTTGGAACCAGGCTCCATGTTACAAATCTGGA 
CCAGGGTGTGACAAATGAAGATATAAGGGTATAATCAGACTTCTATAATTTGTGCATTTG 
GTTTCTTAGAGGGGAGCCAGACACTAAAATGTATCTTCATGGGATCTAGGAACTCTTCTC 
TGAGATTGGGGAGGTAGAGCGTTATGCGATTCATTATGACAAAAATGGGCGTCCAAGTGT 
AAGTCCTCACAAATCTTTATCAGTCCCATTCTCTTCATGATTTTGAAAAAGTTTTATCTT 
GTATGCTCTTTCTAACAGGGATTTTGTTTTGTGCCATGTAACTATAGGGCACAGCTGAAG 
TGGTGTATCCAAGAAGAAGTGATGCATTTCAAGCTCTGAAGAAATATAACAATGTGCTAT 
TGGATGGAAGGCCAATGAGACTTGAGATTTTGGGTGGCAACAATTCTTCCGAGGCTCCTT 
TATCTGGTCGTGTGAATGTGAATGTCACTGGACTCAATGGAAGGCTGAAGAGGACGGTTG 
TTATCCAGTATGAATTTCTGTCTTTTCTTTTTGTTTTCTCAGTAATCGCATGAATAACTG 
TTGTGAGACTAAATCCAAGACTTACACAATCTTCTCTGATGCTTGTAGACAAGGAGGAGG 
AGGGAGAGGAAGAGTTAGAGGTGGGAGAGGAGGAAGAGGTCCAGCTCCTACTGTCAGTCG 
CCGCCTTCCAATGTAAGTATAAATCTGTTTCTCTTAATTCGTTTAGCGGAGAACCGAACT 
GAGATTTGTCAACTGCATTCCATATTAAACTGCATGGTCACAAAAGTTTTGTTCCTATTT 
TTGTGTAACCAAACCGAATAAATCAAAATTCGTAGTTAATTGATTTTCGTTTGTTTCGGT 
TAATGTTTTAATTTGCACTTGTTTTCTCTTGGTGGCAGTCATAACCAGCAGGGAGGAGGG 
ATGAGAGGAGGAAGAGGCGGGTTTCGTGCTAGAGGGCGTGGTAATGGTGGCCGTGGTCGT 
GGTGGTGGAAGAGGAAATGGAAAGAAGCCAGTGGAGAAGTCAGCTGCTGATCTTGACAAA 
GATCTTGAGAGCTATCACGCTGATGCCATGAACACCTCTTAAATCGTGTTGTGTTGTTCT 
TACTAAACTAGTTTCAGATGAAATCATGCTTCTCTTTTTTTCATGCTCTTCGTTGGTTTT 
GTTGGATGTTGATTGTAAAGTAAATGGAAGCCTTTTAGAATCTAGCTGTCTTAAATTTTC 
TTTTATATAAAGAGTGATTTAAAGTTACC
>AT5G37720.1 |  RNA and export factor-binding protein putative 
TTCTCTGCTAAATTCTGTCTGATCTAAAAAATCAACGAACACAAAACTCATCAAAGCTCC 
TCAAAACCCTAAACACAGTCTCTCCATCTTCTTCAATCTCTCTCTCGTTCGGATTCTCAT 
CTCTTCTTCTGGTAATTTCTTCTTCTTCTTCTTCTATCTTCTTGCGAACCATTCGTGCTC 
TTGAACCATCTTACTTGATTAATTTCGTTCTATTCTCATCTGCTTGCACGCAATTATTAG 
TTTTCGTTTCAATAACTATGACTAGGTTAATATAGGATATAGATCTAGGGTTTCAATCGA 
TGTTATGTTTGATTTGAGAACTATAGATTTCCCTCGTAAGTGATCTAGGGTTTATCTGAT 
TAGCTCTCAATCTGATTGGATTGATTTGTTTCTCATGAGCCTTTGTGTTTTTCTACACTG 
GGTAGCTCTAAAATTGCAATTTTGATTGAAATTTATTGTTTGGGTCATTAAGCTAGTGCT 
TGTTTGAGTTAGAAGATAAGCCAGTTTTATGATTATGATATGTTTTTCTTGTTCATGTTT 
TTGGTGGTAACTAAACACTCCTTCTCTAATTTATGCAGGTTTCAGATTGAGTCTTGTTAC 
TGTGTTTCATAAGACTATTGAAGTTAAGATGTCTGGAGCATTGAATATGACTCTTGATGA 
GATTGTTAAGAGGGGTAAAACTGCAAGGTCTGGGGGAAGAGGGATTTCTCGTGGGCGTGG 
TCGTGGACGTGGTGGTGGTGGAAGAGGAGCTGGACCTGCTAGAAGAGGTCCTCTTGCTGT 
GAATGCTCGTCCATCATCTTTCACCATTAACAAGGCAAGCTCAAAATCTGGGATCTTCTA 
TGTGTATGATTTGGAAATCTGAGTTTCTGTGAAGCATTTACTTCATCATACTATATCTAA 
ACGATGGGAGAAGCAGGTTTTCCTGTCCATGCGGAAAGCCTTACTTCTGATGATAGTTTG 
ACATTCTTTAGCATTGAGAACATCGCCTAGGAACATGCTTCTTTCTAGTTCATGGAGATG 
TTTTCATTTAGGAATGCCTCTTACCCCTGCAGTTTCAGTGTACTTTGTGGTTTATGTTGT 
TAATTGTGAGGACTTTGGCAGACAAGTTATTGGTTGCTTTTGCGACAGTACTTAGAACCT 
GAGGAGCTTCAGTAAGATGAAGATCAAAATTTGTTCTTCCAGTACAATTAGACATGTTGT 
GCATTTCCGTCACACAGTTTCAAATCCTCAAAAGATGTGTGGTGTTGTAGTAAATATAGT 
GACTTACCCTCCTAACCCCTACACAGTCTTAACTGTATCATGCATGAAGTTATTGATGAA 
CGTCCTGCTGCATTTGGAATTTCTTCAGCATGCTATGAGCGTCGGTTTTTCTTTTATCAT 
CATAGCCTTGGTACAAAGAATTTGTTTTGGAACCGGAGCATAGTCGGTCAAACTCATTGT 
TCCTCCATTTCATTTGGTTTTCTCATTGGGTGGTTCTTGACTACTCGGTGGAGCTCTTTG 
CTTTGACTGGGTTTCCCTCTTCCAGGCATATGGGTGGTCACTTCTTTGGAATTGTTTTTC 
ATTGACGCTGTTTTTGAAGTTCGACAGACATCTTGTACTGAAATGATTCTGTTCTATTGA 
ATAGCCTGTCCGTAGGGTCAGGAGCTTGCCATGGCAAAGCGGTTTGTTTGAAGATGGCCT 
AAGAGCTGCCGGGGCATCAGGAGTTGAAGTTGGAACCAGGCTCCATGTTACAAATCTGGA 
CCAGGGTGTGACAAATGAAGATATAAGGGTATAATCAGACTTCTATAATTTGTGCATTTG 
GTTTCTTAGAGGGGAGCCAGACACTAAAATGTATCTTCATGGGATCTAGGAACTCTTCTC 
TGAGATTGGGGAGGTAGAGCGTTATGCGATTCATTATGACAAAAATGGGCGTCCAAGTGT 
AAGTCCTCACAAATCTTTATCAGTCCCATTCTCTTCATGATTTTGAAAAAGTTTTATCTT 
GTATGCTCTTTCTAACAGGGATTTTGTTTTGTGCCATGTAACTATAGGGCACAGCTGAAG 
TGGTGTATCCAAGAAGAAGTGATGCATTTCAAGCTCTGAAGAAATATAACAATGTGCTAT 
TGGATGGAAGGCCAATGAGACTTGAGATTTTGGGTGGCAACAATTCTTCCGAGGCTCCTT 
TATCTGGTCGTGTGAATGTGAATGTCACTGGACTCAATGGAAGGCTGAAGAGGACGGTTG 
TTATCCAGTATGAATTTCTGTCTTTTCTTTTTGTTTTCTCAGTAATCGCATGAATAACTG 
TTGTGAGACTAAATCCAAGACTTACACAATCTTCTCTGATGCTTGTAGACAAGGAGGAGG 
AGGGAGAGGAAGAGTTAGAGGTGGGAGAGGAGGAAGAGGTCCAGCTCCTACTGTCAGTCG 
CCGCCTTCCAATGTAAGTATAAATCTGTTTCTCTTAATTCGTTTAGCGGAGAACCGAACT 
GAGATTTGTCAACTGCATTCCATATTAAACTGCATGGTCACAAAAGTTTTGTTCCTATTT 
TTGTGTAACCAAACCGAATAAATCAAAATTCGTAGTTAATTGATTTTCGTTTGTTTCGGT 
TAATGTTTTAATTTGCACTTGTTTTCTCTTGGTGGCAGTCATAACCAGCAGGGAGGAGGG 
ATGAGAGGAGGAAGAGGCGGGTTTCGTGCTAGAGGGCGTGGTAATGGTGGCCGTGGTCGT 
GGTGGTGGAAGAGGAAATGGAAAGAAGCCAGTGGAGAAGTCAGCTGCTGATCTTGACAAA 
GATCTTGAGAGCTATCACGCTGATGCCATGAACACCTCTTAAATCGTGTTGTGTTGTTCT 
TACTAAACTAGTTTCAGATGAAATCATGCTTCTCTTTTTTTCATGCTCTTCGTTGGTTTT 
GTTGGATGTTGATTGTAAAGTAAATGGAAGCCTTTTAGAATCTAGCTGTCTTAAATTTTC 
TTTTATATAAAGAGTGATTTAAAGTTACC
>AT5G37720.2 |  RNA and export factor-binding protein putative 
TTCTCTGCTAAATTCTGTCTGATCTAAAAAATCAACGAACACAAAACTCATCAAAGCTCC 
TCAAAACCCTAAACACAGTCTCTCCATCTTCTTCAATCTCTCTCTCGTTCGGATTCTCAT 
CTCTTCTTCTGGTAATTTCTTCTTCTTCTTCTTCTATCTTCTTGCGAACCATTCGTGCTC 
TTGAACCATCTTACTTGATTAATTTCGTTCTATTCTCATCTGCTTGCACGCAATTATTAG 
TTTTCGTTTCAATAACTATGACTAGGTTAATATAGGATATAGATCTAGGGTTTCAATCGA 
TGTTATGTTTGATTTGAGAACTATAGATTTCCCTCGTAAGTGATCTAGGGTTTATCTGAT 
TAGCTCTCAATCTGATTGGATTGATTTGTTTCTCATGAGCCTTTGTGTTTTTCTACACTG 
GGTAGCTCTAAAATTGCAATTTTGATTGAAATTTATTGTTTGGGTCATTAAGCTAGTGCT 
TGTTTGAGTTAGAAGATAAGCCAGTTTTATGATTATGATATGTTTTTCTTGTTCATGTTT 
TTGGTGGTAACTAAACACTCCTTCTCTAATTTATGCAGGTTTCAGATTGAGTCTTGTTAC 
TGTGTTTCATAAGACTATTGAAGTTAAGATGTCTGGAGCATTGAATATGACTCTTGATGA 
GATTGTTAAGAGGGGTAAAACTGCAAGGTCTGGGGGAAGAGGGATTTCTCGTGGGCGTGG 
TCGTGGACGTGGTGGTGGTGGAAGAGGAGCTGGACCTGCTAGAAGAGGTCCTCTTGCTGT 
GAATGCTCGTCCATCATCTTTCACCATTAACAAGGCAAGCTCAAAATCTGGGATCTTCTA 
TGTGTATGATTTGGAAATCTGAGTTTCTGTGAAGCATTTACTTCATCATACTATATCTAA 
ACGATGGGAGAAGCAGGTTTTCCTGTCCATGCGGAAAGCCTTACTTCTGATGATAGTTTG 
ACATTCTTTAGCATTGAGAACATCGCCTAGGAACATGCTTCTTTCTAGTTCATGGAGATG 
TTTTCATTTAGGAATGCCTCTTACCCCTGCAGTTTCAGTGTACTTTGTGGTTTATGTTGT 
TAATTGTGAGGACTTTGGCAGACAAGTTATTGGTTGCTTTTGCGACAGTACTTAGAACCT 
GAGGAGCTTCAGTAAGATGAAGATCAAAATTTGTTCTTCCAGTACAATTAGACATGTTGT 
GCATTTCCGTCACACAGTTTCAAATCCTCAAAAGATGTGTGGTGTTGTAGTAAATATAGT 
GACTTACCCTCCTAACCCCTACACAGTCTTAACTGTATCATGCATGAAGTTATTGATGAA 
CGTCCTGCTGCATTTGGAATTTCTTCAGCATGCTATGAGCGTCGGTTTTTCTTTTATCAT 
CATAGCCTTGGTACAAAGAATTTGTTTTGGAACCGGAGCATAGTCGGTCAAACTCATTGT 
TCCTCCATTTCATTTGGTTTTCTCATTGGGTGGTTCTTGACTACTCGGTGGAGCTCTTTG 
CTTTGACTGGGTTTCCCTCTTCCAGGCATATGGGTGGTCACTTCTTTGGAATTGTTTTTC 
ATTGACGCTGTTTTTGAAGTTCGACAGACATCTTGTACTGAAATGATTCTGTTCTATTGA 
ATAGCCTGTCCGTAGGGTCAGGAGCTTGCCATGGCAAAGCGGTTTGTTTGAAGATGGCCT 
AAGAGCTGCCGGGGCATCAGGAGTTGAAGTTGGAACCAGGCTCCATGTTACAAATCTGGA 
CCAGGGTGTGACAAATGAAGATATAAGGGTATAATCAGACTTCTATAATTTGTGCATTTG 
GTTTCTTAGAGGGGAGCCAGACACTAAAATGTATCTTCATGGGATCTAGGAACTCTTCTC 
TGAGATTGGGGAGGTAGAGCGTTATGCGATTCATTATGACAAAAATGGGCGTCCAAGTGT 
AAGTCCTCACAAATCTTTATCAGTCCCATTCTCTTCATGATTTTGAAAAAGTTTTATCTT 
GTATGCTCTTTCTAACAGGGATTTTGTTTTGTGCCATGTAACTATAGGGCACAGCTGAAG 
TGGTGTATCCAAGAAGAAGTGATGCATTTCAAGCTCTGAAGAAATATAACAATGTGCTAT 
TGGATGGAAGGCCAATGAGACTTGAGATTTTGGGTGGCAACAATTCTTCCGAGGCTCCTT 
TATCTGGTCGTGTGAATGTGAATGTCACTGGACTCAATGGAAGGCTGAAGAGGACGGTTG 
TTATCCAGTATGAATTTCTGTCTTTTCTTTTTGTTTTCTCAGTAATCGCATGAATAACTG 
TTGTGAGACTAAATCCAAGACTTACACAATCTTCTCTGATGCTTGTAGACAAGGAGGAGG 
AGGGAGAGGAAGAGTTAGAGGTGGGAGAGGAGGAAGAGGTCCAGCTCCTACTGTCAGTCG 
CCGCCTTCCAATGTAAGTATAAATCTGTTTCTCTTAATTCGTTTAGCGGAGAACCGAACT 
GAGATTTGTCAACTGCATTCCATATTAAACTGCATGGTCACAAAAGTTTTGTTCCTATTT 
TTGTGTAACCAAACCGAATAAATCAAAATTCGTAGTTAATTGATTTTCGTTTGTTTCGGT 
TAATGTTTTAATTTGCACTTGTTTTCTCTTGGTGGCAGTCATAACCAGCAGGGAGGAGGG 
ATGAGAGGAGGAAGAGGCGGGTTTCGTGCTAGAGGGCGTGGTAATGGTGGCCGTGGTCGT 
GGTGGTGGAAGAGGAAATGGAAAGAAGCCAGTGGAGAAGTCAGCTGCTGATCTTGACAAA 
GATCTTGAGAGCTATCACGCTGATGCCATGAACACCTCTTAAATCGTGTTGTGTTGTTCT 
TACTAAACTAGTTTCAGATGAAATCATGCTTCTCTTTTTTTCATGCTCTTCGTTGGTTTT 
GTTGGATGTTGATTGTAAAGTAAATGGAAGCCTTTTAGAATCTAGCTGTCTTAAATTTTC 
TTTTATATAAAGAGTGATTTAAAGTTACC
>AT5G37720.2 |  RNA and export factor-binding protein putative 
TTCTCTGCTAAATTCTGTCTGATCTAAAAAATCAACGAACACAAAACTCATCAAAGCTCC 
TCAAAACCCTAAACACAGTCTCTCCATCTTCTTCAATCTCTCTCTCGTTCGGATTCTCAT 
CTCTTCTTCTGGTAATTTCTTCTTCTTCTTCTTCTATCTTCTTGCGAACCATTCGTGCTC 
TTGAACCATCTTACTTGATTAATTTCGTTCTATTCTCATCTGCTTGCACGCAATTATTAG 
TTTTCGTTTCAATAACTATGACTAGGTTAATATAGGATATAGATCTAGGGTTTCAATCGA 
TGTTATGTTTGATTTGAGAACTATAGATTTCCCTCGTAAGTGATCTAGGGTTTATCTGAT 
TAGCTCTCAATCTGATTGGATTGATTTGTTTCTCATGAGCCTTTGTGTTTTTCTACACTG 
GGTAGCTCTAAAATTGCAATTTTGATTGAAATTTATTGTTTGGGTCATTAAGCTAGTGCT 
TGTTTGAGTTAGAAGATAAGCCAGTTTTATGATTATGATATGTTTTTCTTGTTCATGTTT 
TTGGTGGTAACTAAACACTCCTTCTCTAATTTATGCAGGTTTCAGATTGAGTCTTGTTAC 
TGTGTTTCATAAGACTATTGAAGTTAAGATGTCTGGAGCATTGAATATGACTCTTGATGA 
GATTGTTAAGAGGGGTAAAACTGCAAGGTCTGGGGGAAGAGGGATTTCTCGTGGGCGTGG 
TCGTGGACGTGGTGGTGGTGGAAGAGGAGCTGGACCTGCTAGAAGAGGTCCTCTTGCTGT 
GAATGCTCGTCCATCATCTTTCACCATTAACAAGGCAAGCTCAAAATCTGGGATCTTCTA 
TGTGTATGATTTGGAAATCTGAGTTTCTGTGAAGCATTTACTTCATCATACTATATCTAA 
ACGATGGGAGAAGCAGGTTTTCCTGTCCATGCGGAAAGCCTTACTTCTGATGATAGTTTG 
ACATTCTTTAGCATTGAGAACATCGCCTAGGAACATGCTTCTTTCTAGTTCATGGAGATG 
TTTTCATTTAGGAATGCCTCTTACCCCTGCAGTTTCAGTGTACTTTGTGGTTTATGTTGT 
TAATTGTGAGGACTTTGGCAGACAAGTTATTGGTTGCTTTTGCGACAGTACTTAGAACCT 
GAGGAGCTTCAGTAAGATGAAGATCAAAATTTGTTCTTCCAGTACAATTAGACATGTTGT 
GCATTTCCGTCACACAGTTTCAAATCCTCAAAAGATGTGTGGTGTTGTAGTAAATATAGT 
GACTTACCCTCCTAACCCCTACACAGTCTTAACTGTATCATGCATGAAGTTATTGATGAA 
CGTCCTGCTGCATTTGGAATTTCTTCAGCATGCTATGAGCGTCGGTTTTTCTTTTATCAT 
CATAGCCTTGGTACAAAGAATTTGTTTTGGAACCGGAGCATAGTCGGTCAAACTCATTGT 
TCCTCCATTTCATTTGGTTTTCTCATTGGGTGGTTCTTGACTACTCGGTGGAGCTCTTTG 
CTTTGACTGGGTTTCCCTCTTCCAGGCATATGGGTGGTCACTTCTTTGGAATTGTTTTTC 
ATTGACGCTGTTTTTGAAGTTCGACAGACATCTTGTACTGAAATGATTCTGTTCTATTGA 
ATAGCCTGTCCGTAGGGTCAGGAGCTTGCCATGGCAAAGCGGTTTGTTTGAAGATGGCCT 
AAGAGCTGCCGGGGCATCAGGAGTTGAAGTTGGAACCAGGCTCCATGTTACAAATCTGGA 
CCAGGGTGTGACAAATGAAGATATAAGGGTATAATCAGACTTCTATAATTTGTGCATTTG 
GTTTCTTAGAGGGGAGCCAGACACTAAAATGTATCTTCATGGGATCTAGGAACTCTTCTC 
TGAGATTGGGGAGGTAGAGCGTTATGCGATTCATTATGACAAAAATGGGCGTCCAAGTGT 
AAGTCCTCACAAATCTTTATCAGTCCCATTCTCTTCATGATTTTGAAAAAGTTTTATCTT 
GTATGCTCTTTCTAACAGGGATTTTGTTTTGTGCCATGTAACTATAGGGCACAGCTGAAG 
TGGTGTATCCAAGAAGAAGTGATGCATTTCAAGCTCTGAAGAAATATAACAATGTGCTAT 
TGGATGGAAGGCCAATGAGACTTGAGATTTTGGGTGGCAACAATTCTTCCGAGGCTCCTT 
TATCTGGTCGTGTGAATGTGAATGTCACTGGACTCAATGGAAGGCTGAAGAGGACGGTTG 
TTATCCAGTATGAATTTCTGTCTTTTCTTTTTGTTTTCTCAGTAATCGCATGAATAACTG 
TTGTGAGACTAAATCCAAGACTTACACAATCTTCTCTGATGCTTGTAGACAAGGAGGAGG 
AGGGAGAGGAAGAGTTAGAGGTGGGAGAGGAGGAAGAGGTCCAGCTCCTACTGTCAGTCG 
CCGCCTTCCAATGTAAGTATAAATCTGTTTCTCTTAATTCGTTTAGCGGAGAACCGAACT 
GAGATTTGTCAACTGCATTCCATATTAAACTGCATGGTCACAAAAGTTTTGTTCCTATTT 
TTGTGTAACCAAACCGAATAAATCAAAATTCGTAGTTAATTGATTTTCGTTTGTTTCGGT 
TAATGTTTTAATTTGCACTTGTTTTCTCTTGGTGGCAGTCATAACCAGCAGGGAGGAGGG 
ATGAGAGGAGGAAGAGGCGGGTTTCGTGCTAGAGGGCGTGGTAATGGTGGCCGTGGTCGT 
GGTGGTGGAAGAGGAAATGGAAAGAAGCCAGTGGAGAAGTCAGCTGCTGATCTTGACAAA 
GATCTTGAGAGCTATCACGCTGATGCCATGAACACCTCTTAAATCGTGTTGTGTTGTTCT 
TACTAAACTAGTTTCAGATGAAATCATGCTTCTCTTTTTTTCATGCTCTTCGTTGGTTTT 
GTTGGATGTTGATTGTAAAGTAAATGGAAGCCTTTTAGAATCTAGCTGTCTTAAATTTTC 
TTTTATATAAAGAGTGATTTAAAGTTACC
>AT3G05060.1 |  SAR DNA-binding protein putative 
ACTCTTAAAACCCTAAGTGATTGTCCGTCTCCGTCTTCATCTTCTTCCTCTCTCTCACGC 
AGCTGCTTTGATTAACTCTTCAGGTATTTAATATCTCTCATCTTCTCTCTTCACGGTGTT 
TCACTTTTCCATTCTTGCTGGAGATTGTGGAGTTTCGAATACTCATACTCGGACAGAGTT 
TTAAGGCTATTGTAGTTTATCTCTCTGTTTTTTCTTCTCCTGTATTTCTTATGTGATCTA 
AAAGTAGGATTAGGGTTTATATGGAATGCTGTTTCTCGCTAGTTTTTAATCTCAAAACGA 
ACTTTTAGTTTAATTAGTGTGACTCGGACACGTATCTTTACTGTTCTGAGTTAAGTGTTG 
TCTTAATTTTCTCTTCAGGTCCAGCTTAAGAGTTTTGTGAAGATGGTCTTAGTGCTATAC 
GAGACAGCGGCGGGGTTTGCCCTCTTTAAAGTTAAAGATGAAGGAAAGATGGCTAACGTC 
GAGGTGAGTTCTCTTCATTCTTTTGTACTCTCTTTGCTTATCCTTAAGGCTCTAAAAGTA 
TTCATGGATTATTTTTTATTTTTTTTTGCAGGATTTGTGTAAAGAGTTCGACACTCCAGA 
CTCAGCACGAAAGGTAATTTTTTTGCTTCTTCATCAAGTGTGGTTTCAGAACATCTAAAA 
TTAGATTTAGTGTTGAGTTTCTCATATGTTTTTATTGGTGTACCAGATGGTTAAGCTAAA 
AGCTTTTGAGAAGTTTGACAATACATCTGAAGCTCTCGAAGCTGTGGCTAAATTGCTGGA 
GGGAGCTCCAAGCAAAGGTCTGCGCAAGTTTTTGAAAGCTAATTGTCAAGGTGAAACCTT 
GGCTGTGGCTGATTCAAAGCTTGGGAATGTTATCAAGGAGAAACTGGTTTGTAATTCCCA 
TCATTACACCCATATTCCTGTCTGCTCTGTGTTTTGTTTCTAATGAAAGTTCTTAATTTC 
ATACAGAAAATTGATTGCATTCACAACAATGCTGTTATGGAGCTTCTACGTGGTGTTAGA 
AGTCAGTTTACTGAACTCATATCTGGGTTGGGTGATCAAGACTTGGCTCCTATGAGCTTG 
GGTCTGTCTCACAGTCTCGCCAGATATAAGCTAAAGTTTAGTTCTGACAAGGTATCTTCG 
GTTCCTGACTAATTGTATTGGTCTTTTTATTTGGTGATATGATATGTGAAGTATATGAAT 
TTGTTAATTGATCGAAGCTAACTTGTGTTAAATTATGGAACTTCTGTATTGAACTAGCCT 
TTGATTGTCCGACATTAAACGTTTCCTGTGTTTGTTTTTGCTTCTCTTGCATCTCCTAAC 
TGTTTAGTTTTTGTCAGGTGGATACCATGATTATCCAAGCTATTGGTCTGCTTGATGATC 
TTGACAAAGAGCTGAACACATACGCCATGAGGGTTAGAGAATGGTATGGATGGCATTTTC 
CCGAGCTTGCTAAGATCATATCAGACAATATCCTATATGCCAAATCTGTTAAATTGATGG 
GAAACCGAGTTAATGCTGCTAAGCTAGACTTCTCCGAGGTAACTTTCAATTTTGTAAACT 
GTGTAGAGGCTTCCATGAACAAACGCCTTGATTAACGACCTAATATTCTCCTGTTTCTGG 
TTTCATTGTAGATCTTAGCAGATGAAATTGAGGCAGATCTTAAGGACGCAGCTGTGATAT 
CCATGGGAACAGAAGTCAGTGACTTAGACTTGTTGCACATCCGTGAACTCTGTGACCAGG 
TTCTCTCTCTTTCTGAGTACAGAGCTCAGCTTTACGATTACCTAAAGAGCAGAATGAACA 
CTATTGCTCCCAATCTGACTGCCCTGGTAGGAGAGCTTGTTGGTGCTCGTCTTATTTCCC 
ATGGAGGTAGTTTATTGAACCTCTCCAAGCAACCTGGGAGCACGGTTCAGATACTCGGAG 
CCGAAAAAGCTCTCTTTAGAGCTCTTAAGACAAAACACGCCACACCCAAGTACGGTTTGA 
TTTTTCACGCATCTCTGGTTGGTCAAGCAGCACCAAAGCACAAGGGAAAGATCTCGCGGT 
CTTTAGCTGCTAAAACTGTTCTTGCTATTAGGGTTGATGCTCTTGGTGATAGCCAAGATA 
ACACTATGGGCCTTGAAAACCGAGCTAAGGTAACAAAATTCTTCAATAGCTTTCCTCTTG 
TTGGTATCTCTCTGAACAATCTTTTTTCCTCCTTCTTAACTGATGATGTTTCTGATATGT 
GTTAAAAACTCACAGCTTGAAGCGCGGTTGAGAAATCTTGAAGGAAAAGATTTAGGTCGT 
CTGTCTGGTTCATCTAAAGGCAAACCTAAGATTGAAGTCTATAACAAGGATAAAAAGATG 
GGATCAGGCGGTCTTATCACTCCTGCTAAGGTCACGATCATTCTCTCTGTTTTTGATTCA 
TCATCTTTTCTTCTAATTTTGGATGTGTGTACATATTGTCTTTGTTCTTGGGATTATGAT 
GAAGTGATCTTGACTGTTTTTTGTTATGTGCAGACTTACAACACTGCTGCAGATTCTCTT 
CTTGGGGAAACCTCAGCTAAATCTGAGGAGCCATCAAAGAAGAAAGATAAGAAAAAGAAG 
AAGAAGGTAGAAGAAGAGAAACCCGAAGAGGAAGAGCCATCAGAGAAAAAGAAGAAGAAG 
AAAGCTGAAGCAGAAACTGAAGCCGTAGTAGAGGTTGCAAAGGAGGAGAAGAAGAAGAAT 
AAGAAGAAGAGAAAGCATGAGGAAGAAGAAACAACGGAGACACCAGCCAAGAAGAAGGAT 
AAGAAAGAGAAGAAAAAGAAGAGTAAGGACTGAGGGAGAGAAACCGATTTTGAGAAATCT 
CTTGAGTGTAAGATTAATAACTGTTTTTGTTGAATTGCATTTTATCTAGAGGAATAGGTG 
TTTTAAGATGAAACTTAAATTTTCTGAAATCGTCATTTTGAATGATGGATTCATATTTAA 
ATCCTTTTCACCCGAACTTTATTTTTGTTCTAGCCTTCCAGACTCTAGATTATTAATTTT 
GGAACTCTTTTTTCAATTTATAGTTTGTAGTTGTACAATATTCTTCTTGCATGATTTATA 
TATATCTGGAAGAGGAAAGAATTGAAGAAAAATAATATAT
>AT1G17980.2 |  nucleotidyltransferase family protein 
TCTCATTCTTTGCGACGGTGACCCGACAAGATTATTGCCGGGAAACAGACCGAGAAGATT 
AAGCGTAAGATTCTCAACGAATGTTGGAGAAGGAATCTGATTTGACTGCAACGGAGAAAC 
CAAATAACAAGCACGCGGCTGATTCGTTTTCCAGCGAGGATTTGGTCTCACGCGGAGAAA 
CCAAATAACAAGCACGCGGAGATCAATTATTTTTATTTTCGTAGAATCTGATTGAAATAT 
TAAGAAAAAAGAGAAAAAAGAGAGGAAAAGAGCAAAGTAAGTAGGATAGATGGCTAGTGT 
CCAGCAAAATGGGCAACGGTTTGGCGTTTCAGAACCTATCTCTATGGGAGGACCAACGGA 
GTTTGATGTGATCAAGACAAGAGAGCTCGAGAAGGTTTTACTGATATCTTAATGCTTTTT 
TCTTGTAATGCTTTATTGTTTTAGTTTTAAAGTTTACTCATGATATACTTCTTAGTTTTA 
TACTGATTGATAGTATATTGAGTTGTGTTATTTGGTTGTTCAGCACTTGCAAGATGTTGG 
ATTGTACGAGAGCAAGGAGGAAGCTGTTAGAAGGGAGGAGGTTCTGGGGATACTAGATCA 
GGTTTTGTAGTACTTTTGAATCCTAAGAACTTGTGCTTATGGAGTTTTCATCGATGTTAG 
TAACGAACTCTTGATAAATCTTCGTTGTTGATGTGTCCAGATTGTAAAAACATGGATTAA 
AACAATCAGCCGCGCCAAAGGGTTGAATGATCAGCTGCTTCATGAGGCGAATGCAAAGAT 
ATTTACTTTCGGTTCTTATCGACTAGGGGTAATGATTAAGATCTATAGAAGATTTAGCTT 
TGTTTTAGTCATTCTTCTTGTATTGCGAAGTAGAGGGAAAGGGAACAATGTGAATTGGTG 
GAAACTGTGTTTTGTTTCTGTTGTCTTGTCTTGTGAGACGTCCCTGAGTGGGAAGTGGAA 
TCACTCGTCTTTACATGCTCTTTGCATTCATTTAAACATATTGAGGTCTCAATGTTATAT 
ATGTCACTTGAATCATATCTAACTGAGCTTTTCAGTCATTTTAATTATTGGTAAATCTTA 
GACACAATAGGGGGCTATTTATGGTTGCAATTGGTTCTTGGAGAGAATTCAGAGTCCTAA 
AGAGTTCCTTCTCTCCGATTTCTAGCATATTGAGTGCTCCTATAACAGTTCGTTTTACTT 
CTTCAAATAGGTACATGGACCTGGTGCTGATATAGACACTTTATGTGTGGGACCTAGACA 
TGCAACTAGAGAAGTACTATAACCTCTTGCATCTATATGTTGGCTGATTATTTCTTCTGT 
CAATTTATTGTGTTCAATATTCATCTTTATATTTTCCATTAGGGTGATTTCTTTGGTGAG 
CTACAAAGAATGCTGTCAGAAATGCCGGAAGTAACTGAACTGCACCCTGTGCCTGATGCT 
CATGTTCCATTGATGGGATTCAAACTTAATGGAGTTTCTATAGATCTCCTTTATGCACAA 
CTTCCACTCTGGGTTATACCTGAGGTAATTTCTTGTCCACAATGAGGTGATTGTTAGTGA 
GGACTAGGAAATTCGTAGATAAGTATGTTTTAACTTATCGAATTGAACCTCACTAAACTC 
ATCCTTACTGATTACAATCAATTAGTTTCACTCTATTACACAGTTTACATTATGTTCATG 
AATTTAAATGAATGTTATGAGTGGATCTCGTAGAAAATAGGTAATCTGAACCTGGAGCTC 
TGGTCCTGTTCCTCTTATGGAGGCTTAAATGTGTTCCCTGCCTGATGTTAATGGTGCAGG 
ACTTAGATTTATCACAGGACTCCATTCTACAGAATGCTGATGAGCAAACTGTTCGAAGTC 
TCAACGGTTGTAGAGTTACTGACCAAATCTTGCGTCTGGTTCCAAACATTCAGGTTTCGT 
GCTCACTGACCATAAATCTCTTATCTTCTAAAATTTAATTACTCATCCATATGATTTGCT 
TAGCCTGAGTACATGTTTTTTTCTTTGTTTCTGAGCAGAATTTCAGAACAACATTAAGAT 
GCATGAGATTTTGGGCCAAACGACGTGGAGTATACTCTAATGTATGGAGAATTCTTCTAT 
AATGCTCTTCTATTTTTTATGTGACTATCATGTTGCTTAAGTAAAGTATCTTTCTGACAA 
TTGCTAGGTCTCGGGATTTCTTGGTGGTATAAACTGGGCATTGCTTGTAGCTCGGATATG 
TCAACTTTATCCTAACGCCCTCCCTAATATTTTAGTGTCTCGGTTCTTTAGGGTCTTCTA 
TCAATGGAATTGGCCGAACGCCATTTTTCTTTGTTCTCCGGATGAAGGATCCCTTGGTCT 
TCAAGTTTGGGATCCTAGAATAAACCCAAAGGATCGGTTGCATATAATGCCCATCATTAC 
TCCTGCTTATCCTTGTATGAACTCTAGTTACAATGTCTCTGAAAGTACATTGCGGATTAT 
GAAAGGAGAGTTTCAGAGAGGAAACGAAATATGTGAGGTAAGATTTCGATAAGTCCAAAT 
AGTTGGCTTCTATGCAGATTCATGGACTTATTACAACGGCTTGATGTCTTGCAGGCTATG 
GAATCAAACAAAGCTGACTGGGATACCCTTTTTGAGCCATTTGCATTCTTTGAAGCGTAT 
AAAAACTATCTACAGATAGACATTTCTGCTGCAAATGTCGATGATCTAAGAAAATGGAAA 
GGCTGGGTTGAGTCACGCCTCCGCCAGCTCACACTGAAGGTGAAAAGCCATGTTTACTTT 
AACTTGAATAGTTTCTCTTGATTTTGCTTTGCTAATGATTTGTCTTGGATGTTTGCATTG 
TAATCTTAGATCGAGAGACATTTTAAAATGCTTCATTGCCACCCTCATCCCCATGATTTT 
CAAGACACATCCCGGCCACTCCATTGCTCTTACTTCATGGGTCTGCAACGTAAACAAGGA 
GTTCCAGCAGCAGAAGGCGAGCAATTCGATATCAGAAGAACCGTTGAGGAGTTTAAACAC 
ACTGTCAACGCTTACACATTGTGGATTCCAGGGATGGAGATTAGTGTTGGCCATATAAAA 
CGGAGAAGCTTACCTAATTTTGTGTTTCCTGGTGGAGTTAGACCTTCACATACCTCTAAA 
GGAACATGGGACAGCAATCGCCGTTCAGAGCACAGAAATTCTTCTACATCAAGTGCACCA 
GCTGCTACTACCACTACTACCGAAATGAGTTCTGAAAGTAAAGCTGGTTCTAACAGTCCA 
GTTGATGGGAAGAAGAGAAAATGGGGAGATAGTGAAACACTCACCGATCAGCCAAGGAAC 
TCTAAACACATTGCTGTTTCAGTGCCTGTAGAGAATTGTGAAGGCGGGAGTCCAAATCCA 
TCTGTTGGATCAATTTGTTCAAGTCCTATGAAAGATTATTGTACAAACGGTAAATCTGAG 
CCTATTAGTAAGGATCCACCAGAAAATGTTGTTGCTTTCAGTAAGGATCCACCAGAGAGT 
CTTCCGATAGAAAAGATAGCCACTCCTCAAGCTCATGAAACTGAGGAGCTTGAAGAAAGT 
TTTGATTTTGGAAACCAAGTGATTGAGCAGATATCTCATAAAGTTGCAGTCCTGTCTGCT 
ACTGCAACTATACCTCCATTCGAAGCTACTTCAAATGGCTCTCCTTTCCCTTATGAAGCA 
GTGGAAGAACTTGAGGTTTCTTATTTTTCTTATCAATTTTCGATACATAAATTGTTCTCT 
TGATCTTATTCCTCCTGTCTGATTTCTCTTTTGTTGAAAGGTTCTTCCCACGCGACAGCC 
CGATGCGGCACATAGACCTTCAGTACAACAGCGAAAACCGATAATCAAGTAAGTGATTTT 
GTGTCTATGTTTACTCTTAACGTTTGAATATACATTTTTGGATTTTGACAAAGATTGTTT 
GTTTTTGTTTGTCTGATTATTCGCAGATTGAGCTTCACGTCTCTAGGCAAAACCAATGGC 
AAGTAATAATGGCTTTTCCCTACATTGCCAAGAATCTCAGAGCACTTACGGAAATTCGAG 
ATGTTAAGTTGAGGGGTTCTTGTTACTTTATGTCTTATATTTATATGCTTTTCTTAGATG 
TTGCATGATCTCATGTAAAACTCGTTTGGATAAGATTAATGTAATGTGTTCTTGTCTATG 
GATCCCAAACACTTTTTCTGTCATAAATAAAAGTCTGGGTTGAGTTTACTTC
>AT1G17980.2 |  nucleotidyltransferase family protein 
TCTCATTCTTTGCGACGGTGACCCGACAAGATTATTGCCGGGAAACAGACCGAGAAGATT 
AAGCGTAAGATTCTCAACGAATGTTGGAGAAGGAATCTGATTTGACTGCAACGGAGAAAC 
CAAATAACAAGCACGCGGCTGATTCGTTTTCCAGCGAGGATTTGGTCTCACGCGGAGAAA 
CCAAATAACAAGCACGCGGAGATCAATTATTTTTATTTTCGTAGAATCTGATTGAAATAT 
TAAGAAAAAAGAGAAAAAAGAGAGGAAAAGAGCAAAGTAAGTAGGATAGATGGCTAGTGT 
CCAGCAAAATGGGCAACGGTTTGGCGTTTCAGAACCTATCTCTATGGGAGGACCAACGGA 
GTTTGATGTGATCAAGACAAGAGAGCTCGAGAAGGTTTTACTGATATCTTAATGCTTTTT 
TCTTGTAATGCTTTATTGTTTTAGTTTTAAAGTTTACTCATGATATACTTCTTAGTTTTA 
TACTGATTGATAGTATATTGAGTTGTGTTATTTGGTTGTTCAGCACTTGCAAGATGTTGG 
ATTGTACGAGAGCAAGGAGGAAGCTGTTAGAAGGGAGGAGGTTCTGGGGATACTAGATCA 
GGTTTTGTAGTACTTTTGAATCCTAAGAACTTGTGCTTATGGAGTTTTCATCGATGTTAG 
TAACGAACTCTTGATAAATCTTCGTTGTTGATGTGTCCAGATTGTAAAAACATGGATTAA 
AACAATCAGCCGCGCCAAAGGGTTGAATGATCAGCTGCTTCATGAGGCGAATGCAAAGAT 
ATTTACTTTCGGTTCTTATCGACTAGGGGTAATGATTAAGATCTATAGAAGATTTAGCTT 
TGTTTTAGTCATTCTTCTTGTATTGCGAAGTAGAGGGAAAGGGAACAATGTGAATTGGTG 
GAAACTGTGTTTTGTTTCTGTTGTCTTGTCTTGTGAGACGTCCCTGAGTGGGAAGTGGAA 
TCACTCGTCTTTACATGCTCTTTGCATTCATTTAAACATATTGAGGTCTCAATGTTATAT 
ATGTCACTTGAATCATATCTAACTGAGCTTTTCAGTCATTTTAATTATTGGTAAATCTTA 
GACACAATAGGGGGCTATTTATGGTTGCAATTGGTTCTTGGAGAGAATTCAGAGTCCTAA 
AGAGTTCCTTCTCTCCGATTTCTAGCATATTGAGTGCTCCTATAACAGTTCGTTTTACTT 
CTTCAAATAGGTACATGGACCTGGTGCTGATATAGACACTTTATGTGTGGGACCTAGACA 
TGCAACTAGAGAAGTACTATAACCTCTTGCATCTATATGTTGGCTGATTATTTCTTCTGT 
CAATTTATTGTGTTCAATATTCATCTTTATATTTTCCATTAGGGTGATTTCTTTGGTGAG 
CTACAAAGAATGCTGTCAGAAATGCCGGAAGTAACTGAACTGCACCCTGTGCCTGATGCT 
CATGTTCCATTGATGGGATTCAAACTTAATGGAGTTTCTATAGATCTCCTTTATGCACAA 
CTTCCACTCTGGGTTATACCTGAGGTAATTTCTTGTCCACAATGAGGTGATTGTTAGTGA 
GGACTAGGAAATTCGTAGATAAGTATGTTTTAACTTATCGAATTGAACCTCACTAAACTC 
ATCCTTACTGATTACAATCAATTAGTTTCACTCTATTACACAGTTTACATTATGTTCATG 
AATTTAAATGAATGTTATGAGTGGATCTCGTAGAAAATAGGTAATCTGAACCTGGAGCTC 
TGGTCCTGTTCCTCTTATGGAGGCTTAAATGTGTTCCCTGCCTGATGTTAATGGTGCAGG 
ACTTAGATTTATCACAGGACTCCATTCTACAGAATGCTGATGAGCAAACTGTTCGAAGTC 
TCAACGGTTGTAGAGTTACTGACCAAATCTTGCGTCTGGTTCCAAACATTCAGGTTTCGT 
GCTCACTGACCATAAATCTCTTATCTTCTAAAATTTAATTACTCATCCATATGATTTGCT 
TAGCCTGAGTACATGTTTTTTTCTTTGTTTCTGAGCAGAATTTCAGAACAACATTAAGAT 
GCATGAGATTTTGGGCCAAACGACGTGGAGTATACTCTAATGTATGGAGAATTCTTCTAT 
AATGCTCTTCTATTTTTTATGTGACTATCATGTTGCTTAAGTAAAGTATCTTTCTGACAA 
TTGCTAGGTCTCGGGATTTCTTGGTGGTATAAACTGGGCATTGCTTGTAGCTCGGATATG 
TCAACTTTATCCTAACGCCCTCCCTAATATTTTAGTGTCTCGGTTCTTTAGGGTCTTCTA 
TCAATGGAATTGGCCGAACGCCATTTTTCTTTGTTCTCCGGATGAAGGATCCCTTGGTCT 
TCAAGTTTGGGATCCTAGAATAAACCCAAAGGATCGGTTGCATATAATGCCCATCATTAC 
TCCTGCTTATCCTTGTATGAACTCTAGTTACAATGTCTCTGAAAGTACATTGCGGATTAT 
GAAAGGAGAGTTTCAGAGAGGAAACGAAATATGTGAGGTAAGATTTCGATAAGTCCAAAT 
AGTTGGCTTCTATGCAGATTCATGGACTTATTACAACGGCTTGATGTCTTGCAGGCTATG 
GAATCAAACAAAGCTGACTGGGATACCCTTTTTGAGCCATTTGCATTCTTTGAAGCGTAT 
AAAAACTATCTACAGATAGACATTTCTGCTGCAAATGTCGATGATCTAAGAAAATGGAAA 
GGCTGGGTTGAGTCACGCCTCCGCCAGCTCACACTGAAGGTGAAAAGCCATGTTTACTTT 
AACTTGAATAGTTTCTCTTGATTTTGCTTTGCTAATGATTTGTCTTGGATGTTTGCATTG 
TAATCTTAGATCGAGAGACATTTTAAAATGCTTCATTGCCACCCTCATCCCCATGATTTT 
CAAGACACATCCCGGCCACTCCATTGCTCTTACTTCATGGGTCTGCAACGTAAACAAGGA 
GTTCCAGCAGCAGAAGGCGAGCAATTCGATATCAGAAGAACCGTTGAGGAGTTTAAACAC 
ACTGTCAACGCTTACACATTGTGGATTCCAGGGATGGAGATTAGTGTTGGCCATATAAAA 
CGGAGAAGCTTACCTAATTTTGTGTTTCCTGGTGGAGTTAGACCTTCACATACCTCTAAA 
GGAACATGGGACAGCAATCGCCGTTCAGAGCACAGAAATTCTTCTACATCAAGTGCACCA 
GCTGCTACTACCACTACTACCGAAATGAGTTCTGAAAGTAAAGCTGGTTCTAACAGTCCA 
GTTGATGGGAAGAAGAGAAAATGGGGAGATAGTGAAACACTCACCGATCAGCCAAGGAAC 
TCTAAACACATTGCTGTTTCAGTGCCTGTAGAGAATTGTGAAGGCGGGAGTCCAAATCCA 
TCTGTTGGATCAATTTGTTCAAGTCCTATGAAAGATTATTGTACAAACGGTAAATCTGAG 
CCTATTAGTAAGGATCCACCAGAAAATGTTGTTGCTTTCAGTAAGGATCCACCAGAGAGT 
CTTCCGATAGAAAAGATAGCCACTCCTCAAGCTCATGAAACTGAGGAGCTTGAAGAAAGT 
TTTGATTTTGGAAACCAAGTGATTGAGCAGATATCTCATAAAGTTGCAGTCCTGTCTGCT 
ACTGCAACTATACCTCCATTCGAAGCTACTTCAAATGGCTCTCCTTTCCCTTATGAAGCA 
GTGGAAGAACTTGAGGTTTCTTATTTTTCTTATCAATTTTCGATACATAAATTGTTCTCT 
TGATCTTATTCCTCCTGTCTGATTTCTCTTTTGTTGAAAGGTTCTTCCCACGCGACAGCC 
CGATGCGGCACATAGACCTTCAGTACAACAGCGAAAACCGATAATCAAGTAAGTGATTTT 
GTGTCTATGTTTACTCTTAACGTTTGAATATACATTTTTGGATTTTGACAAAGATTGTTT 
GTTTTTGTTTGTCTGATTATTCGCAGATTGAGCTTCACGTCTCTAGGCAAAACCAATGGC 
AAGTAATAATGGCTTTTCCCTACATTGCCAAGAATCTCAGAGCACTTACGGAAATTCGAG 
ATGTTAAGTTGAGGGGTTCTTGTTACTTTATGTCTTATATTTATATGCTTTTCTTAGATG 
TTGCATGATCTCATGTAAAACTCGTTTGGATAAGATTAATGTAATGTGTTCTTGTCTATG 
GATCCCAAACACTTTTTCTGTCATAAATAAAAGTCTGGGTTGAGTTTACTTC
>AT1G17980.1 |  nucleotidyltransferase family protein 
ATCTCATTCTTTGCGACGGTGACCCGACAAGATTATTGCCGGGAAACAGACCGAGAAGAT 
TAAGCGTAAGATTCTCAACGAATGTTGGAGAAGGAATCTGATTTGACTGCAACGGAGAAA 
CCAAATAACAAGCACGCGGCTGATTCGTTTTCCAGCGAGGATTTGGTCTCACGCGGAGAA 
ACCAAATAACAAGCACGCGGAGATCAATTATTTTTATTTTCGTAGAATCTGATTGAAATA 
TTAAGAAAAAAGAGAAAAAAGAGAGGAAAAGAGCAAAGTAAGTAGGATAGATGGCTAGTG 
TCCAGCAAAATGGGCAACGGTTTGGCGTTTCAGAACCTATCTCTATGGGAGGACCAACGG 
AGTTTGATGTGATCAAGACAAGAGAGCTCGAGAAGGTTTTACTGATATCTTAATGCTTTT 
TTCTTGTAATGCTTTATTGTTTTAGTTTTAAAGTTTACTCATGATATACTTCTTAGTTTT 
ATACTGATTGATAGTATATTGAGTTGTGTTATTTGGTTGTTCAGCACTTGCAAGATGTTG 
GATTGTACGAGAGCAAGGAGGAAGCTGTTAGAAGGGAGGAGGTTCTGGGGATACTAGATC 
AGGTTTTGTAGTACTTTTGAATCCTAAGAACTTGTGCTTATGGAGTTTTCATCGATGTTA 
GTAACGAACTCTTGATAAATCTTCGTTGTTGATGTGTCCAGATTGTAAAAACATGGATTA 
AAACAATCAGCCGCGCCAAAGGGTTGAATGATCAGCTGCTTCATGAGGCGAATGCAAAGA 
TATTTACTTTCGGTTCTTATCGACTAGGGGTAATGATTAAGATCTATAGAAGATTTAGCT 
TTGTTTTAGTCATTCTTCTTGTATTGCGAAGTAGAGGGAAAGGGAACAATGTGAATTGGT 
GGAAACTGTGTTTTGTTTCTGTTGTCTTGTCTTGTGAGACGTCCCTGAGTGGGAAGTGGA 
ATCACTCGTCTTTACATGCTCTTTGCATTCATTTAAACATATTGAGGTCTCAATGTTATA 
TATGTCACTTGAATCATATCTAACTGAGCTTTTCAGTCATTTTAATTATTGGTAAATCTT 
AGACACAATAGGGGGCTATTTATGGTTGCAATTGGTTCTTGGAGAGAATTCAGAGTCCTA 
AAGAGTTCCTTCTCTCCGATTTCTAGCATATTGAGTGCTCCTATAACAGTTCGTTTTACT 
TCTTCAAATAGGTACATGGACCTGGTGCTGATATAGACACTTTATGTGTGGGACCTAGAC 
ATGCAACTAGAGAAGTACTATAACCTCTTGCATCTATATGTTGGCTGATTATTTCTTCTG 
TCAATTTATTGTGTTCAATATTCATCTTTATATTTTCCATTAGGGTGATTTCTTTGGTGA 
GCTACAAAGAATGCTGTCAGAAATGCCGGAAGTAACTGAACTGCACCCTGTGCCTGATGC 
TCATGTTCCATTGATGGGATTCAAACTTAATGGAGTTTCTATAGATCTCCTTTATGCACA 
ACTTCCACTCTGGGTTATACCTGAGGTAATTTCTTGTCCACAATGAGGTGATTGTTAGTG 
AGGACTAGGAAATTCGTAGATAAGTATGTTTTAACTTATCGAATTGAACCTCACTAAACT 
CATCCTTACTGATTACAATCAATTAGTTTCACTCTATTACACAGTTTACATTATGTTCAT 
GAATTTAAATGAATGTTATGAGTGGATCTCGTAGAAAATAGGTAATCTGAACCTGGAGCT 
CTGGTCCTGTTCCTCTTATGGAGGCTTAAATGTGTTCCCTGCCTGATGTTAATGGTGCAG 
GACTTAGATTTATCACAGGACTCCATTCTACAGAATGCTGATGAGCAAACTGTTCGAAGT 
CTCAACGGTTGTAGAGTTACTGACCAAATCTTGCGTCTGGTTCCAAACATTCAGGTTTCG 
TGCTCACTGACCATAAATCTCTTATCTTCTAAAATTTAATTACTCATCCATATGATTTGC 
TTAGCCTGAGTACATGTTTTTTTCTTTGTTTCTGAGCAGAATTTCAGAACAACATTAAGA 
TGCATGAGATTTTGGGCCAAACGACGTGGAGTATACTCTAATGTATGGAGAATTCTTCTA 
TAATGCTCTTCTATTTTTTATGTGACTATCATGTTGCTTAAGTAAAGTATCTTTCTGACA 
ATTGCTAGGTCTCGGGATTTCTTGGTGGTATAAACTGGGCATTGCTTGTAGCTCGGATAT 
GTCAACTTTATCCTAACGCCCTCCCTAATATTTTAGTGTCTCGGTTCTTTAGGGTCTTCT 
ATCAATGGAATTGGCCGAACGCCATTTTTCTTTGTTCTCCGGATGAAGGATCCCTTGGTC 
TTCAAGTTTGGGATCCTAGAATAAACCCAAAGGATCGGTTGCATATAATGCCCATCATTA 
CTCCTGCTTATCCTTGTATGAACTCTAGTTACAATGTCTCTGAAAGTACATTGCGGATTA 
TGAAAGGAGAGTTTCAGAGAGGAAACGAAATATGTGAGGTAAGATTTCGATAAGTCCAAA 
TAGTTGGCTTCTATGCAGATTCATGGACTTATTACAACGGCTTGATGTCTTGCAGGCTAT 
GGAATCAAACAAAGCTGACTGGGATACCCTTTTTGAGCCATTTGCATTCTTTGAAGCGTA 
TAAAAACTATCTACAGATAGACATTTCTGCTGCAAATGTCGATGATCTAAGAAAATGGAA 
AGGCTGGGTTGAGTCACGCCTCCGCCAGCTCACACTGAAGGTGAAAAGCCATGTTTACTT 
TAACTTGAATAGTTTCTCTTGATTTTGCTTTGCTAATGATTTGTCTTGGATGTTTGCATT 
GTAATCTTAGATCGAGAGACATTTTAAAATGCTTCATTGCCACCCTCATCCCCATGATTT 
TCAAGACACATCCCGGCCACTCCATTGCTCTTACTTCATGGGTCTGCAACGTAAACAAGG 
AGTTCCAGCAGCAGAAGGCGAGCAATTCGATATCAGAAGAACCGTTGAGGAGTTTAAACA 
CACTGTCAACGCTTACACATTGTGGATTCCAGGGATGGAGATTAGTGTTGGCCATATAAA 
ACGGAGAAGCTTACCTAATTTTGTGTTTCCTGGTGGAGTTAGACCTTCACATACCTCTAA 
AGGAACATGGGACAGCAATCGCCGTTCAGAGCACAGAAATTCTTCTACATCAAGTGCACC 
AGCTGCTACTACCACTACTACCGAAATGAGTTCTGAAAGTAAAGCTGGTTCTAACAGTCC 
AGTTGATGGGAAGAAGAGAAAATGGGGAGATAGTGAAACACTCACCGATCAGCCAAGGAA 
CTCTAAACACATTGCTGTTTCAGTGCCTGTAGAGAATTGTGAAGGCGGGAGTCCAAATCC 
ATCTGTTGGATCAATTTGTTCAAGTCCTATGAAAGATTATTGTACAAACGGTAAATCTGA 
GCCTATTAGTAAGGATCCACCAGAAAATGTTGTTGCTTTCAGTAAGGATCCACCAGAGAG 
TCTTCCGATAGAAAAGATAGCCACTCCTCAAGCTCATGAAACTGAGGAGCTTGAAGAAAG 
TTTTGATTTTGGAAACCAAGTGATTGAGCAGATATCTCATAAAGTTGCAGTCCTGTCTGC 
TACTGCAACTATACCTCCATTCGAAGCTACTTCAAATGGCTCTCCTTTCCCTTATGAAGC 
AGTGGAAGAACTTGAGGTTTCTTATTTTTCTTATCAATTTTCGATACATAAATTGTTCTC 
TTGATCTTATTCCTCCTGTCTGATTTCTCTTTTGTTGAAAGGTTCTTCCCACGCGACAGC 
CCGATGCGGCACATAGACCTTCAGTACAACAGCGAAAACCGATAATCAAGTAAGTGATTT 
TGTGTCTATGTTTACTCTTAACGTTTGAATATACATTTTTGGATTTTGACAAAGATTGTT 
TGTTTTTGTTTGTCTGATTATTCGCAGATTGAGCTTCACGTCTCTAGGCAAAACCAATGG 
CAAGTAATAATGGCTTTTCCCTACATTGCCAAGAATCTCAGAGCACTTACGGAAATTCGA 
GATGTTAAGTTGAGGGGTTCTTGTTACTTTATGTCTTATATTTATATGCTTTTCTTAGAT 
GTTGCATGATCTCATGTAAAACTCGTTTGGATAAGATTAATGTAATGTGTTCTTGTCTAT 
GGATCCCAAACACTTTTTCTGTCATAAATAAAAGTCTGGGTTGAGTTTACTTCACATATA 
TA
>AT1G17980.1 |  nucleotidyltransferase family protein 
ATCTCATTCTTTGCGACGGTGACCCGACAAGATTATTGCCGGGAAACAGACCGAGAAGAT 
TAAGCGTAAGATTCTCAACGAATGTTGGAGAAGGAATCTGATTTGACTGCAACGGAGAAA 
CCAAATAACAAGCACGCGGCTGATTCGTTTTCCAGCGAGGATTTGGTCTCACGCGGAGAA 
ACCAAATAACAAGCACGCGGAGATCAATTATTTTTATTTTCGTAGAATCTGATTGAAATA 
TTAAGAAAAAAGAGAAAAAAGAGAGGAAAAGAGCAAAGTAAGTAGGATAGATGGCTAGTG 
TCCAGCAAAATGGGCAACGGTTTGGCGTTTCAGAACCTATCTCTATGGGAGGACCAACGG 
AGTTTGATGTGATCAAGACAAGAGAGCTCGAGAAGGTTTTACTGATATCTTAATGCTTTT 
TTCTTGTAATGCTTTATTGTTTTAGTTTTAAAGTTTACTCATGATATACTTCTTAGTTTT 
ATACTGATTGATAGTATATTGAGTTGTGTTATTTGGTTGTTCAGCACTTGCAAGATGTTG 
GATTGTACGAGAGCAAGGAGGAAGCTGTTAGAAGGGAGGAGGTTCTGGGGATACTAGATC 
AGGTTTTGTAGTACTTTTGAATCCTAAGAACTTGTGCTTATGGAGTTTTCATCGATGTTA 
GTAACGAACTCTTGATAAATCTTCGTTGTTGATGTGTCCAGATTGTAAAAACATGGATTA 
AAACAATCAGCCGCGCCAAAGGGTTGAATGATCAGCTGCTTCATGAGGCGAATGCAAAGA 
TATTTACTTTCGGTTCTTATCGACTAGGGGTAATGATTAAGATCTATAGAAGATTTAGCT 
TTGTTTTAGTCATTCTTCTTGTATTGCGAAGTAGAGGGAAAGGGAACAATGTGAATTGGT 
GGAAACTGTGTTTTGTTTCTGTTGTCTTGTCTTGTGAGACGTCCCTGAGTGGGAAGTGGA 
ATCACTCGTCTTTACATGCTCTTTGCATTCATTTAAACATATTGAGGTCTCAATGTTATA 
TATGTCACTTGAATCATATCTAACTGAGCTTTTCAGTCATTTTAATTATTGGTAAATCTT 
AGACACAATAGGGGGCTATTTATGGTTGCAATTGGTTCTTGGAGAGAATTCAGAGTCCTA 
AAGAGTTCCTTCTCTCCGATTTCTAGCATATTGAGTGCTCCTATAACAGTTCGTTTTACT 
TCTTCAAATAGGTACATGGACCTGGTGCTGATATAGACACTTTATGTGTGGGACCTAGAC 
ATGCAACTAGAGAAGTACTATAACCTCTTGCATCTATATGTTGGCTGATTATTTCTTCTG 
TCAATTTATTGTGTTCAATATTCATCTTTATATTTTCCATTAGGGTGATTTCTTTGGTGA 
GCTACAAAGAATGCTGTCAGAAATGCCGGAAGTAACTGAACTGCACCCTGTGCCTGATGC 
TCATGTTCCATTGATGGGATTCAAACTTAATGGAGTTTCTATAGATCTCCTTTATGCACA 
ACTTCCACTCTGGGTTATACCTGAGGTAATTTCTTGTCCACAATGAGGTGATTGTTAGTG 
AGGACTAGGAAATTCGTAGATAAGTATGTTTTAACTTATCGAATTGAACCTCACTAAACT 
CATCCTTACTGATTACAATCAATTAGTTTCACTCTATTACACAGTTTACATTATGTTCAT 
GAATTTAAATGAATGTTATGAGTGGATCTCGTAGAAAATAGGTAATCTGAACCTGGAGCT 
CTGGTCCTGTTCCTCTTATGGAGGCTTAAATGTGTTCCCTGCCTGATGTTAATGGTGCAG 
GACTTAGATTTATCACAGGACTCCATTCTACAGAATGCTGATGAGCAAACTGTTCGAAGT 
CTCAACGGTTGTAGAGTTACTGACCAAATCTTGCGTCTGGTTCCAAACATTCAGGTTTCG 
TGCTCACTGACCATAAATCTCTTATCTTCTAAAATTTAATTACTCATCCATATGATTTGC 
TTAGCCTGAGTACATGTTTTTTTCTTTGTTTCTGAGCAGAATTTCAGAACAACATTAAGA 
TGCATGAGATTTTGGGCCAAACGACGTGGAGTATACTCTAATGTATGGAGAATTCTTCTA 
TAATGCTCTTCTATTTTTTATGTGACTATCATGTTGCTTAAGTAAAGTATCTTTCTGACA 
ATTGCTAGGTCTCGGGATTTCTTGGTGGTATAAACTGGGCATTGCTTGTAGCTCGGATAT 
GTCAACTTTATCCTAACGCCCTCCCTAATATTTTAGTGTCTCGGTTCTTTAGGGTCTTCT 
ATCAATGGAATTGGCCGAACGCCATTTTTCTTTGTTCTCCGGATGAAGGATCCCTTGGTC 
TTCAAGTTTGGGATCCTAGAATAAACCCAAAGGATCGGTTGCATATAATGCCCATCATTA 
CTCCTGCTTATCCTTGTATGAACTCTAGTTACAATGTCTCTGAAAGTACATTGCGGATTA 
TGAAAGGAGAGTTTCAGAGAGGAAACGAAATATGTGAGGTAAGATTTCGATAAGTCCAAA 
TAGTTGGCTTCTATGCAGATTCATGGACTTATTACAACGGCTTGATGTCTTGCAGGCTAT 
GGAATCAAACAAAGCTGACTGGGATACCCTTTTTGAGCCATTTGCATTCTTTGAAGCGTA 
TAAAAACTATCTACAGATAGACATTTCTGCTGCAAATGTCGATGATCTAAGAAAATGGAA 
AGGCTGGGTTGAGTCACGCCTCCGCCAGCTCACACTGAAGGTGAAAAGCCATGTTTACTT 
TAACTTGAATAGTTTCTCTTGATTTTGCTTTGCTAATGATTTGTCTTGGATGTTTGCATT 
GTAATCTTAGATCGAGAGACATTTTAAAATGCTTCATTGCCACCCTCATCCCCATGATTT 
TCAAGACACATCCCGGCCACTCCATTGCTCTTACTTCATGGGTCTGCAACGTAAACAAGG 
AGTTCCAGCAGCAGAAGGCGAGCAATTCGATATCAGAAGAACCGTTGAGGAGTTTAAACA 
CACTGTCAACGCTTACACATTGTGGATTCCAGGGATGGAGATTAGTGTTGGCCATATAAA 
ACGGAGAAGCTTACCTAATTTTGTGTTTCCTGGTGGAGTTAGACCTTCACATACCTCTAA 
AGGAACATGGGACAGCAATCGCCGTTCAGAGCACAGAAATTCTTCTACATCAAGTGCACC 
AGCTGCTACTACCACTACTACCGAAATGAGTTCTGAAAGTAAAGCTGGTTCTAACAGTCC 
AGTTGATGGGAAGAAGAGAAAATGGGGAGATAGTGAAACACTCACCGATCAGCCAAGGAA 
CTCTAAACACATTGCTGTTTCAGTGCCTGTAGAGAATTGTGAAGGCGGGAGTCCAAATCC 
ATCTGTTGGATCAATTTGTTCAAGTCCTATGAAAGATTATTGTACAAACGGTAAATCTGA 
GCCTATTAGTAAGGATCCACCAGAAAATGTTGTTGCTTTCAGTAAGGATCCACCAGAGAG 
TCTTCCGATAGAAAAGATAGCCACTCCTCAAGCTCATGAAACTGAGGAGCTTGAAGAAAG 
TTTTGATTTTGGAAACCAAGTGATTGAGCAGATATCTCATAAAGTTGCAGTCCTGTCTGC 
TACTGCAACTATACCTCCATTCGAAGCTACTTCAAATGGCTCTCCTTTCCCTTATGAAGC 
AGTGGAAGAACTTGAGGTTTCTTATTTTTCTTATCAATTTTCGATACATAAATTGTTCTC 
TTGATCTTATTCCTCCTGTCTGATTTCTCTTTTGTTGAAAGGTTCTTCCCACGCGACAGC 
CCGATGCGGCACATAGACCTTCAGTACAACAGCGAAAACCGATAATCAAGTAAGTGATTT 
TGTGTCTATGTTTACTCTTAACGTTTGAATATACATTTTTGGATTTTGACAAAGATTGTT 
TGTTTTTGTTTGTCTGATTATTCGCAGATTGAGCTTCACGTCTCTAGGCAAAACCAATGG 
CAAGTAATAATGGCTTTTCCCTACATTGCCAAGAATCTCAGAGCACTTACGGAAATTCGA 
GATGTTAAGTTGAGGGGTTCTTGTTACTTTATGTCTTATATTTATATGCTTTTCTTAGAT 
GTTGCATGATCTCATGTAAAACTCGTTTGGATAAGATTAATGTAATGTGTTCTTGTCTAT 
GGATCCCAAACACTTTTTCTGTCATAAATAAAAGTCTGGGTTGAGTTTACTTCACATATA 
TA
>AT3G12860.1 |  nucleolar protein Nop56 putative 
AAACCCTAATTTCTCTTATTCTTCTCCGAAACGGAAACTGCATAAATACTCGATTTTCAA 
ATCAATTTTGAAAAAGACGGCTAGGGTTTTTACAGAATTCTCTCTACAATGAAGATTTAT 
CTTCTTTCCGAATCACCCTCCGGCTACGGATTGTTCGAGGGACACGGTTCCGATGAGATT 
GGACAGAACACGGAGGCGGTTCGGAGCTCCGTCTCGGACCTTAGTCGGTTCGGGCGGGTC 
GTCCAGCTCACTGCTTTTCACCCGTTCCAGTCTGCACTCGATGCTCTTAACCAAATCAAC 
GCCGTCTCTGAAGGTGAACTCACTACTAAATTACAGCTCTTTCCCTCTTTAGTTTCCTGC 
ACCATATACTTTATTACTTGCTTCTATTATAGTTTATGCTGGAAAGAGCTTAATTCTTAG 
AAATTGAGCTCTTACTACTGTTGGAATCAGCTTATTCTGTTCTGTTTTAGCTTTTGCTGG 
AGGTCTTGATAATAAAGTATTAATATTTGTATTGTTTTTACACCTTAAAAATCGTAGGAT 
ACATGAGCGATGAGCTGAGAAGTTTTCTGGAGCTGAATCTCCCGAAAGTGAAGGAAGGCA 
AGAAGCCCAAGTTTAGTTTGGGAGTGTCTGAGCCTAAAATCGGTTCTTGCATTTTTGAAG 
CTACCAAAATTCCTTGCCAGAGCAATGAGTTTGTCCATGAGCTCCTTAGAGGTGTGCGTC 
AGCATTTCGATAGGTTCATCAAAGACTTGAAGGTGTGTTTTTTATTTTTGATTACCTAAT 
ACCTACACATATTTTTGCTATTCGTGCTCAATATCATCTTCTTTATAATGTAGCCTGGTG 
ATTTGGAAAAAGCTCAACTTGGACTAGCTCATAGCTACAGCAGAGCAAAGGTGAAGTTCA 
ATGTTAACCGGGTGGATAACATGGTTATTCAAGCTATTTTCATGCTTGACACACTTGATA 
AGGATATCAATTCCTTTGCTATGAGAGTCAGGTTTGTTTTCTTATTGTTTTGCCTTTCAG 
ATTATGTCTTGTCTGTTACCGTAAGAGAAAATGGTTTCTGAGCAGCTCATATTATGTTTT 
TGCAGAGAATGGTACTCATGGCACTTCCCTGAGCTTGTCAAGATAGTTAATGACAACTAC 
CTCTACGCCAAAGTTTCAAAGATTATCGTCGACAAGTCAAAGTTGTCTGAAGAGCACATC 
CCTATGCTTACTGAAGCCCTGGGTGATGAAGATAAGGCAAGAGAGGTTATTGAAGCTGGA 
AAAGCATCTATGGGTAATAAACTGATGTAGCATGTTCGATAAGAATCATGAATCTTTACA 
ATATATCTATTGTTTCTCATGTTCTAAGACATTGTTGTTTTCTCTATTTGAAGGCCAGGA 
TTTATCACCGGTTGATCTGATCAATGTCCAGACCTTTGCTCAGAGAGTTATGGACCTTGC 
AGATTACAGGAAGAAGCTCTATGATTATCTTGTTACTAAAATGAGTGACATTGCTCCAAA 
TTTGGCGGCCTTGATCGGAGAGATGGTTGGGGCTAGGTTGATTTCACATGCAGGAAGTCT 
GACAAATCTTGCCAAGTGCCCATCTTCAACCCTCCAGATTCTCGGTGCTGAGAAGGCACT 
TTTCAGGTGCATTTCAAGCTTTGTTAGTCTTTACAAGTTTAATTACACTGCAGTAACTAA 
CTTTGGTGTTAATTTCAGGGCACTGAAAACACGTGGAAACACACCCAAATATGGTCTAAT 
ATTCCATTCATCATTCATCGGGCGTGCATCTGCTAAAAACAAGGGCCGTATTGCTCGTTT 
CCTTGCAAACAAGTGTTCCATTGCTTCCCGGATTGATTGTTTCTCAGGTAATAATCTAGA 
GAATGTCCTGAATAAGAGAGAGGTGTTTGGGAGATGATGCGTTGTTATTAACTACAAAAT 
CATGGTGGTTGTGTTATGCAGATAACAGCACTACAGCTTTCGGTGAGAAACTAAGGGAAC 
AAGTAGAGGAAAGACTTGACTTTTATGACAAAGGTGTTGCCCCACGTAAGAATGTTGATG 
TAATGAAAGAAGTGTTGGAAAATCTTGAGAAGAAAGGTACATATGACCCAACAAAGCTCT 
CTGATCTGTTGTGGTAAACGGTTTTGTTTGATGGGTTGTTTCTTCTTTTTTTAAGACGAG 
GGAGAAAAAACAGTGGATGCTTCGGAGAAGAAAAAGAAGAGAAAGACAGAGGAGAAGGAG 
GAGGAGAAGGAAGAGGAGAAATCAAAGAAAAAGAAAAAGAAAAGCAAAGCAGTAGAAGGA 
GAGGAATTGACAGCAACAGATAATGGCCATAGCAAGAAGAAGAAGAAAACTAAGTCACAA 
GATGATGAATAA
>AT1G56110.1 |  NOP56 (Arabidopsis homolog of nucleolar protein Nop56) 
TTGTATATTTCTTCTCGCTCAGTAGGTCTTTAGGGTTTTAGTTTCTTCTCCTCAAAAAAT 
GGCGATGTATGTTATCTACGAGTCTTCTTCCGGCTATGGTCTCTTCGAGGTTCACGGACT 
AGATGAGATCGGACAGAACACTGAGGCGGTTCGGACTTCTGTCTCCGACCTCAGTCGCTT 
TGGCCGTGTTGTTCAGCTCACAGCGTTTCATCCCTTTGAGTCTGCTCTCGATGCTCTCAA 
CCAAGTCAACGCCGTCTCTGAAGGTCAGACTCTTCATTACTCTCTTCTTATTCTTTGTTC 
TGTATATTCATGTGTTGTGTTGAGTAGCTTGTTCTTGTATTTAGAGCTAGAGTAGACACT 
TCGATTTAAAACCTTATAGTTCAAATTTCCTGGATATATTGTAGAAAGAGCTTTAATTTA 
TGGTTGATTCTTGTTTTTGTGTTCTGTTTTTGTTTCATTGTTTTGGTTTTGTCATTGATG 
CTTTTGGAATTGGTTTTAATGTGATATTGGTAGGTGTTATGACTGATGAGCTTAGAAGTT 
TTCTGGAGTTGAATCTTCCTAAGGTCAAGGAGGGAAAGAAACCCAAGTTCAGTTTAGGAT 
TGGCTGAGCCTAAACTCGGTTCACATATATTTGAAGCTACTAAAATCCCATGCCAGAGCA 
ATGAGTTTGTTCTTGAGCTTCTCAGAGGTGTTCGCCAGCATTTTGATAGGTTTATCAAGG 
ACTTAAAGGTGTGATCTCCTTTCTATGTGTTTAAAATCTTTTTGTCTGTTTGCTTATCTC 
ATATGGTTTGTGTTCTCATAAAAAATTTCTGTTTATGTAGCCTGGTGATCTTGAAAAATC 
TCAGCTTGGATTAGCTCACAGCTACAGCAGAGCCAAGGTGAAGTTCAATGTTAACCGAGT 
GGATAACATGGTTATTCAAGCTATCTTCATGCTTGACACGCTTGATAAGGATATCAATTC 
CTTTGCCATGAGAGTCAGGTTTGTTTTGTGCTTTTCCCTTTCAGATTGTGTGTTTTCCTC 
GAGAAAATTGGTAGCTGAACTGTTTATAATGTTATTACAGGGAATGGTATTCGTGGCACT 
TCCCCGAACTAGTGAAGATAGTCAATGACAACTATCTTTACGCCCGTGTTTCAAAGATGA 
TTGATGACAAGTCAAAGTTGACTGAAGATCACATCCCCATGCTTACTGAAGTCTTAGGGG 
ATGAAGATAAGGCAAAGGAGGTCATCGAAGCTGGAAAAGCATCCATGGGTAAAAATTTTG 
AGCTGACTTTTTTGGTAGCTTTGAGTTAATGTGTGTTTCTGTTAACTTATGTCCTGAGAC 
ATTTACTCTCTTCCCTATTGGCAGGCTCGGATTTATCACCGCTTGACTTAATCAACGTAC 
AGACCTTTGCTCAGAAAGTTATGGACCTTGCTGACTACAGGAAGAAGCTCTATGATTATC 
TTGTCACTAAGATGAGCGACATTGCCCCTAATTTGGCTGCTTTGATTGGAGAAATGGTCG 
GTGCCCGTTTGATTTCACATGCTGGAAGTCTGACTAACCTTGCTAAATGCCCATCTTCCA 
CCCTCCAGATTCTTGGAGCCGAGAAGGCTCTTTTCAGGTGCAATATCTGGCACTATATTT 
TTAATGTTCACCAGTTTCCTTTTAGTGCTGCTTGTGACATGAACTGCTGTGGTATTTCAG 
GGCACTTAAAACACGTGGAAACACTCCCAAGTATGGATTGATTTTCCATTCTTCCTTCAT 
TGGCCGAGCATCTGCTAAGAACAAGGGCCGTATCGCTCGTTATCTTGCAAACAAGTGCTC 
TATAGCATCCCGGATTGATTGTTTTGCTGGTAAAAATCTGAAACTCCTTGAAGAAGAGTT 
TTGGATTATGAATTCTGTTGTGAAAGTGTTAAATTATGTGCCCTGATGTCCTATGCAGAT 
GGTGCAACTACTGCTTTTGGTGAGAAGCTTCGCGAACAAGTTGAGGAAAGGCTAGAATTT 
TATGACAAAGGTGTTGCCCCACGCAAGAACGTGGATGTAATGAAGGAGGTGATAGAGAAT 
CTAAAGCAAGGTATTTCTTGTAGCTGTTTTTTTTTGGTTGTAATCAGAGTCCTCTTTATG 
ATGGCAAACTCAGTGTTTTTTTATCTGTTCCTCCTTTAGAAGAGGAAGGGAAGGAGCCAG 
TTGATGCCTCGGTGAAGAAAAGCAAGAAGAAGAAGGCAAAGGGTGAAGAAGAAGAAGAGG 
TGGTGGCAATGGAGGAGGACAAGTCAGAGAAAAAGAAGAAGAAAGAGAAGAGGAAGATGG 
AGACTGCAGAGGAGAACGAGAAATCAGAGAAGAAGAAGACAAAGAAGAGTAAAGCTGGAG 
GAGAAGAGGAGACTGATGATGGTCACAGCACCAAGAAGAAGAAGAAGAAGTCTAAGAGCG 
CTGAATAGAAAGGGATGCAACATTAACAAACCCTGTATTGTATTTTTTTTTTGAGCTAAA 
TTAATGTCGTCTGTTTTTCGTAGTGAACATCGGAGAATTTTTGTTTTGGTCTGGAAACGA 
TTCAAGGTTTGGCAATATCTTAAGTTTGTTTAGGTTTTCACTA
>AT2G37990.1 |  ribosome biogenesis regulatory protein (RRS1) family protein 
AAAATATCGCAAAACCCTAACAAAAAATTTTCATTCTTCCTCCACTCTCTCAATTCCAAA 
ACACTGCGCCGGGAAGACATGGACACCGAGATGGAGACAGAACAAATATACCAGGTCGAT 
GTCGGAAATCTCTTGGCTTTCAATCCCAATCACCGCTTCCCATCTGCTCCTTCTTCAAGG 
TTCGTCCTTTCCCGTCTTATCTTAAGCTTGTGTTGAGTTCTTCGATGGCGGCGGCTTGAT 
TATATATTTGTTTAATCCTGATTTAGTTGATTTGGAATGGGTTTATCTTCATACTTGTTG 
TAAACTTTTCAATTGCTGAATAATGTTAAGTAAAGTATGAATTTTTTCGTAAGAGTGATT 
TATTAACAAAAGCTCTGTTTAAGTACAAGAGTTTCTTCAATTAGTTTCTCTAAGCATCAA 
TCTCGGAAGTACAAGAGTTAAATATCTTAAGACGATGACCCAATCGAAAAGGTTGCGTCT 
TTAAGCAACTTCTCTGAGTGCTGTTTTAAGAGTTTTGGGAGTTGAACCTCTTCCTCAGTT 
GCATTCTTTTGTAATTAGGGAACAATGCTGTGTCGCTATCAATACAATATCGTCTTACTT 
GAGTTACTTGTTTCTGTTGAGAGCTTGTTTTATTTCTGTCCTTGATGATGATTTGTTCGA 
ATTATTTTAGGGGGGAGCTTGTGAAGGAGATCCTAACGGAGGGAACAAAACTTGTTCAGG 
AAATAGCCAATAAACTTTTCAACTTTCCTTCTACTGAAACAAATGATGGTCCTATTGTCC 
AATTGCCTCCGCCTACAACCAAACTTCCTAGAGAGAAACATGTAAGATCTTCCTTTTTAT 
TTTCCACTATCTCCATTCTCATGCAACACATGGATTTAACCAGTTTCAAATGCAAACGAG 
TGATTTCTTGTATGAGCTTATCCAAAAGACTAGAACAAGTTCATATTTTTGCTCATCACT 
TATCTTTGTATTGTACTAAAGCTTGTAACCTTCTCCTCTTTTCCCAGATTCCAAGGCCTA 
AGCCTCCTACGAAGTGGGAAGAGTTTGCGCTTAAGAAAGGTAAAAGCTGTTTAAGAAATT 
GTTTTAAGGATTGGAAGCTTTATTTTGTTCAGATTTTGATGGGTCGACGACCTCTGTGTT 
CTATAGTTTGAAGGTACTAATGTTTATTTCGTTTGGAATTGTTCTTGGTTCTGTTTCTTA 
GGTATACAGAAGCGCAAGAAGGAAAAAGTTGTATGGGATGAACAAACTAATCAGTTTAAG 
CGTCGCCATGGTTATGACCGTGTTAACGATGATAATGATGTTCCCATCATTGAGGCGAAA 
GAATCAGATGGTAAGTCTTATGGAAAACAACTATCTTAGATTATGTTGTTAGAGACAATG 
TTGAAATCTAATCTCTTTGAGTTTGAAGACAAGGATATGGAGTTGCATTACATTATTTTT 
TCTACTATTTATGAAAGCTTTTGGTTAATTGCAGAACCAGGAGTAGATCCTTTTGCCAAG 
AGACTAGATGATAAGAAGAAGAGAGTTGGAAAGCAAGAAAAGAATAGACTTCAGAATCTG 
AAGGCTGCTGAAAAAGCTGGTGCTTTACCAAGGTAAAACAGCTTCTTTGATCGGTATTGC 
ATTTGTTATCCTTGCGTGAGATAACATACTAATGTAGTTGCTAAAATCTAAGTGTTATCT 
GACGGAAAGAAATTGAAGTCAATCCTAGCTCGATATAGGATTTCTTTTTGGAATTATCAT 
ACCACCTTTTTCATGGTTTTTGAAAACTGAAGGTCTAACTGGGTCAACATTATTTGCAGC 
CATGTCCAACTTGCTGCAACATCATTGCCCATATCAGGAACGAAAGCTCAACCAAAGAAA 
ATTGGAAAGGATGAACTTGGAGATGTAGCAGGTTTAGCCGCTACTTCAACCGCTAGTGGT 
GGAAAATTCGATAAAAAGTTGCCTGGAGAAAAACCTCCAAAGAAGCAGGGCAAACATCAC 
AAGGTAATTTAGTAATCTTGTCCCTCCTTTGATAATTTGATTACTAAATGACCATATCTG 
TTGATGATATTTGTGGAATATTTGCAGTATTTACCGGTTGTATCAGGGCGTGGGGATGTT 
AACGCAGAAAAAGAACAGACAAATAATGTACTCAGCAAGATATTCTCAAAGCATTCGCAT 
GAGATCCTCAATGTTGGCAAGGTAAAACCAATTCACTTCTCAGCTCTCCTCTCTGGTTTG 
GTCTATTACCTCTGATGTTTGTATGTGAAAAGATTGTGTTAAACTGTTGCGTATAATATG 
ATTTAGGCGATAAACATGTACAACGTCAAGAAGGAGAAGAAGAAGTCAGGAAGGTCAGAC 
AAGTTGAAACCTAAGAAGGACATCACCAAGAAGCCTGCCAACAAAGCCAAGTGAAGAGAC 
TCTCCCATGTCTAATTTACTCTTCTATCTGTCTCCATCTTCTATCACAAAACAAATTTTG 
GGTTGCTCTGTTAAAGTAATACTTTATGAGTACGTTTATTTTAATCTTATTGACTTCATA 
TTTTGCACCATAAAACAATTTAAAGCTCGCAAGGTCTAGAAATCCAGTTTGATTTTCTCT 
CTAA
>AT4G08350.1 |  GTA2 (GLOBAL TRANSCRIPTION FACTOR GROUP A2) structural constituent of ribosome / transcription elongation regulator/ transcription factor 
GAAAATCGTTGAGAGTCCTTTTTCACTTCTTCAGATTTCTAGGGTTCGCTCAAACAAACG 
AAGAGAAACTCAAATTCTGTAATCTATAGATTTTGGAAATTTCCAGATCGGAACCCTAAA 
CGATGCCGCGAAGCAGAGACGAAGACGATGAATTAGACGGTGACTACGAAGCATTAGATT 
TAGAGGAAGAAGAGGAAGAAGACGAAGAAGAAGAAGAAGAGAGAGGAAGAGGTGGCGGCG 
GTTCTAGACGGAAGAGAGGAAGATCGAATTTTATCGATGATTATGCTGAGGAAGATTCTC 
AGGAAGAAGATGATGACGATGAAGATTATGGTAGTAGCCGTGGAGGTAAAGGAGCTGCTA 
GTAAGAGAAAGAAGCCATCTGCTTCTATTTTCTTAGACCGAGAAGCTCATCAAGTTGATG 
ATGAAGACGAAGAGGAAGAAGATGAAGCAGAAGATGGTAAGTACTCTTGAATTTTCGGAA 
TTCGTTTTTGTTCTTTCCATCGATTCATTTCCATTAGGTTAAGATTCGTGTTGTTTTGTG 
ATTGAGATTGGTTCTCAGAAGTCACCATTGATAAGAATTGGTTACTTAGTCACTGGAAAT 
GTTCACTAGTTGAAGGATTTTTTTATGAAATGCAGATTTTATTGTGGATAATGGAACGGA 
CCTTCCGGATGAGCGTGGTGATAGACGGTACGAACGGAGGTTTCTTCCTCGAGACGAAAA 
TGATGAGGATGTGGAAGATCTCGAGAGAAGAATTCAAGAGCGGTTCTCCTCTAGGCATCA 
TGAAGAATATGATGAAGAAGCTACAGAAGTTGAGCAACAAGCGCTTTTGCCATCAGTCCG 
TGATCCGAAATTGTGGATGGTGAAATGTGCGGTATGTGTTTTATCTTGGAAGTTAGAAGT 
CTTACTTCTGTGATACTTGGAACTGATTCGTTATGATTTTCTCATTGCAATGTCAGATTG 
GCCGTGAAAGGGAGGTTGCTGTTTGTCTTATGCAAAAATTTATAGATCGAGGAGCTGATT 
TGCAGATTAGATCTGTTGTTGCCCTTGACCATCTTAAGAATTTTATATATGTTGAAGCAG 
ACAAGGAAGCTCATGTGAAAGAGGTATTTGATGGTTACCCTGTTATATGATATAGATTTT 
TTTTTTTATTTTCTGCCAGTGATAGTGTTCGTTAGTGTTTGTGACTGGTTGTGAAGAAAG 
TACTTTTGCTGTTTTTTAACTTGTGTTAGGCAATCAAGGGCATGAGGAATATATATGCTA 
ATCAGAAGATCTTACTTGTCCCGATAAGAGAAATGACAGATGTTCTTTCTGTTGAGAGCA 
AAGCCATTGATCTATCACGGGATACCTGGGTTAGAATGAAAATCGGGACGTATAAAGGTG 
ATCTTGCAAAGGTATGATTCATTTTCATGTGTAGTCATTGATAAAAGTACCCACAGGCTG 
CTGAAGTGCAACTCCTTTGCAGGTAGTTGATGTTGATAATGTGCGTCAGAGGGTCACAGT 
CAAGTTAATCCCAAGAATTGATCTGCAGGCACTAGCCAGTAAGCTGGTATGGATTCTGTC 
CATGCATAAGATAAAGATGGTGCTTTTTATGTTTGGTAAAGATTTCTGATAGAGTAATAG 
CAAAACTTAGCCTGTTAGAGAAAATTACGAAGACTGTCCTGGCATTCTAAGGTTTTTGAG 
TGTGTTCTAGTCATTCAAACGATACAATTATTTAGACACACTTTGCTTGACTAATTGCAG 
GACGGAAGAGAAGTTTCAAAGAAAAAAGCCTTTGTTCCACCTCCACGTTTCATGAACATT 
GATGAAGCGAGGTACTCCTTTTAGATACTGTACGTTGCACTATAATATTATAAAGCCTGT 
TATGGAGAAGGGTTTACCACAGTGCTGAATTTTCAAAAATTGTCACATGCCTTTAGGGAA 
CTGCACATACGTGTTGAGCGTCGGCGTGATCACATGACTGGTGATTACTTTGAAAATATT 
GGTGGCATGCTTTTCAAAGATGGGTTTCATTACAAACAAGTATCATTGAAGTCCATCACT 
GTTCAGAATGTTACACCAACTTTTGACGAACTTGAAAAATTCAATAAACCAAGTGAAAAT 
GGAGAGGGCGACTTTGGTGGTCTGTCAACATTATTTGCAAACAGAAAGAAAGGTCATTTC 
ATGAAGGGTGATGCAGTTATTGTTATCAAGGGGGATCTGAAAAACTTGAAGGGTTGGGTT 
GAGAAAGTAGATGAAGAAAATGTCCTTATCAGATCAGAAGTGAAAGGTCTCCCTGTAAGC 
ATCCTTACTCTTTGGCTGTTCGTAACTGCTTGCATGTTTTTAAAATGATCCAGCCAAGAA 
TAACTGCCGAGATTGACTCTTGTGTTGCAGGATCCTCTTGCTGTAAATGAGAGAGAGCTT 
TGCAAGTACTTTGAACCTGGAAATCATGTGAAGGTTGTCTCTGGGACCCATGAAGGAGCA 
ACAGGCATGGTTGTCAAAGTTGATCAACACGTGCTTATCATTCTGTCTGACACGACCAAA 
GAACATGTAAACCAACTTTGTATAATGGTTTGAGCGTATGTCTGCCTAGTAGGGTTACTA 
AATCCCAAGAGAATATACTTGTAGGTCCGAGTGTTTGCTGATCATGTTGTTGAGAGTTCA 
GAAGTGACAACTGGTGTTACCAAAATTGGGGACTATGAACTTCATGATCTTGTGCTTCTG 
GAGTAAGTGGAATACCTAATCACCTTGAAGTAATGCATCTTTCCTGTTTACACGTGTATG 
AAAGCCTTATATATTTGATGCAGTAACCTGAGCTTTGGAGTAATTATACGACTAGAGAAT 
GAAGCTTTTCAGGTAAATTGTCAATTTTCCGAGAATACCACTAGTTAAGTCTACGCTTAA 
CAGCTAGAATTTGAAACTTTTTTCTTGTGGGATACTTTTCAATGTCCCAGTGGATCTAGG 
AATAACTCTGTTTGAATGTCCTTAGGTTCTTAAAGGGGTTCCTGACAGACCAGAGGTTGC 
TCTTGTCAAACTCAGAGAAATCAAATGCAAACTTGAGAAGAAAATCAATGTTCAAGATCG 
CTACAAAAATGTCATTGCTGTGAAAGATGACGTCAGAGTGATCGAGGGTCCTAGCAAAGT 
AAGTACCTTTGCTGTCTGGTTGTTGTTGCTTACCTTGCTCAATTTTCCTGATATCATATC 
AATTAATATTTATATTCTAGGGTAAACAAGGTCCTGTAAAGCATATCTACAAAGGAGTCT 
TATTTATATATGATCGACATCACCTTGAGCATGCTGGATTTATCTGCGCTAAATGCACAT 
CATGCATTGTTGTTGGTGGATCACGTTCTGGTGCTAATAGAAATGTAAGTGTCTTGTTGT 
GATGTGGCCATGTTTTGTTATATTTTCATCAAACTGTTGCTTCACCTTATCTAGCTATTT 
TTCTACTCTAGGGTGGTGATTCGCTTTCAAGGTATGGCAATTTCAAGGCACCTGCCCCAG 
TACCCTCATCTCCAGGAAGATTTCAACGTGGCAGAGGCGGAGGATATAATAACTGTATGT 
TTGATCTTTTCTTTCTATTTTGGTTATGAGTAAGAATACGTAATGTTTTGTTTAGTTGAT 
ATTTGCATTCTTCACTGGTCTGCTGCACTTAATACTTCTTCAGGATAAGAAAATATTTCC 
ACTATATATGACTTGTACATTTTTCTGGTAGTACAATGTTTTATTGCTTTCCATATATTT 
TGTGACATGCTTATACATCTTATCTACGTAAAGTTTCACATACTCTTATTTGTATCTTTA 
AATGCAGCTGGAGGGAGGCATGGGGGTGGAAGAGGACGGGGAGACGATTCTTTATTGGGT 
ACTACTGTTAAAATCCGTCTAGGACCTTTCAAGGGGTATAGGGGACCTGTAGTAGAAGTG 
AAAGGAAATTCAGTGCGTGTAGAACTTGAGATGAAGATTGTGACAGGCAAGCCCTTGAAT 
TCACTTCTCCGCGTGTGGGTTTCTACATGTCGAACGAATTCTAACAATAGTTCATATATG 
CAGTTGATCGGGGTGCAATATCAGATAATGTTGCGACAACACCGTTTAGGTAATCTACTT 
ATTTTTATATCATTGGTTATTTTGACTTCAATCATTATGAAGGACTTTGATTTTATCATT 
TGAATTTACACAGAGATACATCTCGGTATAGTATGGGAAGCGAAACACCTATGCATCCTT 
CACGGACTCCACTTCATCCTTATATGACTCCAATGCGGGACTCTGGAGGTTTGTTTTTTA 
GATCCAATATCTGTTTATTTTTAATGTTATATAACACCTCCTCTGTAATATGTTCTCAAG 
TTCCTTGGTGATTTTATGTAATTTCAGCTACACCAATCCATGATGGAATGAGGACACCCA 
TGCGTGATAGAGCTTGGAATCCTTACACGCCTATGAGTCCACCTAGGTAAGTTTGTGTTG 
CGTTTCTATTTTCAAAAGTTGATTTCCTCTTTAATCTCCTCTTGGTTCTCTTAAATGCTG 
TTGTAATTTTTGCATCAATGTGAGGTTATCTGTTATGTTTACAAACATGGCTATTGTCTC 
TCAAATTATTCTCAGAAATTCTTAACACATGTCTGAGAATTGTAAATCTTGATTGAAGAA 
TAAACTTGGATATCTCTCAAATTATGGTTGTTATGGCATCAGGGATAACTGGGAAGATGG 
AAATCCGGGATCTTGGGGAACGAGTCCTCAATATCAGGTAAGATTTATACATCTATTGTT 
TTGCTTTCAACCTTATTATTGGCTTAATGTCTCTGACATATGTAGTCGTGTTAATTACGC 
ATTAAAATCGTTTGTGTTGCACTTGTTTCCAGCCGGGAAGTCCTCCTTCACGGGCATATG 
AAGCACCAACGCCTGGCTCAGGATGGGCTAGTACTCCTGGTGGTAGTTACTCGGATGCGG 
GGACACCTAGAGACCATGGTTCAGCTTATGGTAAGATGCGTGTAATCTTTTTCAAAATGT 
TGACTTTTCTAGTCTGGCCCGTCTTTTTCTTACATACCTTGTCATGCAGCTAATGCCCCA 
AGTCCTTACCTGCCATCAACACCTGGGCAACCCATGACACCAAGCTCGGCTTCATACTTA 
CCTGGTACTCCCGGAGGACAACCAATGACTCCTGGAACTGGCCTCGATGTCATGTCTCCT 
GTTATAGGTATTGTCTATTGTCGGGGTAATAGTCAAAAGGATAAATGTTTAGTATAGTCC 
GACCTTGCATCTTCCTTCTCTCAGTCCCCCTTAGTTAGAAGTTTCCGTTTCTATGGTTGT 
TTTCTTAGCTTATTGTAAATGCAACAGGTGGGGATGCTGAAGCATGGTTCATGCCCGATA 
TTTTGGTTGACATACACAAGGCTGGAGAGGACACCGATGTGGGCGTCATCCGAGATGTTT 
CGGTTCGTCTTTTACCTTTCACCAGTTTTATTTAAATAAAGAGAACTTCTAGTGATAAAC 
AAAACCAGGAGAAAAGTCAATGATCAAAGTTACACATAGAGAAGCTCGTAGACCTTGACT 
GCGAGAAATGATTCTGTTCATGTTGAGTGATAGCTCCTTTCTAATGCTAATATTCTTCCT 
ATGTACTACTTTTGTCAGGATGGAACGTGTAAAGTGTCTCTCGGGTCCAGCGGTGAAGGT 
GACACTATAATGGCCCTCCCAAGCGAACTGGAGATAATTCCTCCGAGGAAATCCGATCGT 
GTCAAAATAGTTGGCGGTCAGTATCGTGGGTCTACAGGTAAGCTGATCGGAATCGACGGG 
TCTGACGGTATCGTTAAGATAGATGATAATCTTGACGTCAAGATTCTGGACCTGGCCTTA 
TTAGCCAAGTTTGTGCAACCGTGATACTGTTCTAATGAACGTTAACTTTTATCTTGTGAG 
ACTCGTATATTGTAATCTTATATTCCTCAATAGTTTATAAAGAAACTTTGAATCTTGTTT 
ATCATCAGAGAAAACATCTGAATCTTATCTCCAGTTTTGTGTTTTTCTTGTAATGCCTCT 
ATCTTTTCTAT
>AT2G34210.1 |  structural constituent of ribosome / transcription elongation regulator/ transcription initiation factor 
ATGTCTCAGTACTCAGACGACGATTATTCACATGAAGATGACTCGGAGATGGAGGATGAG 
GACGAAGAAGACGAATATGAACCCAGAAGTAGCCGCAAAGGAAGATCAGGGAAGAAAAGG 
GGAAGATCAAATTCAGATTCCGATGGTCGGCGAGGGAGTAAAAAGAAGTCTTCGGGCTCC 
GCCTTCATTGACTGGGAGGTTGAGGTAGATGACGACGTCGAAGACGACGATGATGATGTG 
GACGTTGAAGACGGTAAGCAACAGTTGAAATTTGGGGATTTTTCTCTTTGTTGAATTCCT 
TGATTGAATTCGAAAGTTCCAGTTTTTATTGATTTTGAAGTAGAAGAATATCACAAAGTC 
ATCTCCTTTGACTATGAATTTGCAGGTTTCATTGTAAGTGGTGAAGCTGACCTTCCTAAT 
GAGGATTCTGATCATCGTAGGCAATATTACCAACGGGGGTTTCATCCTCATGAAGAAGAT 
GTCGACGAGTTGGAAAAGAGAACTTTGGAAAGATTGTCTACGAAATATGCAAAGGATGAT 
TATGAGCTTGATGATGTTAACGACGTTGATCAACAAGCGCTTTTGCCATCAGTCCGTGAC 
CCTAAACTGTGGCTGGTGAAATGTGCGGTATGATTTCTTTCTTGTTATCTCTTAACTTGG 
ATGTTTGATTCAATTCAGAGCACTGATGTTTTACAATGGAATCACAGATTGGACGTGAAA 
GAGAAGTTGCTGTTTGTCTTATGCAAAAAATCGTAGATAGAGGATCAGAGTTCAAGATTA 
GATCTGCTATTGCTCTTGATCATCTTCAAAACTATGTATATATTGAAGCGGATATGGAAG 
CTCATGTGAAAGAGGTATTTTTATGGTTTGTCCTGTTTTCGTAGCAATATTTTGATGTTT 
TGACTATAGTTTGATGATATATTTTCCTCTGTGGTATAGGCTATCAAGGGCATGCGGAAT 
ATTTATGCTAATCAGAAGATTTTGCTTGTCCCCATAAAAGAAATGACTGCTGTTCTTTCT 
GTCGAGAGTAAAGCAATCGATTTATCCCGTGACTCGTGGGTTAGAATGAAACTTGGGATA 
TATAAGGGTGATCTAGCTCAGGTACGATCCATTTTTCATGTGTTTTAAGTGTTCAGAGTT 
CTCTGAAACCTTTCTGAAATTTAAGTTTGGTACAGGTGGTTGATGTTGATAATGTACGTA 
AGAGGGTCACAGTCAAGTTGATCCCAAGAATTGATCTGCAGGCTCTAGCCAATAAGCTGG 
TATACGACCTTTTTATACTTAAGTGTAACAAATGCTGTGTATTGTGAAACATACTTCTTC 
CTATCTTATATACTTAGGGTATATGTAGGAAGGAACAGAGAATGTCAAGAAGAAAGCTTT 
TGCTCCACCTCCACGTTTCATGAACATTGATGAGGCAAGGTACTGTTCCAGACTTCTGGT 
GAAACTATCCTATGTTTTTCTAAGCAATAATTGTGTTCTTTGGTTATGATTTATCAGTAT 
TTGTAACGTGATTATAGGGAACTTCACATACGTGTTGAGCACCGGCGTGATCCAATGACG 
GGTGACTACTTTGAGAATATCGGTGGAATGCTTTTCAAAGATGGTTTTCTTTACAAGAAA 
GTATCGACGAAGTCCATTGCTGCTCAGAATGTAACACCAACCTTCGATGAACTTGAAAGA 
TTCAAGAGACCAAATGAAAATGGGGAGATCGACTTCGTTGATGAGTCGACTTTATTTGCA 
AATAGAAAGAAGGGTCATTTCATGAAAGGTGATGCGGTTATTGTGATCAAGGGGGATCTT 
AAAAACTTGAAGGGCTGGATTGAGAAAGTAGATGAAGAGAATGTCCTTATCAGATCAGAG 
ATGAAAGATCTTCCTGTAAGTATCCAAAATCTTCATCTTTTCATAAACAACATATTTGTT 
GCTAAAATGTTGTAGCCAGTAAAAGACTGTATTCACTGTTGCAGAATCCTATTGCGGTTA 
ATGGGAGAGAGCTTTGTAAATACTTTGAACCTGGAAATTTTGTGAAGGTTGTGTCTGGCA 
TCCATGAAGGAGGAACTGGCATGATTGTCAAAGTTGATCAGCATATGCTTATCATTCTGT 
CTGATACAACCAAAGAACATGTAAGGCATATTTTGTTTAAGTTGTGTGTTAATTTCTGAC 
AAGGGTAATATAACGCATGGGGATGATATTTTATATGTAGATTTGCGTCTTCGCTGATCA 
TGTTGCCAAGAGTGCAGAAGTGACTAAAGGTGTCACAAAAATTGGGGACTATGAACTTCA 
TGATCTTGTGATTCTAAGGTAAGTTGAATGCGCCCAACCACCTCTAATTGATATCATTTC 
TATCGGTATGATAGCTTTATATTACACGATGCAGTGACTTTAGCTTTGGAGTAATCCTAA 
AACTTGATAGTGAAGCTATCCAGGTAACTTACCAATCATACAAATGCCTCTTATCATGTC 
AATGCTATAATGTTATTATTTATTTCAAGATTTGCTGTAACTCCATTTTATTTCAGATTC 
TTAAAGGGGTTCCTGACAGCTCAGAGGTCTCTATTGTCAAAGCCAGCGAAATAAAATACA 
AAATTTGGAAGAAAATCAATGTGCAAGACCGTTACAAAAATGTCGTCGCGGTGAAAGATG 
TTGTCAGGGTCATTGAGGGTCCTAGCAAAGTGAGTTCCTTTGCAGTCTGGTCGTTTTTTT 
GTTAGCAAACTCTTTAAATATCATTTGATAAGTCTTATACCGATTTATATATTTGTGATA 
GGGTAAACAAGGTCCAGTGGTGCAAATCTACAAAGGAGTGTTGTTTATACATGACCGGCA 
TAACCTTGAACACACTGGATTTATCTGCACTAGATGCTCATCTTGTGTTCTTGCTGGTGG 
CAATTTCAAGACACCAGCCCTGGTTCCTCCATCTCCAAGGAGATTCCAACGGGCAGACAT 
GGGATATAACCGTATGTCAGATTTCTTCGTATTATTTTGGTTCTTTATTCTTGACTCGTC 
CAGTGCATGTTAAAGAGGGGCCCCCCTACGTATGACTTGTAAATAGGTTTAGTCTGAAAC 
TGTTATGCGTAACTTAGAATGCATTCGTTTACTGCAGCTGGAGCTGGAGGGAGACATCAG 
GGTGGACGAGGGAGAAGGGGTGACGATCATTTGGTAGGTACTTATGTCAAAATTCGTCTG 
GGGCCTTTCAAGGGATATAGTGGGCGTTTAGTTGAAGTCAAAGATAAGCTAGTGCGTGTG 
GAACTTGAGGCCAAGATTGTGACAGGCAAGCTCCACTGTAATTTCACTTCTATTCACAGC 
TGGTTGCTGAATGTTGAATGAATTCTAACTCTTTTTGTATGAACAGTTGAGCGGAAGGCG 
ATATCAGATATGACTGATAATGTAGTCGCAACCCCGCAGTATAATATGGGAAGCCAAACT 
CCTATGCATCCTTCCCGGACTCCACTTCATCCCTGTATGACTCCAATGCGGCATTCTGGA 
GGTTTGTCACCTTAATTTCGCAGTTTCAAGATCCAATCATTTGTTTGTGTTTTTGTTTCT 
CATTTGACAACATGTTTGATATGTTTATGTAAAAAATTCAGCTACACCTATCCATGATGG 
AATGAGGACACCTATGCGTGGTAGAGCTTGGAATCCTTACATGCCTATGAGTCCTCCTAG 
GTACTTTAACATGGCCACTCTTCATTTATTCCCATAAATATTTCACATTCTGAGCAAGTG 
TCTCAAACCAAAATATGGTTGTTGTGTCTCAGGGATAACTGGGAAGATGGGAACCCGGGA 
TCATGGGGAACAAGTCCATATGAAGCAGCTACGCCTGGATCAGATTGGGGTAGTAGTACT 
CCTGGTCGTAGTAGTTACAGAGATGCCGGAACACCAATAAACAATGGTTTTGTCTACTAC 
CTTTTATGCCTTAACGGTTTCTTGCTTTGACGAATCTTATTCTCACACACTTTTCTCATG 
CAGCTAATGCCCCAAGTCCTATGACACCAAGCTCAACTTCCTACTTACCTACCACACCCG 
GAGGACAAGCAATGACTCCTGGAACCGATCTCGATGTCATGTCTCTTGATATAGGTGCCT 
GCCTATCTCTTAGTTTTATACCATTGGTGTTTTTGATTCTCATATTCTTAACTCTACCAG 
GTGGAGATGCAGAAACCAGGTTCATACCCGGTATATTGGTCAATGTACACAAAGCTGGAG 
AGGATAGAAATCCCGGTGTTATTCGAGATGTTCTTCCGGTTTGTCCTCTTTAAACTACAC 
AGAAGAATGTTGTATTGGAGTAAACATTTTCCAGTTTACTGATTATGTAAGCCTCTTTTT 
CCTTTGTGGTCATCATCAGGATGGCTCCTGTGTAGTCGCACTTGGACACAGAGGTGAAGG 
CGAGACGATAAGAGCGACACAGAACAAAGTGAGCCTAGTTTGTCCGAAGAAGAACGAACG 
TGTGAAGATTCTTGGAGGCAAGTATTGTGGTTCAACAGCTAAGGTCATTGGTGAGGACGG 
TCAGGACGGTATAGTTAAGCTAGATGAAAGTCTCGATATCAAGATATTGAAGCTGACTAT 
ATTAGCCAAGTTAGTTCATGAGTGA
>AT3G18600.1 |  DEAD/DEAH box helicase putative 
TGTCTCCGCGCCGCGTTATCACTCTTACGTTTCTCTCTCTCTCTCAACTTCTTCCACAGC 
AAATTTCTTCGATTCTCTGAGCTCTCTCCCATCCTTTTCAAGTGGCTTCGTTTCTAAAAG 
TAAGTTTTTTTAATCTATGGGTTCTCTTCAAGTGGTTGTTCCTTTTCGAATCTCTGTACC 
CTAGATGAAATCGAGTACAGCTTTAATTACTCTGTTTTTCTTTGGGATTGCTCTGTTTCC 
CTTCTCTTAGAGGTGTATAATTACTCTCAAATTTGTTGTTTTTTTCATTCATAAATTCAT 
TAATATTGCTGCAGAATTGATTGGTTGAAGAAAGTGGAAACATGGTTGAATCGGACAAGT 
CATCCGTTGAAGAGCTGAAGAAGAGGGTTAGGAAGAGAAGCCGTGGGAAGAAGAATGAGC 
AGCAAAAGGCTGAAGAAAAAACCCACACTGTAGAGGAAAACGCTGATGAAACGCAGAAGA 
AGAGTGAAAAGAAGGTTAAGAAAGTGAGAGGCAAAATCGAGGAAGAGGAAGAAAAGGTGG 
AAGCAATGGAAGATGGTGAAGATGAGAAGAATATTGTGATTGTCGGGAAAGGGATAATGA 
CTAATGTGACTTTTGATTCCCTCGACTTATCTGAGCAAACTTCTATAGCTATCAAGGAGA 
TGGGCTTTCAGTACATGACGCAAGTACGTTAATTTTAACCTTCTTCTCACTACATGGTCT 
TGTGACTTGTTGTAGAGTATGTTTCTAAGTCTCTTAATCATTTTTTGCTATTATTCAGAT 
TCAAGCTGGATCAATTCAGCCCCTTTTGGAGGGGAAGGATGTTCTTGGTGCTGCCAGAAC 
TGGTTCTGGTAAAACTCTTGCTTTTCTCATTCCGGCTGTTGAGTTGCTGTTTAAAGAGCG 
TTTCTCTCCTCGCAACGGGACTGGTGTGATTGTTATTTGCCCCACAAGGGAACTTGCTAT 
CCAGGTAATTTTCGTTTTTATTAACTTAAGGCATTTTCAACTTGGTAGCAACAACCATGC 
TGTCATTTCGAGTAGATATGTCCTGTAATTGTTGTAATGCGCTAGGTAGATCAGATCTGT 
AAGGTTCTCGTTTTTCTTCTAGCTGAATCATTGATATTGCTTTGTGTTTGTAAAGTATGA 
GCATCGTTGTATGTTATTGCGGCCTCCCATTCTGGTTTTCACTTTACTATTTTGATATTT 
TAGACTAAAAATGTGGCGGAGGAGTTACTCAAGCATCATTCACAGACAGTCAGCATGGTT 
ATTGGTGGCAATAACAGAAGGTCGGAAGCACAACGCATTGCCAGTGGTTCAAACTTGGTG 
ATAGCAACTCCTGGTCGTCTTCTTGACCATCTTCAGAATACAAAGGCTTTCATTTATAAA 
CACTTGAAGGTACTGTCCTTTCCATTGTTACATTTGGCGTGTTGTCTAGTCTTCTTTGTG 
TGATGTAAATGCAAAAAGCTTTACTGTTGAGCCACATGGCCATAATTTCCAGTAAACAAA 
CAATATTATGTAAAGGAGCCCATAGATAAATATTTGAACTGTTGACAACAGCTTATGCTA 
TATTATTTCTGTTGCATCAATGTTAGACTTACAAATGGAATACTGCCGATGTGATCCACA 
CATATTCCGTGGTTTGTTTAGGTTTGTAGCTTGGGCTGTAGCAATACTAATAGTTGAAAT 
GTAAATACACAGCTTTATGCTATAGATGACTCTAATAAATTTTTATTGCCATATGTATTC 
CCTACAAATTGCAGTGCCTTGTGATCGATGAAGCTGATAGGATACTGGAAGAGAATTTTG 
AGGAAGACATGAATAAGATTCTAAAGATTTTACCAAAGGTAATTTCATCTTTTTGGGTCT 
AAATTAAGGTCTAACCAAAAAAGATATGGGAAAACTAGATGAATTCATTTTGGCTCACCA 
GTATCAGAGACTTCATTTTTATCTCTTTTATAGAAACATGCCAATATCATGTGAATGCCC 
TTTGGTGTTGATATTCTCCTCATCCGAAACAACTACCAAAGTAGTTTCGTAGGAATTTTG 
TTTGTTCAACTGTCAACACAACTTATTTGCCAAAATTTCTGGCATTACTGTGTATTTGGC 
TTTTGCGCTGATTGAAGTTCTTACCATGTTTCTGCAGACTAGGCAAACTGCGTTATTCTC 
TGCCACCCAGACCTCTAAGGTATTTTTCTGTTGGCTGTTGTATGGTCATTATTAGTATCT 
TTTGTTTCTTATGATGCATTGTCTAATCTTACAGGTTAAAGATCTTGCTCGGGTGTCATT 
GACATCACCTGTTCATGTGGATGTCGATGATGGCAGACGCAAGGTATGAATTAAATACTC 
TGATAATGGATATTAAGGGAGCATGGAGAGTTTTCTTATCAAGTTTCCAAAACTGTTAGG 
TGACAAATGAAGGATTGGAGCAAGGCTATTGTGTTGTTCCGAGCAAACAAAGACTTATCC 
TTCTAATTTCCTTTTTGAAAAAGAACCTAAATAAAAAGATTATGGTATTTTTCTCGACTT 
GCAAGTCGGTACAATTCCATACGGAAATCATGAAAATAAGCGACGTGGATGTCTCTGATA 
TTCATGGAGGCATGGATCAGAACAGAAGAACTAAAACCTTTTTCGACTTCATGAAAGCAA 
AGAAAGGTATCTTGTTATGTACTGATGTTGCTGCTCGTGGTCTCGATATTCCTTCCGTGG 
TACGTCTCCACATCTATGTTCTTGCATTGGTTTTGTACGCATTTACTTACCAATGGTTTT 
ATGGAAATCATATTTCTGGCGATTTTTATTATCTGTAGGACTGGATTATACAGTATGATC 
CACCAGACAAGCCAACGGTAAGACAAACACTTCCTCATATTTGGTTTTGCATATCCCTTT 
GCCTCTGTATGTGTATCTTAGATTGTTCTTTGGTGCTGTTATTTCAGGAATATATCCATA 
GGGTTGGTCGAACAGCCCGTGGAGAAGGAGCAAAGGGAAAGGCATTACTTGTCTTGATTC 
CTGAAGAACTTCAGTTTATTCGCTACCTGAAGGTAAGAATGGTTATTGAAATTTTATTGT 
GGGTTAACCAACTTGAGTTTTAATTTGTAATTTAACCCTCAGGCTGCGAAAGTACCTGTT 
AAAGAGCTTGAGTTCAATGAGAAGAGGCTTAGTAATGTTCAATCTGCGCTGGTAAGACTT 
CTGATTCAGTAATGTTGTGGGTTTAATAACTTTCCATTTGTAATAACAACGTTTCTTGTT 
CTGTCTCACAGGAGAAATGTGTTGCCAAGGACTACAATCTGAACAAGTTAGCCAAAGATG 
CGTACAGGGCTTATCTCTCAGCATACAATTCACACTCTTTGAAAGACATCTTTAATGTTC 
ACCGACTTGACCTCCTGGTAAAAGAAACTTAAAAAACAAATATTCTTCCAAAGATTTTTG 
TTTTCATAATAGCTAATATCTCGTGTTTTGACGTTGAGTATCACAGGCTGTTGCTGAATC 
GTTCTGCTTCTCTTCGCCGCCTAAAGTGAATCTGAACATAGAAAGTGGAGCTGGGAAGGT 
GAGGAAGGCGAGAAAGCAGCAAGGTCGCAATGGCTTCAGTCCTTACAGTCCCTATGGCAA 
GTCCACACCTACAAAGGAGGCATAAAGTGTCATTTGTTTACAAAATTACTATTTTGCTCC 
GTAGTTTTGACTAATTACCACCACCAAGTTTTGTTTAAAGAGTAAACAGTGCATTTGATT 
TAAATGAAATGTTCCTTGGCTACTATTAATATTTCAGTTCTATGGGTTATAACTTTTT
>AT5G58420.1 |  40S ribosomal protein S4 (RPS4D) 
CGTGCTCTCACTTTTTCTCTCAAGTGGTTCGGAGCTGTTTCTAAGAAAACAACAGGTAGT 
TCGGATCGGAGCTACGCTTGCAAAACTCAAAACATGGTTCGTCATCCTCTAATCTCTATC 
TCTTTCTTCTGAGCTTAGTGATTGTTTACATCTAGATAGTTCCTTAACTCGACTCTCGTT 
TCTGGTGGGTTTGTGTTAGAGTGACTTAGAGAATGGGTTTTGTTAGCAATTTGATTGATT 
CGATAACTTGTGAATATTATATGCATCATGGTGATTCTCCTTAGATCTGAGCTCATTAGA 
TCTCAAATGTGTCGCTGATTTAGGTCATGATGATGATATACATAGCAGTAGAGATTTCCT 
TAATAATAACATCTCTTAACATTTATTTTGTTAAATTTTACAGGCGAGGGGTTTGAAGAA 
GCATCTGAAGAGGCTTAATGCGCCTAAGCATTGGATGCTTGACAAACTTGGTGGTGCATT 
TGTATGTCTTTTACTCTCTCTCTTCTTGTCTCAGTTTTGATTCAATTTTATATATATCTC 
TTGGGTTTGTTTGAATAAGTATGTTCATTTCTGGTTCCACACAGGCCCCAAAGCCGTCTT 
CTGGACCACATAAGTCAAGGGAGTGCCTTCCCCTCGTCCTTATCATCAGGAACAGGTTGA 
AGTATGCTCTTACCTACCGTGAAGTGATTTCAATCTTGATGCAAAGGCATATCCAAGTTG 
ATGGGAAAGTCAGGACGGACAAGACCTACCCTGCTGGTTTCATGGATGTTGTGTCTATCC 
CCAAGACCAATGAGAACTTCCGTCTTCTCTATGATACCAAGGGACGTTTCCGTCTCCACT 
CCATCAAGGATGAGGAAGCAAAGGTTTGTTCTCCTCTTGTCATTGTTTAGTTGTCTTTTA 
GAGTGATACTTGACATGATGGGGATATGTTGTGTTCTAACATTATGTCTTCTATTTGTAC 
AGTTCAAACTTTGCAAGGTTCGATCTATCCAGTTTGGACAGAAAGGCATTCCTTACCTGA 
ACACTTACGATGGTCGCACCATCCGTTACCCTGACCCGCTCATCAAGCCTAATGACACCA 
TCAAGCTCGACCTTGAGGCCAACAAGATTGTCGAGTTCATCAAGTTTGATGTTGGCAATG 
TTGTGATGGTTACAGGAGGTAGAAACAGAGGGCGTGTTGGTGTGATTAAAAACCGTGAGA 
AGCATAAGGGAAGCTTTGAGACAATCCACATCCAAGATTCAACAGGACATGAGTTTGCAA 
CAAGGTTGGGTAATGTGTACACCATTGGCAAAGGAACAAAGCCATGGGTGTCTCTTCCCA 
AGGGCAAAGGTATCAAGCTGACTATCATCGAGGAGGCCAGGAAGAGGCTTGCTAGTCAAC 
AGGCTGCTTAATTTTGTGATTTTCAGTTCTTTGTTATGCTTCTTTAGACGTTTCATATTT 
CCTAGACTCACTTCGTTTCTTTTGGTACTCTGCTCAGTTTTGAAACTTCTCTTATATTAT 
TTATTTCAAGAGTTAAAAACATCAAATATCCATTGTGTCCTCTCTTGTTTTTTACTATCT 
TCAAGAGTTGGTACTAGTTGGTTATGGTT
>AT2G17360.1 |  40S ribosomal protein S4 (RPS4A) 
ACACATGTTAAAAACTTAAAATTAGGGCTTTGTGTTTCGCTTCTTCTCAAACCCTAGAAG 
ATATAATTGAGACTGGCTTGCTTAGCCGCGGAGAACTCAGAACTCATTCGCTGCAAACAT 
GGTTCGTAATCTTCGTCTCTTTCTCTAAGTCTCGTATTCACAAGCGTATTGCGTCATGTG 
TTTGTTTTGGTTTTGGATAGTTTGTCTCCATCTGTGAATTCATTTTGTGCGGGATTATAA 
AATCTCTCTTTGTAATCTAGATAGCATTTCCATGTAATTATGGGTAATTGTTAATGTTTA 
TAAAGTGAATTCCTTTGTGCGATCTGTAAAATGGGTTAGGGATTGATATTGAGATCTCAA 
AAGATAGGACTCAATTAGTCAGATATGAAACCTCCCTGGCGTTATTCTCTTGTTCTGTGA 
CTTGAGGTCTTGAGTGATGAGACTTTTAGTGATTGAGCTATTATAAACATTTATTGTGTT 
TTGATTTTTATTTTTGTTCGATATTCTTTTGCAGGCAAGAGGTTTGAAGAAGCATTTGAA 
GAGGCTCAATGCTCCTAAGCATTGGATGCTTGATAAACTTGGTGGTGCCTTTGTAAGTTT 
CACTTGTGTTGGATTGAATCTTATTAGAGCTTAGTTTTCGTTTGATTCGGTGCTTATAAT 
GCTATTTCTGTCCAGGCCCCCAAGCCGTCTTCTGGGCCACACAAGTCTAGGGAGTGTTTA 
CCCTTGGTCCTTATCATCAGGAACAGGTTGAAGTATGCTCTGACATACAGAGAAGTGATT 
TCGATCTTGATGCAAAGGCATATTCAGGTTGATGGGAAAGTGAGGACTGACAAGACTTAC 
CCTGCTGGTTTCATGGGTGAGTCTGTTAGTGTTGTGATACGTTTTCAGAGTCTGGCTATA 
GTCCTTGTGCTGATTGATTTTTATGCTTCTTGTGATCAATGATCTAACTAAGGATAAATA 
TTTATTTACAGATGTTGTGTCTATCCCCAAAACAAATGAGAACTTCCGTCTTTTGTATGA 
CACCAAGGGACGTTTCCGTCTCCACTCCATCAAGGATGAGGAGGCTAAGGTTTGTTCTCC 
TAAATCTCTTACATTGCCATATACTGAATCTGTCAAAACAAAGTCAAGTCTTTATTCATT 
GCTCTATACTTACATTAGAGGTCTGCTGAATTTGCATGTTGATTACCAGTTTGTAATATA 
TTCCAACAAGTATCCTCTTTTGTTGTTGTGCAGTTCAAGCTTTGCAAAGTGAGATCGATC 
CAATTTGGTCAGAAGGGTATTCCCTACTTGAACACATATGATGGTCGCACCATCCGTTAT 
CCTGACCCGCTCATCAAGCCTAACGACACCATCAAGCTCGACCTTGAGGAGAACAAGATT 
GTGGAGTTCATTAAGTTTGATGTGGGCAACGTAGTTATGGTCACTGGAGGAAGAAACAGA 
GGGCGTGTTGGTGTGATTAAGAACCGTGAGAAACACAAGGGTAGCTTTGAAACCATCCAC 
ATTCAAGACTCAACAGGACATGAGTTTGCAACAAGGTTGGGAAATGTGTACACAATCGGT 
AAGGGAACAAAGCCATGGGTGTCCCTTCCAAAGGGTAAAGGTATTAAGTTGACCATCATT 
GAGGAAGCCAGGAAGAGACTTTCTGCTCAACAAGCTTGATAGTTAATACTATGCTCTGTT 
TTCCAGTTTCAGAACAAACCATGCTTTAGTTTGCAGCTTTTCAATGAGTCACTTTTGTTT 
TAAAACTTATCTTTTCGGATTGTTATGAGCTATATTTTGGACCTTTTGCGCTATTAATAT 
TAAGTTTGAACTCAACCTTGTTTCTTCAGATAGT
>AT1G18540.1 |  60S ribosomal protein L6 (RPL6A) 
CTGATAGATTTTACACCACCGAAGCCGAAAAAATGCCGGCGGCGAAGAGGACTCCCAAGG 
TTAACCGTAACCCTGACCTAATCAGGGGAGTTGGAAAATATTCGAGGTCTCAGATGTACC 
ACAAGAGAGGTTTGTGGGCTATCAAGGCCAAGAACGGTGGCGTTTTCCCTCGTCACGATG 
CTCAGCCAAAGGTCGACGCTCCGGTTGAGAAGCCTGCCAAGTTTTATCCGGCGGAAGACG 
TCAAGAAGCCGCTTGTTAACAGACGCAAGCCTAAGCCTACCAAGCTAAAGTATTTATCCA 
TCTTCTTCTTCGATTGGTTTTTAATTTTCATTTGAGTTTGATTCCGCTAGATCTAGTATT 
AGAATGGTTTTGGATCTACTGGTGATATAAGAGAGACCATACAAATTGTTAGGATTTTTA 
GAAATGTAGGATTCCTAGAGATTATGGCTATGCTTCATTTTTGATATGAATATGGTTTTG 
TTTATCTCTGTGTTGCAGAGCCAGCATCACTCCAGGAACTGTGTTGATCATTCTTGCTGG 
TAGATTCAAGGGTAAGAGAGTTGTCTTCCTCAAGCAACTTTCTTCTGGTTTGCTTCTTGT 
AACAGGTGAACTCTTATCTCTCGATGGTGTTGGTTTGATTGTTCAATTTGGAACCTATGT 
TAATGTTTGTCTTTGTTGATTTGGTCATTTCAGGACCATTCAAGATTAATGGTGTTCCAT 
TGAGACGTGTTAACCAAGCCTATGTGATTGGAACCTCCACAAAGATTGACATTTCTGGAG 
TCAACACTGAGAAATTCGATGACAAGTATTTTGGAAAGGTTGCTGAGAAGAAGAAGAAGA 
AAACAGAAGGCGAATTCTTCGAAGCTGAGAAAGAGGTATACAATCATCTTATGGATATTT 
GGTTTTATCCAAAAATGGTTATTATGTGTTTTCTTGTCTTTGTACCATTACCTAATTGAA 
AACTTTGGGTTGAACAGGAGAAGAAGGAGATCCCACAGGAGAAGAAGGAAGACCAGAAAA 
CCGTTGATGCTGCTCTGATCAAATCCATTGAAGCTGTCCCAGAGCTCAAGGTTTACCTTG 
GAGCCAGGTTCTCATTGAGTCAAGGAATGAAACCACATGAGCTTGTTTTCTAGATTTCGT 
ATTGTTTCTCAAATTTTAAGAATATCTGTTTCCCTGAGTATTTTCATCTTTAATCGTCCT 
TGGATCTTAAAGACTATTTTCTCTGATTTTATATATCAAATTTTCGAGCAATCTAGCTTT
>AT5G09650.1 |  AtPPa6 (Arabidopsis thaliana pyrophosphorylase 6) inorganic diphosphatase/ pyrophosphatase 
TTTTTGTGTTCTGTCTTTCTTGGTGGTGTGATAAAGAATAAAGAGAGCCAGTCGAGGGTA 
AAACGAAAGGCCACCATTTTCAATCTTTCCACAATAATGGCGGCTACTAGAGTGTTAACT 
GCAGCGACGGCCGTGACCCAAACCACCTCCTGTTTCCTCGCCAAGCAAGCTTTCACTCTT 
CCGGCGAAGAAATCCTGCGGCGGATTTGGTGGTCTCTGCTTCAGCAGAAGAGCTTTGGTG 
TTGAAATCTAAGAGACCTTTCTCCTGCAGTGCCATTTACAATCCTCAGGTTAAGGTTCAA 
GAAGAAGGTCCGGCCGAATCCCTAGATTATCGAGTTTTCTTCCTCGATGGTTCTGGAAAG 
AAGGTACCTTTTGTTTCTGACTTCTCCGTTTTCTGTCTCCGGTGTTTAAAATCTTAGCTT 
GGTTTACTGGGGAAGTATTGAGGAATGGATAACGTTTGCACATTGTTATTTTGGAATAAT 
CTTTGGTTAAATTGGTTACGAATAGATGAATCATAATGAAGAAATCTTCTCCGAGTTTGC 
AGTCAATGTTTTAAAGATCTACATTGTCAATTTGCTTTGAAGTGTTCATCACTCTGTTCT 
GTGTTCAAGGTTTGGTTATGGGGACAGATTGAGTAAGTGGATTATTTGTTTACCAACATT 
TTTGCTAACCACTAAGCTCACTATAATAAAGAGATCTTCTCTGAGAATGCAACCACTGTT 
TCTAACATTTTGATTGTTGATTGAAATACTTTTTGGTTTATTACTCTGTTCCGTGTTTTA 
GTGAAAGGCTGGATAAAGATGGTTTCCAATTGTGTATAGGTTTCTCCATGGCATGATATA 
CCATTGACCTTAGGCGATGGAGTTTTCAACTTTATAGTTGAAATACCTAAAGAGTCAAAA 
GCAAAAATGGAGGTTGCTACTGATGAAGATTTCACTCCTATTAAGCAGGATACTAAGAAG 
GGGAAGCTCAGATATTATCCGTAAGTAAAATATATTTCTCCCTTTTTTATAAGTTTTGCT 
TTGTTTTAAGCTAATTTCTTAGAGGCTTCAGCATCCATTGATGACAAGTTAGCTCATTTT 
CTGAATTACTATTTGTTATAGACTTTGAAATCAATGACTTATGGAATGGATTTGATCCAG 
GTATAACATTAACTGGAACTATGGGTTGCTTCCTCAAACATGGGAAGATCCATCTCATGC 
AAATTCTGAAGTTGAAGGATGTTTTGGGGATAATGATCCAGGTAAATCTGTGATACTCTT 
TCATGTAATGGAAAATTTAATCACTTTGGAACAAAGAGATTATGCTTATTCTTGGTTTGG 
ATATATGTAGTTGATGTTGTTGAGATTGGTGAAACACAAAGGAAGATAGGCGATATTCTA 
AAGATAAAGCCTTTAGCTGCTTTAGCTATGATTGATGAAGGTGAGCTAGACTGGAAGATT 
GTTGCCATTTCTTTGGATGACCCAAAAGCTCATCTTGTGAATGATGTTGAAGATGTTGAG 
AAACATTTCCCGGTACGAGCTACTACTAGTATAAACCATTCCCCATACGTTCATGCAAAA 
ACAAATTTCTGTTGTTGACTCTAAATCTGTTGATCAGGGTACACTAACAGCCATTAGAGA 
CTGGTTTAGAGACTACAAGATCCCAGATGGAAAGCCTGCTAACAGATTTGGTCTTGGAGA 
CAAACCAGCAAACAAAGTAAGTCCTTCTTTTTAATCTTCTATAGTGGTGGTGGTTTATGT 
TTGGTACTGAAACTGAGAAGAGCTATACACTTGTGGTTTGTCTGTTACAGGACTATGCTT 
TGAAGATCATCCAAGAAACAAATGAATCATGGGCTAAACTTGTGAAGAGATCAGTTGATG 
CTGGAGACCTTTCACTTTACTGAACATATTTTGCAATGTCGACTTATGAGGTCGAATAAT 
GAATAGACTCAAGATTCCTATATCATTCTTGTTGTTTCCTTTCAATTGAGATGTAAACAT 
TGGGATTTGGATTTTGTTTTTCACCATTGATGACTGAGAAGTAATAAAATGACTTTCTGC 
TTTGGAAATATTTAAATGGAATATG
>AT1G54080.2 |  oligouridylate-binding protein putative 
ACTTGATTTTGAACCCTAGCTTAAGGGGAATTTTCTCGGGAAACAAAAGAGATATTTTTA 
TCGCAGTGAGAAAGAAACACAAAAAATGCAGAATCAAAGGCTTATTAAGCAGCAACAACA 
ACAACAACAACAGCAACATCAACAAGCTATGATTCAACAAGCTATGATGCAACAACATCC 
TTCTCTTTATCATCCTGGTGTTATGGCTCCTCCTCAGGTTTTTTTTTTCTTTCTTGATCT 
AATCTCTTTTCATTTTCTATGTAACCTCCTTTGATTCCAAATTAGGGCTTGTTCTGTAAT 
TCCGATTGTGGGTTTTAATTCACTGAGCTCTGTTACCTAATCTTATGAATCTCTCTCTGT 
CTCTTTCTCTGGCTAATTATTATGTAAAGTTTTGAGCTTTTGATTGTGGGCTTGTGTTTT 
TTTGTTAGTAATTCGGTTTCTCTGCTGATTTTGTGTTTAATTTTGGTGGTAATGGTAGAT 
GTTCGTGTAGAAAAGGAGTGGTTTTGGTACTTGTTTCTGCAATCATCTCTTAATGTTTTG 
TTTATGGTTTTGCATTTTTGTTGCAGATGGAGCCTTTACCAAGTGGAAACCTTCCTCCTG 
GTTTTGATCCAACTACTTGCCGTAGTGTGTGAGTTTTTTATTTCAATTGGTTTTTCTTTC 
TTTCTTTCGCCTTTGGTATAATGCAGAGTTTCAATTTGTAATTGTTCTTTTATGTTTTGC 
AGGTATGCTGGAAACATTCATACGCAGGTCACAGAGATTCTTCTTCAAGAGATTTTTGCA 
AGTACTGGTCCTATTGAAAGCTGTAAACTCATCAGAAAGGATAAGGTAGAGTTTTGGAAC 
CCGCCCTTCTGTTTTTTATTCGAATGAAGCTTTTCGGTAGTGTTCTTTGAAAGCTAACTT 
CTAGACATGAATGTTTTACACTTTTGCAGTCATCATATGGATTTGTTCACTACTTTGATC 
GAAGATGTGCTAGTATGGCTATAATGACTCTTAACGGAAGGCATATGTAAGAATCTAACA 
TTGATACTTCATGCTTTGATTAGTCAATTTATTCATGTGTTCTCTTAGATTATAATATTG 
GATTTCACAGATTTGGACAGCCTATGAAAGTTAATTGGGCGTATGCAACTGGTCAAAGGG 
AAGATACATCAAGTAAGTTCTTATGAGCACGGATTGATTGTCAAGGACTTTCTTTTTGTT 
CTTTGAGTGAGGCATGGTACTGAATGGTTTTGGTTTCATGAAATGCAGGTCATTTCAACA 
TTTTTGTTGGAGATCTTAGTCCAGAGGTTACTGATGCAGCATTGTTTGATAGCTTTTCTG 
CTTTTAACAGCTGCTCGTAAGTTCTTGTGCTTGGTCTTCTGATTTTAGTTACTAGCTGGT 
TACAAAAATGAAAATCTTGTTACACAACTACGGTGTACGCATATATCACTATGTGTTACA 
AGATTTTCTTTAATGATTAAGCTTATTTGTTTAAACAGTCTATCAGAATCTTTGATTTAA 
TATCTATAGTTCTTATTATAGGGACGCAAGAGTAATGTGGGACCAGAAAACTGGACGCTC 
AAGAGGCTTTGGTTTTGTTTCCTTCCGTAATCAGCAGGTTTTATATCCTTTTAATCATGA 
GTGACTTTTTTTTTAGCTCCATTCATTGTTTACATTGATTTTTAAATGTTTCTGTAATTT 
GCAGGATGCTCAAACTGCCATAAATGAGATGAATGGTAAGAATTATCATATACCAGCTTG 
TGGTTTAGAGCTTTAAGGTTCCTTATTGTGAACTTTGGTTTCTACATACTGATATTGTAT 
GATGCACTTAGCTCTGTAATATTTGTTGTATCTAGAAAGGTGAAATTTGGTCAGGAATTG 
TGTTCTTGGAGCTTATTGGTTGGTGAACAACTGTTGAAGTTACATGTTGCTTGTGCCGAT 
TATGATTTATCTCTATAATTGAGCTATTTATCTCAATTCCTAGCACTTGGTTTCCCATTA 
CTAGAACCTTGGCTTGTTTTGTGTATTCTCAGGTAAATGGGTAAGTAGCAGACAGATCAG 
ATGCAACTGGGCGACAAAAGGTGCTACTTTTGGCGAGGACAAACATAGCTCTGATGGAAA 
AAGTGTTGTAGAACTTACTAACGGATCTTCAGGTTTTCTTTTGTTTACTGTGCAACTTCT 
AAAATTTTTATTTTCTTCCTCAAAGCAGATTTTCATGGAGATTACATTGATATAATACTT 
GATTTTGCAGAGGATGGTAGAGAGCTGTCAAATGAAGATGCCCCTGAAAACAATCCTCAA 
TTTACAACTGTCTATGTAGGAAATCTCTCTCCAGAAGTAAGTTGTCAACTTAACGAATTG 
TTCTTTATAAACACTGCAACAGCTCCTGGGGTTTTTCTTTTTGGCGCCTCGTGACAGTTG 
TCAATCTTGCAGGTAACTCAGCTTGATCTACACCGTCTATTCTATACCCTTGGTGCTGGA 
GTGATCGAAGAGGTCCGTGTCCAGCGAGACAAAGGGTTTGGTTTTGTGAGATATAACACT 
CATGACGAGGCTGCTCTTGCTATTCAGATGGGCAACGCTCAGCCTTTCCTCTTTAGCAGA 
CAGATAAGGGTATTTGCTTCAGTTAATGTTACATAGATCTATCTGTTGTTGCATCTACGT 
AGACAACCAAAGTCTGCTTGTAATTGGTTTTTACCAGTATTCCCCTAAACCCATTTCCTT 
GTTTCTGTGATTTATTGCAGTGTTCCTGGGGAAACAAACCAACTCCATCAGGCACAGCCT 
CAAACCCACTTCCCCCACCAGCCCCGGCATCAGTCCCTTCTCTGTCTGCAATGGACCTCT 
TAGCCTACGAGAGGCAACTGGCTCTAGCCAAGATGCATCCTCAGGCTCAACATTCTCTGA 
GGCAAGCAGGTCTTGGAGTCAATGTTGCTGGAGGAACTGCAGCTATGTATGATGGTGGCT 
ATCAGAATGTAGCTGCGGCCCATCAGCAGCTCATGTACTATCAGTAATAAACCCTCTTCA 
CTGGCTCTGAGATACCTTTTTCTGTTTCTTTCTTTTTCTTCTTCTTAATTTTATAACTTT 
CTTGCTTTTTCTAGACCTTCCTTGTTCAAGAGTCTTTATGTATGTGTCTCTTTCATTTAA 
AGCCGTTGGTTTTATTTATGTATGCAGAGCTTTATGCTCAGTTTGTAACCTATAGGTCTT 
ACTTGGATTGTAAGCCAAGCAATAAGACAACATCAAATAAAAGGGGATTTGGTTTTCTGG 
GGTTAATGTTGTTTGTGGTTCTGTAATGATAGGTTTGAAACAAAGTAATTTGTCTTTTAT 
AAAAGTTTTATAGTTTCATTTCTCATGTT
>AT1G54080.2 |  oligouridylate-binding protein putative 
ACTTGATTTTGAACCCTAGCTTAAGGGGAATTTTCTCGGGAAACAAAAGAGATATTTTTA 
TCGCAGTGAGAAAGAAACACAAAAAATGCAGAATCAAAGGCTTATTAAGCAGCAACAACA 
ACAACAACAACAGCAACATCAACAAGCTATGATTCAACAAGCTATGATGCAACAACATCC 
TTCTCTTTATCATCCTGGTGTTATGGCTCCTCCTCAGGTTTTTTTTTTCTTTCTTGATCT 
AATCTCTTTTCATTTTCTATGTAACCTCCTTTGATTCCAAATTAGGGCTTGTTCTGTAAT 
TCCGATTGTGGGTTTTAATTCACTGAGCTCTGTTACCTAATCTTATGAATCTCTCTCTGT 
CTCTTTCTCTGGCTAATTATTATGTAAAGTTTTGAGCTTTTGATTGTGGGCTTGTGTTTT 
TTTGTTAGTAATTCGGTTTCTCTGCTGATTTTGTGTTTAATTTTGGTGGTAATGGTAGAT 
GTTCGTGTAGAAAAGGAGTGGTTTTGGTACTTGTTTCTGCAATCATCTCTTAATGTTTTG 
TTTATGGTTTTGCATTTTTGTTGCAGATGGAGCCTTTACCAAGTGGAAACCTTCCTCCTG 
GTTTTGATCCAACTACTTGCCGTAGTGTGTGAGTTTTTTATTTCAATTGGTTTTTCTTTC 
TTTCTTTCGCCTTTGGTATAATGCAGAGTTTCAATTTGTAATTGTTCTTTTATGTTTTGC 
AGGTATGCTGGAAACATTCATACGCAGGTCACAGAGATTCTTCTTCAAGAGATTTTTGCA 
AGTACTGGTCCTATTGAAAGCTGTAAACTCATCAGAAAGGATAAGGTAGAGTTTTGGAAC 
CCGCCCTTCTGTTTTTTATTCGAATGAAGCTTTTCGGTAGTGTTCTTTGAAAGCTAACTT 
CTAGACATGAATGTTTTACACTTTTGCAGTCATCATATGGATTTGTTCACTACTTTGATC 
GAAGATGTGCTAGTATGGCTATAATGACTCTTAACGGAAGGCATATGTAAGAATCTAACA 
TTGATACTTCATGCTTTGATTAGTCAATTTATTCATGTGTTCTCTTAGATTATAATATTG 
GATTTCACAGATTTGGACAGCCTATGAAAGTTAATTGGGCGTATGCAACTGGTCAAAGGG 
AAGATACATCAAGTAAGTTCTTATGAGCACGGATTGATTGTCAAGGACTTTCTTTTTGTT 
CTTTGAGTGAGGCATGGTACTGAATGGTTTTGGTTTCATGAAATGCAGGTCATTTCAACA 
TTTTTGTTGGAGATCTTAGTCCAGAGGTTACTGATGCAGCATTGTTTGATAGCTTTTCTG 
CTTTTAACAGCTGCTCGTAAGTTCTTGTGCTTGGTCTTCTGATTTTAGTTACTAGCTGGT 
TACAAAAATGAAAATCTTGTTACACAACTACGGTGTACGCATATATCACTATGTGTTACA 
AGATTTTCTTTAATGATTAAGCTTATTTGTTTAAACAGTCTATCAGAATCTTTGATTTAA 
TATCTATAGTTCTTATTATAGGGACGCAAGAGTAATGTGGGACCAGAAAACTGGACGCTC 
AAGAGGCTTTGGTTTTGTTTCCTTCCGTAATCAGCAGGTTTTATATCCTTTTAATCATGA 
GTGACTTTTTTTTTAGCTCCATTCATTGTTTACATTGATTTTTAAATGTTTCTGTAATTT 
GCAGGATGCTCAAACTGCCATAAATGAGATGAATGGTAAGAATTATCATATACCAGCTTG 
TGGTTTAGAGCTTTAAGGTTCCTTATTGTGAACTTTGGTTTCTACATACTGATATTGTAT 
GATGCACTTAGCTCTGTAATATTTGTTGTATCTAGAAAGGTGAAATTTGGTCAGGAATTG 
TGTTCTTGGAGCTTATTGGTTGGTGAACAACTGTTGAAGTTACATGTTGCTTGTGCCGAT 
TATGATTTATCTCTATAATTGAGCTATTTATCTCAATTCCTAGCACTTGGTTTCCCATTA 
CTAGAACCTTGGCTTGTTTTGTGTATTCTCAGGTAAATGGGTAAGTAGCAGACAGATCAG 
ATGCAACTGGGCGACAAAAGGTGCTACTTTTGGCGAGGACAAACATAGCTCTGATGGAAA 
AAGTGTTGTAGAACTTACTAACGGATCTTCAGGTTTTCTTTTGTTTACTGTGCAACTTCT 
AAAATTTTTATTTTCTTCCTCAAAGCAGATTTTCATGGAGATTACATTGATATAATACTT 
GATTTTGCAGAGGATGGTAGAGAGCTGTCAAATGAAGATGCCCCTGAAAACAATCCTCAA 
TTTACAACTGTCTATGTAGGAAATCTCTCTCCAGAAGTAAGTTGTCAACTTAACGAATTG 
TTCTTTATAAACACTGCAACAGCTCCTGGGGTTTTTCTTTTTGGCGCCTCGTGACAGTTG 
TCAATCTTGCAGGTAACTCAGCTTGATCTACACCGTCTATTCTATACCCTTGGTGCTGGA 
GTGATCGAAGAGGTCCGTGTCCAGCGAGACAAAGGGTTTGGTTTTGTGAGATATAACACT 
CATGACGAGGCTGCTCTTGCTATTCAGATGGGCAACGCTCAGCCTTTCCTCTTTAGCAGA 
CAGATAAGGGTATTTGCTTCAGTTAATGTTACATAGATCTATCTGTTGTTGCATCTACGT 
AGACAACCAAAGTCTGCTTGTAATTGGTTTTTACCAGTATTCCCCTAAACCCATTTCCTT 
GTTTCTGTGATTTATTGCAGTGTTCCTGGGGAAACAAACCAACTCCATCAGGCACAGCCT 
CAAACCCACTTCCCCCACCAGCCCCGGCATCAGTCCCTTCTCTGTCTGCAATGGACCTCT 
TAGCCTACGAGAGGCAACTGGCTCTAGCCAAGATGCATCCTCAGGCTCAACATTCTCTGA 
GGCAAGCAGGTCTTGGAGTCAATGTTGCTGGAGGAACTGCAGCTATGTATGATGGTGGCT 
ATCAGAATGTAGCTGCGGCCCATCAGCAGCTCATGTACTATCAGTAATAAACCCTCTTCA 
CTGGCTCTGAGATACCTTTTTCTGTTTCTTTCTTTTTCTTCTTCTTAATTTTATAACTTT 
CTTGCTTTTTCTAGACCTTCCTTGTTCAAGAGTCTTTATGTATGTGTCTCTTTCATTTAA 
AGCCGTTGGTTTTATTTATGTATGCAGAGCTTTATGCTCAGTTTGTAACCTATAGGTCTT 
ACTTGGATTGTAAGCCAAGCAATAAGACAACATCAAATAAAAGGGGATTTGGTTTTCTGG 
GGTTAATGTTGTTTGTGGTTCTGTAATGATAGGTTTGAAACAAAGTAATTTGTCTTTTAT 
AAAAGTTTTATAGTTTCATTTCTCATGTT
>AT1G54080.1 |  oligouridylate-binding protein putative 
TACAGTCTATCTCTCTCTCGAAGAAATCGTCACACTCCTATAAATGGTCACTTGTTTCGT 
ACGGCCTTTCTTTACTCCTTTAGAGAGAGCGTGCCATTTTTATTTTTCTCTTTCTTCTCT 
CATTTTTATTTTCTTTTCTTTTTTTTCACCTTTTTTTTTTCCTTTTTTTTTCTTTCTTCT 
TCTTCTTACTTGATTTTGAACCCTAGCTTAAGGGGAATTTTCTCGGGAAACAAAAGAGAT 
ATTTTTATCGCAGTGAGAAAGAAACACAAAAAATGCAGAATCAAAGGCTTATTAAGCAGC 
AACAACAACAACAACAACAGCAACATCAACAAGCTATGATTCAACAAGCTATGATGCAAC 
AACATCCTTCTCTTTATCATCCTGGTGTTATGGCTCCTCCTCAGGTTTTTTTTTTCTTTC 
TTGATCTAATCTCTTTTCATTTTCTATGTAACCTCCTTTGATTCCAAATTAGGGCTTGTT 
CTGTAATTCCGATTGTGGGTTTTAATTCACTGAGCTCTGTTACCTAATCTTATGAATCTC 
TCTCTGTCTCTTTCTCTGGCTAATTATTATGTAAAGTTTTGAGCTTTTGATTGTGGGCTT 
GTGTTTTTTTGTTAGTAATTCGGTTTCTCTGCTGATTTTGTGTTTAATTTTGGTGGTAAT 
GGTAGATGTTCGTGTAGAAAAGGAGTGGTTTTGGTACTTGTTTCTGCAATCATCTCTTAA 
TGTTTTGTTTATGGTTTTGCATTTTTGTTGCAGATGGAGCCTTTACCAAGTGGAAACCTT 
CCTCCTGGTTTTGATCCAACTACTTGCCGTAGTGTGTGAGTTTTTTATTTCAATTGGTTT 
TTCTTTCTTTCTTTCGCCTTTGGTATAATGCAGAGTTTCAATTTGTAATTGTTCTTTTAT 
GTTTTGCAGGTATGCTGGAAACATTCATACGCAGGTCACAGAGATTCTTCTTCAAGAGAT 
TTTTGCAAGTACTGGTCCTATTGAAAGCTGTAAACTCATCAGAAAGGATAAGGTAGAGTT 
TTGGAACCCGCCCTTCTGTTTTTTATTCGAATGAAGCTTTTCGGTAGTGTTCTTTGAAAG 
CTAACTTCTAGACATGAATGTTTTACACTTTTGCAGTCATCATATGGATTTGTTCACTAC 
TTTGATCGAAGATGTGCTAGTATGGCTATAATGACTCTTAACGGAAGGCATATGTAAGAA 
TCTAACATTGATACTTCATGCTTTGATTAGTCAATTTATTCATGTGTTCTCTTAGATTAT 
AATATTGGATTTCACAGATTTGGACAGCCTATGAAAGTTAATTGGGCGTATGCAACTGGT 
CAAAGGGAAGATACATCAAGTAAGTTCTTATGAGCACGGATTGATTGTCAAGGACTTTCT 
TTTTGTTCTTTGAGTGAGGCATGGTACTGAATGGTTTTGGTTTCATGAAATGCAGGTCAT 
TTCAACATTTTTGTTGGAGATCTTAGTCCAGAGGTTACTGATGCAGCATTGTTTGATAGC 
TTTTCTGCTTTTAACAGCTGCTCGTAAGTTCTTGTGCTTGGTCTTCTGATTTTAGTTACT 
AGCTGGTTACAAAAATGAAAATCTTGTTACACAACTACGGTGTACGCATATATCACTATG 
TGTTACAAGATTTTCTTTAATGATTAAGCTTATTTGTTTAAACAGTCTATCAGAATCTTT 
GATTTAATATCTATAGTTCTTATTATAGGGACGCAAGAGTAATGTGGGACCAGAAAACTG 
GACGCTCAAGAGGCTTTGGTTTTGTTTCCTTCCGTAATCAGCAGGTTTTATATCCTTTTA 
ATCATGAGTGACTTTTTTTTTAGCTCCATTCATTGTTTACATTGATTTTTAAATGTTTCT 
GTAATTTGCAGGATGCTCAAACTGCCATAAATGAGATGAATGGTAAGAATTATCATATAC 
CAGCTTGTGGTTTAGAGCTTTAAGGTTCCTTATTGTGAACTTTGGTTTCTACATACTGAT 
ATTGTATGATGCACTTAGCTCTGTAATATTTGTTGTATCTAGAAAGGTGAAATTTGGTCA 
GGAATTGTGTTCTTGGAGCTTATTGGTTGGTGAACAACTGTTGAAGTTACATGTTGCTTG 
TGCCGATTATGATTTATCTCTATAATTGAGCTATTTATCTCAATTCCTAGCACTTGGTTT 
CCCATTACTAGAACCTTGGCTTGTTTTGTGTATTCTCAGGTAAATGGGTAAGTAGCAGAC 
AGATCAGATGCAACTGGGCGACAAAAGGTGCTACTTTTGGCGAGGACAAACATAGCTCTG 
ATGGAAAAAGTGTTGTAGAACTTACTAACGGATCTTCAGGTTTTCTTTTGTTTACTGTGC 
AACTTCTAAAATTTTTATTTTCTTCCTCAAAGCAGATTTTCATGGAGATTACATTGATAT 
AATACTTGATTTTGCAGAGGATGGTAGAGAGCTGTCAAATGAAGATGCCCCTGAAAACAA 
TCCTCAATTTACAACTGTCTATGTAGGAAATCTCTCTCCAGAAGTAAGTTGTCAACTTAA 
CGAATTGTTCTTTATAAACACTGCAACAGCTCCTGGGGTTTTTCTTTTTGGCGCCTCGTG 
ACAGTTGTCAATCTTGCAGGTAACTCAGCTTGATCTACACCGTCTATTCTATACCCTTGG 
TGCTGGAGTGATCGAAGAGGTCCGTGTCCAGCGAGACAAAGGGTTTGGTTTTGTGAGATA 
TAACACTCATGACGAGGCTGCTCTTGCTATTCAGATGGGCAACGCTCAGCCTTTCCTCTT 
TAGCAGACAGATAAGGGTATTTGCTTCAGTTAATGTTACATAGATCTATCTGTTGTTGCA 
TCTACGTAGACAACCAAAGTCTGCTTGTAATTGGTTTTTACCAGTATTCCCCTAAACCCA 
TTTCCTTGTTTCTGTGATTTATTGCAGTGTTCCTGGGGAAACAAACCAACTCCATCAGGC 
ACAGCCTCAAACCCACTTCCCCCACCAGCCCCGGCATCAGTCCCTTCTCTGTCTGCAATG 
GACCTCTTAGCCTACGAGAGGCAACTGGCTCTAGCCAAGATGCATCCTCAGGCTCAACAT 
TCTCTGAGGCAAGCAGGTCTTGGAGTCAATGTTGCTGGAGGAACTGCAGCTATGTATGAT 
GGTGGCTATCAGAATGTAGCTGCGGCCCATCAGCAGCTCATGTACTATCAGTAATAAACC 
CTCTTCACTGGCTCTGAGATACCTTTTTCTGTTTCTTTCTTTTTCTTCTTCTTAATTTTA 
TAACTTTCTTGCTTTTTCTAGACCTTCCTTGTTCAAGAGTCTTTATGTATGTGTCTCTTT 
CATTTAAAGCCGTTGGTTTTATTTATGTATGCAGAGCTTTATGCTCAGTTTGTAACCTAT 
AGGTCTTACTTGGATTGTAAGCCAAGCAATAAGACAACATCAAATAAAAGGGGATTTGGT 
TTTCTGGGGTTAATGTTGTTTGTGGTTCTGTAATGATAGGTTTGAAACAAAGTAATTTGT 
CTTTTATAAAAGTTTTATAGTTTCATTTCTCATGTT
>AT1G54080.1 |  oligouridylate-binding protein putative 
TACAGTCTATCTCTCTCTCGAAGAAATCGTCACACTCCTATAAATGGTCACTTGTTTCGT 
ACGGCCTTTCTTTACTCCTTTAGAGAGAGCGTGCCATTTTTATTTTTCTCTTTCTTCTCT 
CATTTTTATTTTCTTTTCTTTTTTTTCACCTTTTTTTTTTCCTTTTTTTTTCTTTCTTCT 
TCTTCTTACTTGATTTTGAACCCTAGCTTAAGGGGAATTTTCTCGGGAAACAAAAGAGAT 
ATTTTTATCGCAGTGAGAAAGAAACACAAAAAATGCAGAATCAAAGGCTTATTAAGCAGC 
AACAACAACAACAACAACAGCAACATCAACAAGCTATGATTCAACAAGCTATGATGCAAC 
AACATCCTTCTCTTTATCATCCTGGTGTTATGGCTCCTCCTCAGGTTTTTTTTTTCTTTC 
TTGATCTAATCTCTTTTCATTTTCTATGTAACCTCCTTTGATTCCAAATTAGGGCTTGTT 
CTGTAATTCCGATTGTGGGTTTTAATTCACTGAGCTCTGTTACCTAATCTTATGAATCTC 
TCTCTGTCTCTTTCTCTGGCTAATTATTATGTAAAGTTTTGAGCTTTTGATTGTGGGCTT 
GTGTTTTTTTGTTAGTAATTCGGTTTCTCTGCTGATTTTGTGTTTAATTTTGGTGGTAAT 
GGTAGATGTTCGTGTAGAAAAGGAGTGGTTTTGGTACTTGTTTCTGCAATCATCTCTTAA 
TGTTTTGTTTATGGTTTTGCATTTTTGTTGCAGATGGAGCCTTTACCAAGTGGAAACCTT 
CCTCCTGGTTTTGATCCAACTACTTGCCGTAGTGTGTGAGTTTTTTATTTCAATTGGTTT 
TTCTTTCTTTCTTTCGCCTTTGGTATAATGCAGAGTTTCAATTTGTAATTGTTCTTTTAT 
GTTTTGCAGGTATGCTGGAAACATTCATACGCAGGTCACAGAGATTCTTCTTCAAGAGAT 
TTTTGCAAGTACTGGTCCTATTGAAAGCTGTAAACTCATCAGAAAGGATAAGGTAGAGTT 
TTGGAACCCGCCCTTCTGTTTTTTATTCGAATGAAGCTTTTCGGTAGTGTTCTTTGAAAG 
CTAACTTCTAGACATGAATGTTTTACACTTTTGCAGTCATCATATGGATTTGTTCACTAC 
TTTGATCGAAGATGTGCTAGTATGGCTATAATGACTCTTAACGGAAGGCATATGTAAGAA 
TCTAACATTGATACTTCATGCTTTGATTAGTCAATTTATTCATGTGTTCTCTTAGATTAT 
AATATTGGATTTCACAGATTTGGACAGCCTATGAAAGTTAATTGGGCGTATGCAACTGGT 
CAAAGGGAAGATACATCAAGTAAGTTCTTATGAGCACGGATTGATTGTCAAGGACTTTCT 
TTTTGTTCTTTGAGTGAGGCATGGTACTGAATGGTTTTGGTTTCATGAAATGCAGGTCAT 
TTCAACATTTTTGTTGGAGATCTTAGTCCAGAGGTTACTGATGCAGCATTGTTTGATAGC 
TTTTCTGCTTTTAACAGCTGCTCGTAAGTTCTTGTGCTTGGTCTTCTGATTTTAGTTACT 
AGCTGGTTACAAAAATGAAAATCTTGTTACACAACTACGGTGTACGCATATATCACTATG 
TGTTACAAGATTTTCTTTAATGATTAAGCTTATTTGTTTAAACAGTCTATCAGAATCTTT 
GATTTAATATCTATAGTTCTTATTATAGGGACGCAAGAGTAATGTGGGACCAGAAAACTG 
GACGCTCAAGAGGCTTTGGTTTTGTTTCCTTCCGTAATCAGCAGGTTTTATATCCTTTTA 
ATCATGAGTGACTTTTTTTTTAGCTCCATTCATTGTTTACATTGATTTTTAAATGTTTCT 
GTAATTTGCAGGATGCTCAAACTGCCATAAATGAGATGAATGGTAAGAATTATCATATAC 
CAGCTTGTGGTTTAGAGCTTTAAGGTTCCTTATTGTGAACTTTGGTTTCTACATACTGAT 
ATTGTATGATGCACTTAGCTCTGTAATATTTGTTGTATCTAGAAAGGTGAAATTTGGTCA 
GGAATTGTGTTCTTGGAGCTTATTGGTTGGTGAACAACTGTTGAAGTTACATGTTGCTTG 
TGCCGATTATGATTTATCTCTATAATTGAGCTATTTATCTCAATTCCTAGCACTTGGTTT 
CCCATTACTAGAACCTTGGCTTGTTTTGTGTATTCTCAGGTAAATGGGTAAGTAGCAGAC 
AGATCAGATGCAACTGGGCGACAAAAGGTGCTACTTTTGGCGAGGACAAACATAGCTCTG 
ATGGAAAAAGTGTTGTAGAACTTACTAACGGATCTTCAGGTTTTCTTTTGTTTACTGTGC 
AACTTCTAAAATTTTTATTTTCTTCCTCAAAGCAGATTTTCATGGAGATTACATTGATAT 
AATACTTGATTTTGCAGAGGATGGTAGAGAGCTGTCAAATGAAGATGCCCCTGAAAACAA 
TCCTCAATTTACAACTGTCTATGTAGGAAATCTCTCTCCAGAAGTAAGTTGTCAACTTAA 
CGAATTGTTCTTTATAAACACTGCAACAGCTCCTGGGGTTTTTCTTTTTGGCGCCTCGTG 
ACAGTTGTCAATCTTGCAGGTAACTCAGCTTGATCTACACCGTCTATTCTATACCCTTGG 
TGCTGGAGTGATCGAAGAGGTCCGTGTCCAGCGAGACAAAGGGTTTGGTTTTGTGAGATA 
TAACACTCATGACGAGGCTGCTCTTGCTATTCAGATGGGCAACGCTCAGCCTTTCCTCTT 
TAGCAGACAGATAAGGGTATTTGCTTCAGTTAATGTTACATAGATCTATCTGTTGTTGCA 
TCTACGTAGACAACCAAAGTCTGCTTGTAATTGGTTTTTACCAGTATTCCCCTAAACCCA 
TTTCCTTGTTTCTGTGATTTATTGCAGTGTTCCTGGGGAAACAAACCAACTCCATCAGGC 
ACAGCCTCAAACCCACTTCCCCCACCAGCCCCGGCATCAGTCCCTTCTCTGTCTGCAATG 
GACCTCTTAGCCTACGAGAGGCAACTGGCTCTAGCCAAGATGCATCCTCAGGCTCAACAT 
TCTCTGAGGCAAGCAGGTCTTGGAGTCAATGTTGCTGGAGGAACTGCAGCTATGTATGAT 
GGTGGCTATCAGAATGTAGCTGCGGCCCATCAGCAGCTCATGTACTATCAGTAATAAACC 
CTCTTCACTGGCTCTGAGATACCTTTTTCTGTTTCTTTCTTTTTCTTCTTCTTAATTTTA 
TAACTTTCTTGCTTTTTCTAGACCTTCCTTGTTCAAGAGTCTTTATGTATGTGTCTCTTT 
CATTTAAAGCCGTTGGTTTTATTTATGTATGCAGAGCTTTATGCTCAGTTTGTAACCTAT 
AGGTCTTACTTGGATTGTAAGCCAAGCAATAAGACAACATCAAATAAAAGGGGATTTGGT 
TTTCTGGGGTTAATGTTGTTTGTGGTTCTGTAATGATAGGTTTGAAACAAAGTAATTTGT 
CTTTTATAAAAGTTTTATAGTTTCATTTCTCATGTT
>AT1G10490.1 |  unknown protein 
CTTTTACCTCTCTTCTCGCTTCACTCACCATCCTCAGGTTCGTTCTCTGTCACAAACATT 
ACTTCCGACGAAAGAATTAATTTTACAGTTAGGAATTGTAATCAGTGCGAGTAAGTACAG 
GAATCGAAGCCGGTTTTGTGTTTCTTTTGCTTGATTTTTCTCCGTTTATTCTCAACTTTG 
AGACTTTTGCTTCATTGGTTACCCTATAAAGCTTGAAACTTTATTCGAATTGAGATGTTC 
CATTAGATATTTTCAAACAAGTTCCTGCCTTTTTACTCTACATTAAGCTAAAACCTGTGT 
TTGATTGAATTTTTGATTTCGGCTTAATTAAGGTTAGGCAAAACCAATAACTGGTGTGAG 
AATGAGGAAGAAGGTAGACGAACGTATAAGGACTCTGATTGAAAACGGTGTTAAACTTAG 
ACACCGTTCCATGTTTGTCATTATTGGTGATAAGGCTCGTGACCAGGTAAAATTCTTCTT 
GTTATAGATAATTTCTACTTTGCATTTTCCTCGGATTTCAAGTCTAATACTTTTCTGATT 
CTGTTATGTAACAGATAGTTAATCTTCATCACATTTTGTCAAAATCGGTGGTCAAGTCTA 
ACCCAAGTGTGCTATGGTGCTACAAGAATAGACTCGACATTAGCAGGTTTGATTTATCAA 
CCGATTCAAATATTAGATATTTGCAAAAGTTGAAGCGTTGAAATTTTGTTATTAAAAACT 
TAATTGAAGCCTAGTTAATAATTAGGTGTGAGTTTCTTTTGAATTTTCCATGCCAAGAGA 
ATGATGGAACCTGGTTTTGTGAGCTATGTTACGCATATTTGTGGAGTTCTATTTGTTGAT 
AACTTGGTCCTGAAAAAGAGTGGGTGTAATTGGTTTTGTGTGCAGTCACAATAAAAAACG 
TGCTAAGCAGTTGAAGAAGATGAAGGAGAGAGGACAATTAGATCCTGAAAAACTCGACGC 
TTTCTCTCTTTTTCTTGATGTGGTGGATGTTACTCATTGCTTGTACAAAGATTCTGAAAG 
AATTCTTGGGAATACTTTTGGCATCTGCATCTTACAGGTACTCTTGATTAATGGCTGAAG 
AAACATTTACTTTTGCTGCAGCTTACTCATATTTGCATCCTATTCTTACTATGTTCAGGA 
TTTTGAAGCTCTAACTCCAAATCTACTAGCAAGAACAATAGAGACAGTCGAAGGGGGTGG 
GCTAGTTGTATTATTATTACAATCGCTTGCTTCACTTACTAGTCTCTGCACCATGGTTAT 
GGTATGAAGACTGATTTTGCTAGTTATGTTGTTTGCTAACTACTTATTTGGAGTTACATG 
ATTGGTTCTGTTCATATCAGGATGTGCATGATAGATTTCGAACCGAGTCACACTCTGAAG 
CTTCCGGACGTTTCAATGAACGATTTCTGTTGTCACTAGCATCTTGCAAAGCATGCGTTG 
TCATGGATGATGAGTTGAATTTATTGCCACTTTCATCTCATATCAAATCTATCACAAAAG 
TTCCAACAAAGGAGGTAATTTCTATAGCAAATTCACACTTCTTTTCATGGGTTGTTTAGA 
GAGATTGTCTTCCATCATACCAGTTAGCATCTTTAACTTTTCAATTTTATGTGTTTGTAA 
TAAAAGGATTCGGAAGCGCTTTCTGAGGCAGAACGAGACCTGAAGAGTTTGAAAGATGCA 
CTAAACGATGATTTTCCTGTTGGTCCTTTAATTAATAAGTGTTGTACATTGGATCAGGTA 
TGTGGTTTAGTCAGCTGTGCACATTGGATTAAGAAGTGTTGCACATTGGATCAGTATTGA 
ATTTTCTCTTTTGTAGGGTAAAGCTGTTGTCACATTTTTCGATGCAATATTGGATAAGAC 
CCTCCGTAGCATAGTTGCTCTGATTGCTAGTCGTGGGCGTGGAAAATCTGCTGCACTTGG 
TCTAGCTGTTGCTGGGGCTGTTGCTGCTGGGTAGGCTTGAGTTATTTTGAGCTTTTATTC 
ATGTTTGTTAATAGTATTTATTGTCTTATTAATTCTATATCGTATTTTCTGTTAGGTACT 
CTAATATTTACGTAACAGCACCGAGCCCAGATAACTTGAAAACAGTCTTCGAGTTTGTTT 
GCAAAGGTTTCGATGCACTTGAATATAAGGTAATATGAGCTTCTTCTGCATCACACATAT 
GAAGCAATTTTCTAGAAACTGCTGGACTTCTTCCATTTTGTTGGGGTTGTCATAGATTTG 
AAATCTGCACTATCTCCTGGAAGAAGAAAAATGTTACTTTGTTTTGCATGTTAATTCAGG 
ATTACCATATAATTTTCTGAACTCTATCTTCAACTATATATTTGAAGGAACATCTTGAAT 
ATGATGTCGTGAGAAGTGTGAATCCTGAATTTAATAAAGCCATCGTACGGATCAATATCT 
TCAAGCAGCACAGGCAAACTATCCAGGTCTGTCCAACCCTGAATTTTTGTAAGAAGCCGT 
AGTTTGTGTCGATCGATAAATTGCTTTATTCTTCTTCTTTTTTCATGCAGTATATACAAC 
CGCATGAACATGAAAAGCTCTCACAAGTGGAGCTGTTGGTTATTGATGAAGCGGCAGCTA 
TTCCTTTGCCAGTTGTGAAGTCTCTACTTGGCCCTTACCTAGTTTTCTTATCATCTACTG 
TCAGTGGGTATGTGAAACAGGAGTAAAATGCTTATATTCCCATGATATTGAAAGATATAT 
GCATGGCTTGATTATATATAGGGTCAGTCAGGCTGCTGATTTTTGTTTGTTTTACCTTCT 
TTGCCAAAGCTATGAAGGTACTGGTAGATCTTTGTCCCTGAAACTCCTCCAACAGTTAGA 
AGAGCAAAGCCGAGCCCCTGTCACTGGTGTTGAAGGCTCTCTTTCTGGTATTTACTACTA 
CATCTTGCTTTCACTTTTGGCATGTGGCAACCTGGATATTTTTTTTTTGTAGAGATCCCA 
ATATTATTATTAAGAATATAGAAGTTCATCTTTTTTAAAATATCGCTCCAATGCCTTTGC 
GTCGGGGCTTATCAGCTAGCATTTTCATAAGAAAGAAATTTATGTTTTTGAAGTAAACCA 
TTGCTCCAATTCCTAAGTTTGAGGAATATATGTGAATGATTTTTTCCAAGAACGTAGGTT 
TTGTTGTTAAGTTTGGCCTTAAGGGCCTCCGAAGGTTGATTGAAACTTCATGCAGAGTAG 
TCCTCTGTCTGATGGGTGTTCATATTCATTAGAACTAATGTTCTCTCACGCAGGGCCTAC 
TACTTTCATATCTTAGTATGTAGTATTAGATATCCTCTTTTTCCTACACTATCTAGTTGA 
TGTGATTCGTTATCTTGGGGAACTCCGTGACTGTCTGAATTTTCTTTGGATTCAGGTTGC 
CTTTTCAAGAAAATAGAACTTAGTGAGTCTATAAGATACGCTTCTGGAGATCCAATTGAA 
TCCTGGCTTAATGGATTACTATGCCTTGATGTTGCTAATTGTCTTCCAAATCCTGCTTGG 
TATGGTATTTCACTTCATATAAATAGAATGTTGCCATCCTTTCTTGCCAACTAGTGATCT 
AGAAAATGATTTCTATTTTTCTTGCATTTGTAGCCATCCTCTGCCAAGTCAGTGTGATCT 
TTATTATGTCAACCGAGACACCTTATTTTCTTATCACAAGGACAGTGAGTTGTTTTTACA 
GGTAATAATAGTTGATTTTACAACCTACGTACTTTTTGCTACCTATATTTTGTTAATAAG 
GCATTAAGTGGTATTCTACAGCGAATGATGGCACTTTGTGTCTCTTCTCACTACAAGAAT 
TCTCCTAATGATCTTCAACTTTTGTCGGATGCTCCTGCTCATCATTTGTTTGTGTTGCTC 
GGTATGCAATTGTTCCTCCTTTTCATAGCTAGAGATAATCATCAGATTTAGAGTATTGCC 
TTATTTTCTTTTTGGCACAGGTCCTGTTGATGAGTCCAAAAACCAGCTTCCTGACATACT 
GTGTGTTATTCAGGTATCGATTTCTTACTTTCTGCTCTGCTCTTTGAAATTGTTTGTTTG 
GAGAAAAACAGTTAGTTGGACTAAACAAAGAATAAAAGCAGCTATCAGTCTGCTTGAATT 
GTTTGTTTGCAGCAATTTTGTTTTGTAAAATCATGAATCTCATATCTTGTCGTTCGTATG 
TGATTGATTCTGGATGTAACTGGTCTTAAGTATCCTTGAAATTGATATTTATGCAGGTCT 
GTCTCGAAGGACAGATATCTCGGAAATCAGCTGAAAAAAGTTTAAGAGAAGGTCATTCAC 
CACATGGAGATCAAATACCATGGAAGTTCTGTGAACAGTTCCGGGACGTGGTCTTTCCAA 
AGCTTTCTGGTGCTCGTATAGTACGCATAGCAGTCCACCCCAACGCTATGAAGGTAAAGT 
TTCTTAGTCGCCTCATTTTTTTAGTCTTGTAGGTTTCTTGTGAGATTTAACAAATTCTTG 
ATTACATTCTATGTAGATGGGATATGGGTCTGCTGCGGTTGAACTCTTGACCAGGTAAAT 
GCAATGATTACGACTTAGATGATTAATACATGCAAATATTTTAATTGATTGATACGTGCA 
GATACTTTGAGGGTCAGCTAGCTTCAATATCAGAAGGTGATGATGAACTGGAAGTGGAGC 
CTTCACCAGTCAGAGTTACCGAGGCTGCTGCAAAGGTTCTTGATTATTTTAATCTACCCT 
TGTAGGGTTTTGCATCATGCATTCTAGTTCTTACTTGAATTTTTTCCCTTAGGTTTCTTT 
GCTTGAGGAACAGATAAAGCCTCGTGCCAATCTTCCACCTTTGCTGGTTCCTCTTCGTGA 
TCGACGACCTGAGAGACTCCACTACATCGGTGTCTCTTTTGGGCTTACTTTGGACCTCTT 
CCGTTTCTGGAGAAAACATAAATTTGCTCCATTCTACATCAGTCAAATACCAGTTGAGAA 
TCCCTCTTTCCCTCTTCTCCTGAATTACTAATTCTAGTGTTGTCTAGCAGTTCATAACAC 
AATTTCTAAAATATGGTTGGATCAGAGTGCTGTGACTGGTGAGCACACATGTATGCTTCT 
GAAACCATTAACCTTAAGCAACGATGAATTCGAAGTTGATGAGTCGGATGAACTGGGCTT 
CTTTGCTCCCTTCTATAAAGGTTTGTAAATTCTTAACAGGAATCAAATGTTTCTGTAGCT 
TTTAAGGATGACAGGTTTTGTTTTAATGTTTTGGCAAATTCTTCTACTCTGTTCAGATTT 
CAGGATAAGGTTCTCTAAACTGTTGAGTGATAAATTCAAGAAGATGGATTATAAACTTGC 
AATGAGGTTAGCACTAATCATATTCTCTCCCCATGCAAATTTAGACTTTTTCTGCAATAC 
TATTTTAAGATGATTAGACTTTTCTTGGTGCGGTATTATTGTGTTGATAATATACTCGTT 
TCACAATTTTGTTAGTGTTTTGAACCCTAAGATCAACTTCCCAGAGGTTGATTTGACTGG 
AAATTCACCAGATGGATTTTTGAAGAAACTCGACGGAGTTCTTTCACCTTATGATATGGA 
GAGATTCAGAGCATACACTGCCAATCTCGTTGACTTCAATCTGGTTAGATTCACTCTCTG 
AGAGTCACTTATTTTAGGGAAATATGTACTATAGTCAGATATGTAATCTGCTTAAATAAC 
TACACAATCATAAGATTCTGGTACAGACTCAGACAAATAATACTAACCGCATGTTCAAGC 
TTGATACTCTGTCTTTTCGTTTGGTTTGGTAACTATTTTTACTTTGTTATCTTTTCAAAG 
GTTTATGACATCTGCAAAACTCTAGCTCATCATTATTTTCAAGAGAAGCTCCCAGTCTCG 
CTGTCGTATGTTCAAGCTTCTGTACTCCTGTGTTTGGGCTTGCAGGAGTCAGATTTCTCG 
AGCATCGAGGTATAACATATCTACTCTTTAAAATAAATCGATGATCTGGACCAGCTGAAT 
TATGTTTCACCACACATGTGGAGATAAATTTCTTGACACATCTGGTTGTTCTAAATTGGA 
TCATGACGTTGACTTACAGAGACAAATGCAGTTGGAGAGGGGCCAAATATACTCTCTTCT 
ATTGAAGGTTGGAAAGAAGTTATACAAATATTTGAATGGAATCGCAACAAAAGAGCTCGA 
ATCCACCTTACCTCGGTTGAAAGATGTAAGTTCAGATGGGAAAACTTACATAACATTTCC 
ATGTTCTTTTGCTCAGTCATAATATTCCCTCATTTTTGAAAATTAACAACCCTAAGCCCT 
AAATACATACACGAATATCGAGCTGACTGAAATGATTCATGGTTGCTTTTGGTTGCAGAG 
AGTGCTTGAACCTCACAAAGTATCAGTAGACGAAGATCTCAGGGAGGGAGCAAAAGAAGT 
TGAGGTAATCGCTTCTGTTTCCGTGCATGCGTATATTTTGTTTTGGTTTCCATGTAAAAT 
CGAAACACCACTCACACTCTCAATGCTTGGGTTTAAAGGAACAAATGAGGGCAAGGATAG 
AAGAATTGTTGGACCCTGAGCTACTTGACCAATTTGCTATTGGGGACAAAGAAGCTGAGG 
CTTTGCAAAAGTCGAAGATCTCTTCAAGTGGTCTTATCAGTATAGAGTCCACCAAAACTG 
ATAACAAGAAAGAGAAGCCAAGTGGTTTTGATAAATCAGCCAAAAAGAGAGGCAATGATA 
AGCATTCCTCCACATCCAACAAAAAGAGAAGAGCCTGAGATGGAGGTTGATGTCAACAAT 
TGTTTTTTTGTAACAGTGACCAGAAAATTTTGATCTTTGGTCTTTTTACGAATTTTTGTA 
ACCAGGTTGAATAATTTATTAAAATTATGGTTTGATCATACAATTTTTTTAAAAAAACTT 
ACAGATTCTGTTTGAGCATTCTACAACCATAATACAAAGTTTTCTATTAACTATAACTAT 
ATTGTTTATCTACTGCAATGTGTGAAACTGGTTCACATCTCGGCAGCAAAAGACTTCCCA 
CATCCACAGGTTTGTGTAGCGTTAGGGTTCGAGAAAGAGAAGCCTCCACCAATCAAAGCA 
TCGCTGTAATCAAGCTGCATTCCAAAAAGAAAGAGCATGCTCTTTGGATCACAAACTGCA 
AAAGAAGTGAGTACAAATTAAAAACCTGAGCCTTCAATTCACAGATGTAAAAATACTTTA 
CTGCAGAAGACAACAAGAGACTGCAAAAGACAACAAGAGACTAGAAGTCTCAGTTCAAGA 
ATCGGCAGCTAAGTAGTATATAATTCAAGCTGCACATCAAAAAGAATCAACTGACCATCT 
ACTTGACAATAAAACTTTAGCCTATTTGATCGAACAATCTCAGCCTTTTTTTTATTTGGA 
TGCATACTTGAACACAGAAACTGACATTCATATTGTAAGTATGGCAAGTCTACATCATCA 
AGAAACTAGCTGA
>AT5G23880.1 |  CPSF100 (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 100) DNA binding / protein binding 
TAGTTCATCGGAGAAATTTTAGGGTTTATATCGGCGAACGGAAAAGATGGGTACTTCGGT 
GCAAGTGACTCCTCTCTGCGGAGTTTACAACGAGAATCCTCTCTCCTACTTAGTCTCCAT 
TGATGGTTTCAACTTCCTCATCGACTGTGGTTGGAACGATCTCTTCGACACATCGCTCCT 
CGAACCTCTCTCCAGGTTTCTCTATCCTTATTATCTACATTTCCAGAATTCACCAATCTA 
ATTTGTTTTGAATTCGATTCTTCTGGTTTACAGGGTTGCTTCTACTATAGATGCAGTTTT 
GCTTTCTCATCCAGATACACTTCACATTGGTGCTCTTCCTTATGCTATGAAGCAGCTTGG 
ACTCTCCGCTCCTGTTTATGCTACTGAGCCTGTTCATAGATTAGGTCTCCTTACAATGTA 
TGATCAGTTTTTGTCCAGGAAGGTGAGATTTTGTTAACTACTGGAGTGGTTATTTTTGCG 
CAATTGTCTGCATTGTAACACGATGATCTTACTGTTGCAGCAAGTATCCGACTTTGATCT 
GTTTACACTGGATGACATAGATTCTGCTTTCCAGAATGTGATCAGATTGACTTACTCTCA 
AAATTACCATCTTTCTGGTATGTGGTTTTAGTGATTTCTAGGCTCTATAGCAAACTAGAA 
ACAATTGACACTTATCTCAAGCAAGTTTGATCTGCATTATCTATGATCTCATATCGGGAA 
GGAGTTCTTTGACACACATTGAGTATTTGGTTGTTGAAACCTAAGTTATGACTTCAAAGA 
TTGTTAGGATGTCTCAAGGTTTTATCGTTGCCCTATCAGGAAAGGGAGAGGGTATTGTAA 
TTGCTCCTCATGTTGCTGGACACATGCTGGGAGGTAGCATCTGGAGGATAACAAAGGATG 
GGGAGGATGTTATATATGCTGTTGACTACAATCATCGGAAAGAAAGGTACATATGTTCAG 
ATTTTATCTTATTTGAAGTTCGAGTAATGTTCATAACAGTAAGTAAAGATGTGGACTCGT 
GATACTGAATTGTATATCTTAATTCAGGCATTTGAATGGAACTGTTTTACAGTCTTTTGT 
TCGGCCTGCTGTTCTGATAACCGATGCATATCATGCTCTTTATACCAATCAAACCGCAAG 
ACAGCAAAGGGACAAAGAATTTCTAGGTTAGCTTGTAGCCCAATATGTGTTGTGTATCTT 
CTATAGTATTTAAAACAGCCCGCTTCTAACTGCCAGAAACATGTGTGCATGTCCCCATTT 
ATCATTCAGATACCATTTCAAAACATCTTGAAGTTGGAGGAAATGTTCTATTGCCAGTAG 
ACACTGCGGGTCGTGTCCTGGAACTTCTCTTGATACTTGAACAGGTAATAGAACCGCTTT 
GAATGTATCATGCTCTTAGTTAATGTTCAGCTGTTTTTTAAAGACTGGATATTGATCAAA 
CCTGCAGCATTGGTCACAAAGAGGTTTCAGCTTTCCCATTTATTTTCTCACGTACGTGTC 
ATCTAGCACAATTGACTATGTTAAGAGTTTCCTCGAGTGGATGAGTGACTCCATTTCAAA 
GTCCTTTGAGACTTCACGTGATAATGCCTTTCTATTGAGGTAGATTTTCTTATAAGAATG 
CCTTATTTGTGCCGTCGTTTGTTTAGAATACAGAAGACATCACATGAAATTTAAACACAT 
GCAGGCATGTCACTCTGTTGATAAACAAGACTGATCTGGATAATGCTCCACCTGGTCCAA 
AGGTTGTTTATAAAATTATAAGTAACTCATTAGTGTTTGTTAGTACATAGAACGTGGTGG 
ATTTATTATTATTTCCTGTCTTTTCAGCTGATAATAGAACTAGATTTTTTCCTATTATAT 
GTTGTAGTGACTAAATCTCATAATATAGGTTGTTCTTGCTTCCATGGCTAGTCTCGAAGC 
CGGTTTTGCTCGAGAGATATTCGTGGAGTGGGCAAATGATCCCAGAAATTTAGTCCTCTT 
TACTGAAACAGGCCAGGTATGTTTTTAGAACCCACATACGTTGAGGAACGAAAATTTATT 
AGCATTGCTATAAAGACCTGATGGTAGATTCTTTTCCTAGTGCTGATCAGCTAGTTAAGT 
GGATATATGAGAATCTTTTTTGTCTTCTGATCTGAATAAGAGTTCCCCCATTTATGTGTG 
GATATTTACCCCCAATATGTACACAATAGGCAGAGATTGAGTACCTTAAAGCAGCATTAT 
AATTACCACCAAAGCCTGGCTTGCTCCTTTAGGATAATCTCCAGAGCTTTCAGTCTTGAA 
TTTATCAATTAGTTACATCCAGTACAAAATAAAGGGTCTTAGTAGACTATCATATTAATG 
GAATTGACACCACTATGCACAAACTGTCTAATTGGCCATATCATTCATCTCAAATGAACA 
TAATTTTTTTTTGTAACCGCGTACTTTGTTTATTTTTCTTCTAGCGAGACATCATCCTGT 
TCCCTGAAATATCATACTTTTAATTAAAATTCAATCTAGACAAAAATAAATTTATTCAAA 
TAAATAGTTTGGAAACAAATGGAAGCTTTGGTTAATTATTCACGCTTTTCTCAGTTCTGT 
GTGACTATGCTTTCTTGTCCATGTCAATCTATCCAGAAAACAGAGCATTACGGAATTATT 
AAGTTTGAAATACCAGTAACACCGTAAATCCAAGTGAAATTATCGAAGTTCTTCATCCAA 
TTTGTTACCTTTGCCATTGGTCGTGTTCCTTAGTTGCGATGGCGATTATACTTTCCATGT 
GTCCATTCATAGTTCACGTGATCTAAGATTTGCAAGATGTTTCGGTTTGTAGTCAATCAC 
ATAAAACTAAACTGCTGTTAGTTTGATTTTTAATTGTCATTTGCTTCTATTTGCAGTTTG 
GCACTTTAGCTCGTATGCTTCAGTCAGCCCCACCTCCAAAATTTGTTAAAGTCACCATGT 
CTAAGAGGGTTCCTTTGGCTGGGGAAGAGTTAATTGCATATGAGGAAGAGCAAAACAGAC 
TGAAAAGGGAAGAAGCTTTGCGAGCTAGCCTCGTTAAAGAGGAGGAAACAAAAGCTTCCC 
ATGGATCCGATGATAATTCAAGTGAACCTATGATCATAGATACCAAGACTACTCACGATG 
GTAAATTTTTTCTTATTTTATATAACATTTTATTACCCTTGAATATTCTGTGGCCTGTAA 
CTTCTTATTTTTCATGTAAACTTTAACTTAATTGAAGTATCTAGTACTGAAAATGGCTAT 
GCACATAGTACCCTCTGTAATGTACTGGTTAGTTGGTTTTAGGAGGCATTTATGTGGTTA 
TCTTGAGTGACCTAGAAGCTACATTTAGAAGTCTCACAATACATTTCTGGGTAATTTGTT 
TAGTTTTTCACAGTCCCACAATATGTGTCTGTTTCAATTAGACCTCTGGCTACCGTTGTT 
GATTGCTCTTCTTTCCACTACATAGTGGTCTGCAACTGACCTTTTACATTTCTGACTACT 
CTTGCAGTTATTGGTTCTCACGGGCCTGCATATAAAGATATATTGATTGATGGATTTGTT 
CCCCCATCCAGCAGCGTAGCTCCAATGTTCCCATATTATGATAACACATCTGAATGGGAC 
GACTTTGGGGAGATTATTAATCCAGATGACTATGTGATCAAGGATGAAGACATGGACCGA 
GGAGCAATGCATGTACGTTCCTTGAATTCTGGTCTTGGTCTTGGTCTTTCTTAGCTCTTG 
TTATATTTGCAAATTAGACCTCTTAATTTCCATGATGTTTGCATAGTGGTGGTTCCTTTT 
ACGATTTTTGTATCAAGAAGAACAAAGATGTAAGAAATCTGCATGATATGCTCTGAGGAT 
TTGGGATACAGATAGGAAATCTTTTGCCATAAAGTTGCTTAGGCTCTTGATTTGGTATGA 
GTGCAGTTCTTCAAATGAGTGCACTGGTTCTACAGTTCCATCTTTATATTTTCCTTAACA 
ACTGATTGCTTACTAGTAAAGGTTTAGGGTCATTCTATGTAGAGTCTTGTGTTGCTTATT 
AAATTTGTGATATAATTTTCCATTTCAGAACGGAGGTGATGTGGACGGAAGGCTTGATGA 
GGCAACTGCTAGTCTCATGCTTGATACAAGACCTTCGAAAGTCATGTCCAATGAGCTCAT 
TGTAAGTAGACTCTAATTATATCCAAAGAACAATACATTGATAGAGATTTTGTCTCAGTT 
AATGTCCTCATTTGTTCTCCCTTTCTAGAATCTCTGATTATTGTTATAGACTGCTTATCA 
ATGATAGGCACAAGGAGTAGTCTTCTCACTTAGAAATAGAGAGATAGGAATTCTCATTGA 
CATGGCGTTGTGCCTGTCAAATTTATCTTCATCTGATGATATGCATACAAGAAATTTATT 
AATTGATCTTCTAATTAGTTATCACGGGAGACCTTGCTAATCAGATCTTTAGCACGATAA 
TTCAACTTACAGATATTTTGTTGTTTGGATTAATCGGTCTAATTTTCTTCTTGTTATTGA 
ACAACTTTTGTGTTCTTACTTTTACCCACTTGATCTTATGTCATGTAGAAGTTTCAGAAG 
GTTATTCTCAGAACGTAGGCCTTGCCTGCTAAACAAAACAATATGGCTCTTTAGTCTTCT 
TCTGTCTATACCTAACTGCTGTCTAATTTCCCTGATAAATGATTTAGTTTGTTCTTATGC 
TTTTGCACAGGTGACTGTTAGTTGTTCACTTGTTAAAATGGACTATGAAGGTCGGTCAGA 
TGGCCGCTCAATCAAGTCAATGATTGCGCATGTTTCTCCTTTAAAACTTGTACGTTTCTC 
TCTCGTCTTATATATATATAGTGTTAAGCACTGAACTGGAAACTTGCGGTGATCTAATAC 
TATATATCATGTGAAGGTTTTGGTGCACGCGATAGCTGAGGCTACAGAGCATTTGAAGCA 
ACACTGCTTGAACAACATCTGTCCACACGTGTATGCTCCTCAAATAGAGGAAACGGTCGA 
TGTGACTTCTGATTTATGTGCTTACAAGGTAGAAATTACTTAGAATTAGGAAGATCCTTT 
TTAACTCATGGGTTTTGAGTTGTGTGATTGAATTAACCCTGTATGGTGATACATCAGGTC 
CAACTTTCTGAAAAGCTGATGAGCAATGTGATCTTCAAGAAGGTACCTTTTATTTCCGTG 
ACTATTTTTTTCTTCTTTTCCGATTTGCAACCAATGTCTCTGAAGAATGATGAAATAATA 
TCAGCTGGGAGATTCAGAAGTAGCTTGGGTGGATTCCGAAGTAGGGAAGACAGAGAGGGA 
CATGAGGTCTCTACTACCGATGCCAGGTGCTGCTTCGCCACACAAACCTGTTCTAGTAGG 
TGATCTGAAAATCGCAGACTTCAAGCAGTTTCTGTCGAGCAAGGGTGTTCAGGTAGAATT 
TGCAGGTGGAGGAGCTTTACGTTGTGGTGAATATGTCACTCTACGAAAGGTTGGACCGAC 
GGGTCAAAAGGTAATTCAAAGCAAATACTGCATTTCTTACAACAAATCAGAGAATGACTT 
ATATATGTTGGGGATTGTTCAGGGAGGAGCATCGGGTCCACAGCAAATTCTGATAGAAGG 
ACCGTTGTGTGAAGACTATTACAAAATCAGGGATTATCTCTATTCTCAGTTCTACCTCCT 
CTGAGCATGATATAGAAAAAAAATGAAGCTTCTTCTCATTTTCTCAACATTTTTCAACCA 
CTCAACATGTAATCTCGTATAGTTTATTGCCTTGCTTATAACCCTCAAATCTTATAGATT 
AATGTGTTAAAAATGGCAATAGCTTTTTGTAACTTTTTTGTACTTGTCATCTTAGTAGAA 
GCTTAAGTTGTCATTGGATATATTCCACTCC
>AT3G12280.1 |  RBR1 (RETINOBLASTOMA-RELATED 1) transcription factor binding 
TATCCTTTTTTAGGGTTTGCCGCATAATCAGACCCCATTCTAGAGAGAGAAGAGGGAAGT 
CAGGTGAAGATAGAGAGAGACACTGAGAGGAGGGAAAATTTGTAGGGTTTTCGGAGATCT 
CTGTGATTCCTCTGAATTTGTCGAATTTTTTGGAGGAGGCGTTAGAAGTCGGGCTTCTTA 
AAAATCAGATCTTCTGCTCAGGCTTTAATCGGCGACGTCTGGTATTGGGATCTGTGACAC 
AAAAAGGTAAGATCTTTCTCTATTGCCTATCCTTTGATTTGAAATCTTATCCTCTAGGTG 
GTTTATCTGAAATTTTCTATTGATATTTCGCTATTCGATTGTAAGTTGGTGAGAGAATTC 
TCCAAAAACAAAAAAGAGAAAAACTTTGAATGAATATTTAAGATAACATCTGGGTAAAAT 
TTTTCCGGAGTGGTGGGTTTTAGATTATGCCCCAATTTCTCTTCTTTTTTTCCCCCAAAT 
TTTGTCTTTCTGCCATGTTTTGGGAAATTGGGAGTTTGTTTTCTCATGTCTGTTAGTGTG 
TTCTTCCGAATGGGTTGGGCATGGTTCCTATTGAATTTCAGTGTGATTAAATTAACAAAT 
CTCTTTGCTTGAAAAGTCCCTTTTTCTTCGTCTTCAGTTAGCAGTTTAATTGGAAGTAAA 
ATTAGCTTGATTTTGCATGTTTTCAGCTGCGTTGGAGACTATGGAAGAAGTTCAGCCTCC 
AGTGACCCCGCCCATTGAACCAAATGGGAAAAGAAGCGAAGCCTCTCTCTTGGACATATG 
CGAGGTTTACTCTTCTCTTTGCTGATCTAGTTGCATTTGTTTAGTTGAAGATACCATTTG 
AGTTCTCTCGGAAATTTTGAGGACTAGCTCTAATCCCTGTAGTTGATTTCTTATTGCAGA 
AAGTTCTGTCTCTTGATGGGAGCACTTGCGATGAAGCTTTGAAGTTGTTTACAGAAACCA 
AACGAATTTTGTCAGCAAGCATGTCTAACATTGGAAGTGGAACGGTGAAATACATTTTTC 
CTCTAACTTCTCTTTTATCAGTTAACTGTGGTTTCATTATGACTAAATCCTTTTTTCTTC 
TTCTTATTAGCGGGAAGAAGTAGAGAGGTTCTGGTTTGCGTTTATTCTCTATTCAGTGAA 
GAGGCTTAGTGTGAGAAAAGAAGCGGATGGTCTGTCAGTGTCTGGTGATAATGAGTTTAA 
TCTATGTCAGATACTGAGGGCTCTGAAGCTAAAGTAAGTAGTGTTCAATTCTTCCTTCCT 
TGTCATTCTTAAATTCATTTGTAGTGACGATTTTCCTCTTTTCTGTTTATAGTATTGTGG 
ATTTTTTTAAAGAGTTACCTCAGTTTGTGGTCAAGGCTGGATCTGTACTGGGTGAACTTT 
ACGGCGCAGACTGGGAGAACAGACTTCAGGTTTTGACTAACATCTTTTAAATATACTTCT 
ACTTCTATTATATCATTGTTAAATATGCTTCTATTAACTAATTTTTACTTACTAGGCAAA 
GGAGGTGCAGGCTAACTTTGTGCATCTTAGCCTTCTAAGCAAGTGAGTTTAGCTCCCTTC 
CTATTTTACATTTATCTTTGTTTTGTGTAAGAATAGTTATTGACATAGATTTCATATTTT 
GGACCTGCAACTTAGAAGCAAATTTTCTTCCTATGCAATAATCAGAATATGGGCTTGCAA 
TATTCCTTCAATTTTAAATTAATTAAGATTTAGAGTTACAGATTTCTGGTTTTCATGTGA 
TTATATTCTGTGAATTGTTTTAAGGACATGTTAAAGTATGATGTTTTTGGTACCTTTCCT 
TGGTAACAGATACTACAAACGTGGGTTCCGGGAATTCTTTTTGACATATGATGCAAACGC 
AGAAAAGAACTCAGCAAACTCTTCTACCTATTTGCTGGATAGTTATCGTTTTGGATGGCT 
ACTCTTTTTGGCACTCCGAAACCATGCGTTTAGTCGATTTAAGGACCTCGTGACATGCTC 
AAATGGCGTAGTTTCTATATTGGTTAGTGACTACCTGTGGAGCTCTCCCTAATCTTTCAT 
TCATTTTAGTCTTGCTGTACATTATTACTTGAAAGATGCTTCGTTTAATATAACGCAATT 
GAAGTATAGGCTAACTCCTTTTCATGTTATCAGGCTATTTTGATCATACATGTTCCTTGT 
CGGTTTAGAAATTTCAGCATCCAAGATTCTTCTCGCTTTGGTGAGTGTTTATCTTTTCTT 
CTATCCCGATAACCATGGCACCATAGAATGTTTATCATCTATTTTCATTTATGTGATGAA 
TCTCAGTTAAGAAAGGTGACAAAGGTGTAGACTTGGTTGCATCACTTTGCAAGATATATG 
ACGCCTCAGAAGATGAGTTGAGGATAGTAATTGACAAGGCAAATAATTTGGTAGAAACCA 
TACTGAAGAAAAAGCCATCTCCAGCATCTGAGTGCCAAACTGACAAGCTAGATAATATTG 
ACCCAGGTTGGTCTAAAATCATTTTCCTTCTTCAATTAAAGAATCATGTGAGTTCATTGA 
ACAGTTGCCTGATTGTTCTTCGAATCTATATGGTGTTTTACTGCAGATGGCTTGACCTAC 
TTTGAGGATTTACTGGAAGAGACGTCCATCTCAACTAGCTTAATTACACTTGAAAAGGAT 
TACTATGATGGTAAAGGCGAACTTGATGAGAGGGTATTCATCAATGAAGAGGATAGCTTA 
CTTGGATCTGGAAGCTTATCTGCAGGAGCTGTTAATATTACTGGTGTTAAGAGGAAAATT 
GATGCTTTGAGCTCACCTGCAAGGACATTTATAAGCCCACTTTCTCCTCATAAGTCGCCT 
GCTGCTAAGACAAATGGTATTAGCGGTGCTACCAAGTTGGCAGCAACACCAGTGAGCACA 
GCAATGACAACTGCCAAGTGGCTCAGGACTGTCATATCCCCGCTTCTGCCAAAACCTTCT 
CCTGGGTTGGAACATTTCCTTAAATCATGTGATAGGGATATAACAAATGACGTCACACGA 
AGAGCACACATAATATTGGAAGCTATTTTCCCAAATAGTTCCCTTGGTGCCCAATGTGGA 
GGTGGAAGTTTGCAAGCTGTTGACCTGATGGATGACATATGGGCAGAGCAGCGCAGATTA 
GAAGCTTGTAAGTTATACTACAGAGTTCTTGAGGCAATGTGTAAAGCAGAAGCTCAGATT 
TTGCATGCAAATAATCTGAACTCTTTATTGACAAATGAGAGGTTCCATAGATGCATGCTT 
GCTTGCTCAGCTGAATTGGTACTGGCTACCCACAAAACAATTACAATGTTGTTCCCAGCT 
GTTCTGGAGAGGACTGGGATCACAGCCTTTGATCTCAGCAAGGTAATTGAGAGTTTCATA 
CGACATGAAGATTCTCTGCCTAGAGAGTTGAGACGACATCTGAATTCACTGGAGGAACGG 
CTTCTAGAGAGTATGGTATGGGAGAAAGGCTCTTCAATGTACAATTCTCTGATTGTTGCC 
AGGCCATCGCTTGCATTGGAGATAAATCAGCTCGGTTTACTAGCTGAACCAATGCCATCT 
CTGGATGCAATCGCAGCACTTATTAATTTCTCTGACGGAGCAAATCATGCATCATCTGTA 
CAAAAGCATGAAACTTGTCCAGGTAGTTTTATTTGTTTCTGAATTAAAGCAGTTTTCCAA 
CCTGTTGTTAATGGTATGATTTTCTTACCAAAAATTGTCAAATTTGCTGCCATATAGGAC 
AAAATGGGGGGATTAGATCGCCCAAAAGATTATGTACTGATTACCGCAGCATTCTAGTTG 
AACGCAATTCCTTTACATCACCAGTAAAGGATCGTCTGTTGGCCTTAGGCAACGTTAAAT 
CCAAGATGCTGCCACCTCCGTTGCAGTCTGCATTTGCCAGGTACATTTTGAGTAACTATG 
AGTAGAAATGGAGAGTTAGTTTACCTATCTAGTTGTCCCTGTACTTGTTAAGTAACCTCT 
TCGGATTTATGTCTACAGCCCAACACGGCCCAACCCAGGAGGTGGAGGAGAAACTTGTGC 
AGAAACTGGAATCAATATTTTCTTCACAAAGGTAGGTCTGTGAGATCTTTGGATCTACTA 
CTAATCGTTTGGTTAGATGATGTACTACAAAACACGGTATTGATTCTTCATTTTCGGCTG 
GGAATTGTGTTAAATGTGGTGGCTCTTCCCAGATTAATAAATTGGCTGCTGTAAGAATCA 
ATGGAATGGTGGAAAGACTACAACTTTCACAGCAAATAAGGGAGAGTGTGTATTGTTTCT 
TCCAACATGTACTTGCTCAGCGGACTTCTCTTTTATTCAGTCGACACATTGACCAGATCA 
TTCTCTGTTGCTTCTACGGAGTGGCCAAGGTGAGTAGTGTGATTCAAAGGGTTTAACTAT 
ATGTCATCTGGTTTACAATGGCTTCTCTTACACTTACACTTTTTCCATGAATCACCTTGT 
AGATATCCCAAATGAGCCTGACTTTCAGGGAAATCATATACAACTACCGGAAGCAACCAC 
AGTGTAAACCATTAGTTTTCCGCAGCGTTTATGTGGATGCGTTACAATGTCGCCGTCAAG 
GGGTATATATACACTCTTAACCTTATGCTGAAAAGTTTCTTTACTCGGTGGAGAAGACTA 
AATTTGTGACAATGACTTGAACAGAGAATAGGGCCAGATCATGTTGACATCATCACATTC 
TACAATGAAATATTTATTCCTGCCGTAAAGCCGCTGCTGGTGGAGCTAGGTCCTGTAAGA 
AACGACCGGGCTGTGGAAGCCAATAATAAGCCTGAAGGTAGTTAAGAAAGGCCAGATACT 
TGTTAGATGTAAGCTTTGTCTATCAATTTAGTCCCTAAGTTAAATGATCGTCTTATTTTG 
GATTCACAGGTCAATGTCCCGGATCGCCAAAGGTGTCTGTGTTTCCAAGTGTTCCAGACA 
TGTCCCCTAAAAAAGTATCTGCAGTGCACAATGTTTATGTTTCTCCTCTTCGGGGATCAA 
AGGTAAAGAAGATCATAGTGCTTAACTCTTTATCATGATATGACTAAGTCTTGAGGAGGA 
GGTAGGTGACAAGATTGTTTGGTTACCTTCCATGTGTTGTGTGTTTGCAGATGGATGCTC 
TTATTTCACACAGTACAAAGAGTTACTATGCTTGTGTTGGAGAGAGTACACATGCTTACC 
AGAGCCCTTCAAAGGACCTATCTGCCATCAACAACCGCTTGAACAAGTAAGTAGAAAAAT 
CACGTCTCTCATCAGCTTCTTCCATAAAACCAATCACTGACCCAATCCAATTTCATCTGG 
TGTCACAGCAGCAGCAGCAACCGCAAGAGGACGCTAAACTTTGACGCAGAAGCAGGGATG 
GTCAGCGATTCCATGGTAGCAAATAGCCTTAACCTCCAAAACCAAAATCAAAACCAAAAT 
GGAAGCGATGCATCGTCCTCAGGTGGTGCCGCACCCCTTAAAACCGAGCCAACAGATTCA 
TAGATATCTCTCTCTACTTGCTACACCAACTTCTCTTCAGTTATAGCATCTGTAAATCCT 
TATGTTGCAGAGTTTGCTTTTATGTTTAGCTTTCTAGTTTATAGTGATCACCTCAGGCTA 
TGAGCGGATGGATCCCTTTATTGTTTCTTTTTTCTTTTTTTATCTTAGTTAAGTCAGTCT 
TAATAAGCATTAATAAATGTCTTTTTCTTGTTCACTCTTTCTAACTGTGTTCGGTGTCCC 
ATCTACTAAATTTATTTTCCAC
>AT1G08880.1 |  H2AXA DNA binding 
GAAGAGCAAAACCCTAAAGCCCACTCATCTTCTCAATTCCCAGATCATCTACAATAGTCA 
TTTCTCTTCGATTTCTTCAAACTCTCATCAAATCGTTTATCTGTTCTAAATTTCGAAGAA 
GACGATGAGTACAGGCGCAGGAAGCGGAACAACCAAAGGTGGCAGAGGAAAGCCAAAGGC 
CACCAAATCCGTCTCTCGATCATCTAAAGCCGGTCTTCAATTCCCCGTCGGAAGAATCGC 
TAGATTCCTCAAATCCGGTAAATACGCCGAGCGTGTCGGTGCCGGAGCTCCGGTCTATCT 
CTCCGCTGTTCTCGAGTACCTCGCCGCCGAGGTAATTTATTTTTCTTGTCTTCCAATTTG 
GTTTTCAATTTCGATTTGGTCACATCTGAATTGGATCTTGTACTGATTTGATTTTGATTT 
GGTTTGGGTTGATAGGTGTTGGAGCTGGCGGGAAACGCAGCAAGGGATAACAAGAAGACA 
CGTATAGTACCAAGACACATTCAGCTTGCAGTGAGGAACGATGAAGAGTTAAGCAAACTT 
CTGGGAAGTGTGACGATTGCGAATGGAGGAGTTTTGCCAAATATTCATCAGACTCTTTTG 
CCATCCAAGGTTGGCAAGAACAAAGGAGATATTGGATCTGCTTCTCAGGAGTTCTGAGGT 
TCTTAGACTTCTTAGTTCAGTTCTCTTGTTTGGATTCGGAACTTGTAAAATAGACCCTGA 
TGGTGTTTTTTGGGGATCAAATTAGGTTTTAAAGCTAAGTATATTTGGCTTTTGCCTAAG 
TATGTTTAATTAGTGAATGATATGATATTTCGGAACGAATCATGTATCAATGGAACTGAA 
TTAATCGATATA
>AT1G17760.1 |  CSTF77 protein binding 
AGAACCGCGGAAAATATTCGTTTCCTGAAGACGGACCGGTTGCTTTGAGTTTCCCCGTTC 
GACAATAGGGTATCACCGACCACCGTGTTTCGGGCAGACTCGTCGGAGGAGTGTTAAAAT 
TGTTGAATCTCAGATTAGGGTTTACTTCTATGGTAAACTTCTGAAGGTCTGTCTGTTTTC 
CTGATCTGAGGTCCTTCTAGGGATTTTTTTTTATGGCGTTGAAGCAGCAGAAGCTTTAGC 
TAGACTTGTCGGAAGATTGTGACACTTATTGAATCTCAGATTAGGGTCTACTTATATTAC 
CATTGAGTGGAATATTTGAAAGACTGTTCTTCCGAAGGTGAAATTCATGGCTGATAAGTA 
CATCGTCGAGGAAGCAGAGGCTTTGGCCAAGAGAGCTTTGGTACAATTCTTTCCCCAGCT 
ATATACTTGTCTGACTTCTCGTACTCTTTCATAAAGTTTAGATTTTTACTTGTTGGGTTT 
CGTAAAATTGTGTCCTTTCCTCAGCATTCACCAATTGCACAGGCGACGCCGATCTACGAG 
CAGCTTTTGTCACTTTATCCCACTTCTGTAAGTTTCCCATGACTTTGCTTCCACGTATTT 
TAAGAGTTTCCTGATGTTTTTGGTTAATTGTGAGCTCCTTTGTACTCTGTAGGCGAGATT 
TTGGAAGCAATATGTGGAGGCACAGATGGCTGTAAACAATGATGATGCTACCAAACAGAT 
ATTTAGTCGTTGTTTGTTGACCTGCCTTCAAGTTCCTCTTTGGTAATGCCATGTTACCCT 
TTATTAGTCGTTGATAAGAGTCAATTTAACATCTTTTCGTCTCATTGTTGGGTTTCTTGC 
TCAGCTGCAATGCAAGTCTTGCCATCTCCTTGGATATAATTCTAACATCTTATTCTCTCA 
GGCAATGTTACATTCGGTTCATCAGAAAGGTCTACGACAAGAAGGGAGCAGAGGGTCAAG 
AGGAGACCACAAAGGCTTTTGAGTTTATGCTTAACTATATTGGTATTGCTTCTCTTCCGC 
AGTTTTGGCTCTATTTTGTTTGTTTTTCATTTCAATCATGTCTCATACATAGAGGGAATT 
TTTTCCGTTTTGTGAGTAATGAATACAGTTATGTTTAGTAAACAATATGATTTGATCAAT 
TTTATGCTTAATATAGTTGCTAATGATAACTATTCATCAGCAATAGCAAGCACATAGTTA 
CGCTTCGTGTCTATGTAGACCTCTAGTTTCCCTTTATCATGCCAACACATAACACAACTT 
GGGCCTTACAGATGGTTGTTTATTTCGATTTATGAATCTCCAGGGACAGACATCGCATCA 
GGGCCTATATGGACTGAGTACATTGCCTTTCTAAAATCTCTTCCGGTTCGTTATATCACT 
CTAACTTTGTCCTTGATACTAATAATTTGTTATTGCAGAGAAACTAATAGATTCCCATGC 
AGGCTCTTAACCTCAACGAAGATTTGCATCGGAAGACTGCTCTTCGAAAAGTGTATCATA 
GAGCTATATTAACTCCGACCCACCACGTTGAACAACTTTGGAAAGATTATGAAAACTTCG 
AAAATACTGTTAACCGTCAATTGGTAAACTTCTAAGAAATTAAAATTATGTGGCTTCTTA 
TTTTCATGAAAAGAAGCAGGTACGAACTTCATTCTCTTGGCTTTGTTGATGGATAATCTA 
ATCTAATCATGTGAGCAGGCAAAAGGACTTGTAAATGAGTATCAACCAAAATTTAACAGT 
GCCAGGGCTGTATATAGGGAGCGCAAGAAGTACATTGAAGAAATTGATTGGAACATGCTT 
GCTGTCCCACCAACAGGAACTTCCAAGGTAAAGAATTTATCATCCATTGCTTCTTTTTGG 
AACTGCTGAGTGCTGAATGTACAATTATTTTCTTATCTTTTTGAGTTCGATAAGATTGGA 
TATATTGACTCTTAAACTGCCTAAAAGACATTATGAGCATAATTCACGTCATGAGATCAT 
GTTATTAAGATAGGAAATACATATTGAGTATCATCTGCTTACTTTGCTACTTTACACCGT 
CTTATGGTTTTTTGCAGGAAGAAACCCAGTGGGTGGCCTGGAAAAAGTTCTTGTCCTTTG 
AAAAGTAAATCCCCAATTATCATATACAGTTTTTAATTTTAATATACATTCCATTCAGTG 
ATGATGTGTGTTTTACGTATCTCCTTAGCCATTGTTTCTCTACCATAGCTAGATTTTAAT 
ATATCGCAACAGTTAATTGGTCCCTTGGTAGATTTTTTTGATTTTTTCGGTTTACGCCTA 
ATGGTAAGACTTTTATATCTTGTTCCGTCTCTGTGTTTTGCCGATTAAGATTTATGATAT 
TAACTAGAGAGCTGGAATAAATTACTATCCAGTTATGTCTCCAACAAGTGATGATGAGGT 
CTTATGCATAGAATTGTTTAACGAGTCCTTCTAAATATAACAAACTTCTGTATCTAATAC 
AATTGTAAATTTCAGAGGAAACCCTCAAAGGATTGACACGGCCTCGTCAACTAAGCGGAT 
TATATATGCCTATGAACAGGTATGCGAAGAGTCAGTGAGATGCTCTTGCTGAAATTTTGG 
AGGACTAATCTCCGAAATGTGTTCATTTCTGAATTGACTGACTATTACTCTGGTTTTACA 
GTGTCTGATGTGTTTATATCACTATCCCGATGTATGGTATGACTATGCTGAGTGGCACGT 
AAAATCTGGTTCCACGGATGCTGCAATCAAAGTATTTCAGCGAGCTCTTAAAGCCATTCC 
TGGTAAAAATCTAATCTATCCTTTTTTCTTTATGTCTATGAACTAGTTGCTTTATGAAGG 
ATCAACTATTACTCTTTGCTTACCTGCTGGCTTACTGTTTTAATCTTATCTTCTATCTAC 
TCTTAAGAAGTCTATTTTCTCTCTGCGACTCTTTTATATTTTTTACTAAGTGTCTACATT 
TCCCACTCTCGTATGTCAGATTCAGAGATGTTGAAATATGCTTTTGCTGAGATGGAGGAA 
TCTCGTGGAGCAATTCAGGTTTTTATTTCTTGCTGCTGGCTTCTTGTAATTTAGCTTTAT 
TAGTTGTCCGCATACTCGTTGCTTATAGTTGTATGATTTTGCAGTCAGCGAAGAAATTAT 
ATGAAAACATTTTGGGGGCTAGCACAAACTCTTTGGCACATATACAAGTAAGTACGCTCA 
AGTTTCAAAATTTAGGACTTGCGAAGATTGGCATAAACAGCATATCTTTCACTTTGAAAT 
TGTTTCTTTTCTCTGAAAACATTCTCATATGATATATACTTATATATATATATATATATT 
CTTTCGCAGTACCTTCGTTTTCTCCGGAGGGCTGAGGGTGTTGAAGCTGCTCGCAAGTAC 
TTTTTAGATGCTAGAAAATCTCCTAGCTGCACATATCATGTGTATATTGCTTTTGCTACC 
ATGGCCTTTTGTATTGACAAGGAACCAAAGGTGTATTTTCTTACCCACTATGTGGTGGTC 
TATATGCTATTTAGAACTGCTTTTGTCTTGTGAAGGAGGTAGTGGTCGTTCAGTCAAGTT 
CAGAACCCACTCGTCTTATTAGTCTCTTAGTTGTTTAAGTTAACCAGGACCCATGAGACT 
TTTGTGATAATAAAGTCAAAATGATTTGAATATTGGGGTGTTTTGGCTATTGATGCACTT 
AAACTCTTCATTTGTTTGCAAAATACATGTACGTTACTTTTATGCCTCGTACATTCCTCT 
TTGTGCCTTCATTTGTTCGATTCTTTAACAAAGAATTAACATGTTCTTGCAAGACATATA 
TACTAATGTAAACCATCTGACTTCAATTTCTATTCAGTTTCACAATAAAAATCCTTATGT 
TTGTATTTTTATGCAGGTTGCACATAATATCTTTGAAGAGGGGTTGAAACTCTATATGAG 
TGAACCTGTTTACATCCTTAAGTAAGTGTCACTGTAGCTTTACTTAGCGTTCCATTTTCT 
TAAGATACTTGGAAGCTCTTCTTTATTGAAGAAATATTGAGACTTTAAGACCTTCTCAGA 
TAAAATATCCTCAAACTTGTTTCTCTCCCAAACCTTCCTAAGACAGAATTTTAACCATCT 
GGTTTTGCTTTGCAATCTAGGTATGCAGATTTCTTGACTAGATTGAATGATGATAGAAAT 
ATCAGAGCTCTATTTGAGCGGGCATTAAGCACGTTACCAGTTGAAGACTCTGCTGAGGTA 
CGCTGATAGTGATATATTGTTTCTCAAAGCTGTTAAAGTATGCAGATTTTGTTCTTAAGC 
ATGAAAAGAGACAACAAGGAAAATTACTAACCTGCTAATGAAAATAACCAAACCGAGCAC 
CTAATTTGATTATAGCATTTCTGAATGCTTAAATATGATAATGGTTTAGCAATTGGAGGT 
GTAATCTTGATGCACATCTGAGCCTTATGAACAGTGGTGGGGATAGTAGACATTTAAAAC 
TGAACTGAAAGAGTCCAATATTATTGTGGTTCACATGTAATACTGTTTAAAATGCTAGAA 
CAATAAAGAAGACGACTGGTGTCAATGGGTTACGCCGTTATGCTAATTGATTTCTAGGAT 
TAACTTTTTTCTTGCTCCATGTTTTGTAGGTCTGGAAAAGATTCATTCAGTTTGAGCAAA 
CATATGGAGATCTTGCTAGTATTCTAAAGGTATTTTAACTCATTGAATGTTGTCAACGTA 
TACGAGGAAAGCTACTATTATTAGCTTCCTGTGTTTTGTTAGCATTTTTTGTAGTTGTTT 
TTCGGTTGACTCCATTATGATGATAAGTTTGTTGAAGGGTCCAAACATTTATATCTATTC 
CATCTTACTGGCTTTTAGTTGCATGGAAGATCTAAAAATGCTGACACGTTCAACTTATTG 
CTAGAATAGACTATGTCAGACTCGCACCTCATAAAAGAGACATTTGATCAACGATGAAAT 
TTACTGAAATCAGATCCACGATACATCCAGTATCAAGTGTGGCTGTTTGATGGAGTAGTC 
TGCTTATCTTCTTAGTTTTTTGCTCATAAATTTTCTTTACTATGACAACCTTGTTGTAGG 
TTGAGCAGAGAATGAAAGAAGCACTTTCTGGAAAAGGGGAAGAGGGGTCTTCTCCTCCAG 
AGAGTTCACTTCAAGATGTTGTTTCTCGGTACAGTTACATGGATCTTTGGCCATGCACTT 
CTAACGACCTTGATCATTTAGCCAGACAAGAGGTATTTTCCATGCAACATATCGCAATTA 
GCTCAAATAGCTACTAATGATACATCTAGTAAGTACTAATTCTAACCGATCAATGTGTTC 
ACTATAGTTGCTTGTGAAGAATCTGAATAAGAAAGCAGGGAAAACAAATCTACCTCATGT 
TCCTGCGGCTATAGGTCTGTTCTTTTTAATTTTCTGGTGTGATGGATTATGTTAAACTTT 
GGTGATGACTGAAGTAAATAAACCGCCTTCTGGGCTGACAGGTAGTGTAGCTTCTTCGTC 
AAAAGTTGTTTATCCAGATACATCTCAGATGGTTGTTCAAGACCCGACAAAGAAATCAGG 
TATCTGATTTGCACTTTGCCGCAATATTTGGCTGCACGATGAATGGAATTGTTAACTTAT 
TCTGAACCACTCATGATTTGACTGTAGAGTTTGCTAGTTCTGCAAACCCAGTGGCAGCTT 
CTGCTTCGAACACCTTCCCAAGTACTGTGACTGCAACTGCAACTCATGGATCAGCCAGCA 
CATTTGACGAAATACCAAAGACTACTCCACCTGCATTGGTAGCATTTTTAGCTAACTTGC 
CTATTGTGGACGGTAAATCTCTTAAAAACCAACTCCAAGTTGTATCTGAACTGAGCACCT 
GAATAAGTGTCCACTAACCAACTAGTTTATCATTATCTTCTCAATTCGCAGGTCCAACAC 
CCAATGTGGATGTTGTTCTGTCGATATGTTTGCAGAGCGACTTTCCAACAGGTCAAACTG 
TAAAGCAGAGTTTTGCTGCTAAAGGCAATCCTCCAAGTCAAAACGATCCCTCGGGTCCAA 
CCCGCGGTGTGTCTCAAAGATTACCAAGAGACAGAAGAGCTACAAAGAGAAAAGATTCAG 
ACAGTAAGTTACATATGCTTATAGTTTATGTTCAAGTATATATATTTTATGGCTCATGAC 
TATGTCATCACTCAAATGTTTGGCACTTCTTAGCTGCAGATGCATATAACTTCTACTATC 
CCTTAGAACAACCGTTAAATGATAGTTACTTATCTTATTCTATCTCTCTGTTAACAGGGC 
AAGAAGAAGATGATACAGCAACTGTACAAAGCCAGCCTTTGCCCACAGATGTTTTCAGAC 
TAAGGCAGATGCGGAAAGCTCGAGGGATCGCAACATCATCACAGACACCAACCGGTTCCA 
CATCGTATGGTAGTGCCTTCTCTGGCGAGCTTTCTGGTAGCACTGGCTAAAATATACTGA 
GATTGGCAAATTTGTGAAGCCTCTCTTAATACTTGTAATTTATTTCCCCCAACAATTCCA 
ACTTATGCAATAAAATTAAGTCTCTTTGGAT
>AT1G49760.1 |  PAB8 (POLY(A) BINDING PROTEIN 8) RNA binding / translation initiation factor 
CTCTTTGCAGTTTTTTTTCATTTGAGCTTCTCTCTGATAAGGTCACTTCCTCTGACCCTT 
TTATCTAAGCTCAACGCTGCAACTCTCGCCGTCGGTTACTTCCCCATTTTCCTTCCTTCT 
TCCGATTCAAAGACTCAATTTTTATTCTCCGGCGTTGAGGATTCATCTCCTAAAAATCTC 
TGCTTTATCTTTTGATTTGAGCTGATTTGGAGAGGAGAAGAAGATAGATAGATAGGTAAT 
TCGGATTGATATCTCGAAAAATGGCTCAGATTCAGCATCAGGGTCAAAATGCCAATGGTG 
GTGTAGCTGTTCCCGGTGCTGCTGCGGCTGAAGCTGCGGCGGCTGCGGCTGGAGCTGCGG 
CGGCGGCTGCCGGAGCTGCGCAGCAAGGGACGACGTCTTTATATGTCGGTGATCTGGATG 
CGACCGTGACGGATTCACAGCTGTTTGAGGCGTTTACCCAAGCGGGTCAGGTGGTTTCTG 
TCCGTGTCTGCAGAGACATGACGACTCGGAGATCTCTAGGCTATGGCTACGTTAACTATG 
CAACTCCTCAAGATGGTAACTTTCTTAAGGCTTATCTGATTTGGTAACTTAGTCGTTGTA 
GCTCATCTGAATTTGGGGTATGGACTGATGTGTTATATCAAATGCTAATCTAAATTTGGG 
AGCTTTCTATAAAAAAGGTGAAAGCTTTCAGGTTAATTTGGAAAGTGGTTACATTTGGTA 
ACATTGTGGGCTTTCAGGGTATTTGGCTGTTAGGGAGGATAGTTTTCTTTTGAGGTCATA 
GAGTTAGAGTTATGACCTCAATGTTATGAGTAGACTCAATGTTATTCTTCTTACAGAAAT 
GAATGATTTGAGTTATGTTGATGTTAATATTTCTGATTGGTGACAGCTTCCAGGGCACTG 
AATGAGCTGAATTTCATGGCTCTTAATGGAAGGGCTATAAGAGTTATGTATTCTGTTCGT 
GATCCAAGTCTCCGTAAGAGCGGAGTTGGTAATATATTTATTAAGGTACATATATTAAAT 
CTCTTTTTCCTATTGTCCAAGTTTGAACTTCTATGCAGAGATGGAAAGAAACCTTGGCTT 
GTTTAATATCCTATCTCAAAGTTTGTTTGTTTATTGACATGGTTTATTATCTGTGTCTCA 
GAATCTTGACAAATCAATTGATCACAAAGCACTTCACGAGACATTTTCAGCCTTTGGTCC 
CATTCTATCTTGCAAAGTGGCCGTTGATCCCTCTGGTCAGTCGAAAGGCTATGGGTTTGT 
GCAGTACGACACTGATGAAGCAGCTCAGGGAGCCATTGATAAACTGAATGGAATGCTTCT 
TAACGATAAGCAAGTTTATGTTGGACCCTTTGTTCACAAGCTGCAGAGAGATCCTTCGGG 
TGAGAAAGTTAAGTTCACTAATGTTTATGTCAAAAATCTCTCCGAGTCCTTGAGTGATGA 
AGAGCTTAACAAAGTTTTTGGAGAGTTCGGAGTGACTACTAGTTGTGTTATCATGAGAGA 
TGGTGAAGGAAAGTCTAAAGGCTTTGGATTTGTCAATTTTGAGAATTCTGATGATGCAGC 
CAGAGCTGTTGACGCTCTAAATGGAAAGACCTTTGACGACAAGGAGTGGTTTGTTGGGAA 
GGCCCAAAAGAAGTCCGAGAGGGAAACTGAACTCAAACAAAAGTTTGAGCAAAGTTTGAA 
GGAGGCTGCAGACAAGTCTCAGGGGTCGAACTTATATGTTAAGAACTTGGATGAGAGCGT 
CACAGATGATAAGCTCAGAGAACATTTTGCTCCCTTTGGAACTATTACATCATGCAAGGT 
CCGTGACTGATACAATAAAAAGCGCTGCTTGTTACTATCTTCAGCAGATTTGCATTAAAA 
TGTATTACATTTGAACGTGACAGGTGATGCGTGACCCCAGTGGAGTGAGTAGAGGATCTG 
GATTTGTCGCATTTTCAACTCCTGAGGAAGCAACTAGAGCTGTAAGTGACTAGAATATAA 
AGAAGACATGTCAAATTTTGGTGATCTCCTATTCTCTGGAAGGATCTTGATGCTTAACAC 
TGTCTTCTTTTCAATGTTTCAGATTACAGAGATGAATGGAAAAATGATCGTTACCAAACC 
TCTATATGTTGCTCTTGCGCAGCGGAAAGAAGACCGCAAAGCTAGGTTACAGGTCTGGTT 
AATTTACCCATGTTGTTATCCTTGAAAAGGATTATCCTAATCCCATGCTTATCGTGCTTA 
ATTTGACCTCTCTGGCATTTTAGGCTCAATTTTCACAGATGAGGCCGGTCAATATGCCAC 
CTGCGGTTGGTCCTAGGATGCAAATGTATCCACCAGGTGGTCCACCAATGGGTCAGCAAC 
TCTTCTATGGTCAAGGGCCTCCTGCTATGATTCCTCAGGTAAAGCTCAAAGCTTTAAGCA 
TAAAACATTTGAGACCAATCTTTATAACTTTCTTCTCCAACTGGGTATCGAACAGCCTGG 
ATTCGGATATCAACAACAGCTTGTACCGGGTATGAGACCTGGTGGGTCTCCAATGCCAAA 
CTTCTTCATGCCTATGATGCAACAAGGCCAGCAACAGCAACAGCAGCAACAGCAGCAGCA 
GCGACCTGGTGGTGGTAGAAGAGGAGCTCTTCCACAACCACAACAACCTTCTCCTATGAT 
GCAGCAGCAGGTTAAGTTTTGCTTTAGGCCCAAGACTTTCTCCACATGTTTAAAATCGAT 
AGCATGCTTACATTTTGCATCAATCTGTTTCTCTACAGATGCATCCAAGAGGTCGAATGT 
ATCGGTATCCTCAGCGAGATGTAAACACAATGCCTGGTCCTACTCAAAACATGCTTTCTG 
TTCCATATGACGTCTCAAGTGGTGGTGGTGTGCATCATCGTGACTCGCCTACTTCTCAAC 
CTGTTCCTATTGTAGCTTTGGCTACACGGCTTGCGAATGCAGCTCCAGAGCAACAGAGAA 
CGGTAAAGTCAAATGATTTGTTTCTAACAGCTCGGAAACAACTAAGAAAAATGTGTCTTT 
CTTAAACCTGTTATGTTTCTTCGTTATACAGATGCTTGGTGAGAATCTATACCCGCTTGT 
GGAGCAGCTGGAGCCAGAATCCGCAGCTAAAGTCACGGGAATGCTTCTTGAAATGGACCA 
AACCGAAGTACTTCACTTGCTGGAATCACCAGAGGCACTTAAAGCTAAAGTTACAGAAGC 
AATGGATGTTCTGAGGAGTGTAGCACAGCAGCAAGCGGGTGGTGCAGCTGATCAGTTAGC 
TTCTCTGTCTCTTGGAGACAACATCGTACCTTGAGAGTTCTAAGTTATATCTGAAAGAGC 
TCAGTTTATATACACTGTAAAAGTGTTTATTTTGTTCTTTTGGAGAATCAGAAACAGAGT 
TGTTCTTGAAAGTTTTGGATTTTTGAGTTTTTGTTTTGGGCGAGAGTTTTAACATTTTCC 
TTCTGTGTTTTTGATTTTCTTAATACTTTGGGAAGTTTTGTATCGTTACTCTCACCTTTT 
TTTACCTACACTGCTCATTTGATAGGGTATTGTTTGGCTTTTGTCTAGAGTTTCGACTTT 
TGGGTATAAAATTTGGTTTAAAAGCTTC
>AT1G61010.1 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
CTAACTGAAATTGCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAG 
AAAGACGAAACATGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGC 
GAGATGGAGATCAACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCT 
GTGTTTACATGTCCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAAT 
CAAGCAAATGTGTTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGT 
TGTGCAGTTTGATTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTT 
CGATGAGATTGATCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTT 
CTTCCTCTTTTGGCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGT 
CTTGATTTGAATAGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACA 
AAAACAGAAGGATGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTA 
GGAGGCTAGAGTTTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAA 
GAGGTTTATTGGGTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATA 
TAGATCATGCAGCATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATG 
ATTTTGTTTTTTGGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTT 
TGATCAGACGACATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAA 
GCTGTTGCTTACAGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGA 
TGAACAAGACATCAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTAT 
GACTATGTTTATACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAAT 
CTGCTTCAAAACTGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATT 
GACTTCCATCAAACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCAT 
GTTTTGGGTGCAGCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGC 
GACTATTCCCGTGAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCT 
GACATATGCATCATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGT 
GAGAAACGCTTCACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATC 
CCGGCTTTTGCACTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCG 
AACCACCCAGATCTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGT 
ATGGCGGTTTACCAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCA 
AATTCTAATCCGTTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAAT 
GATGTCGGTCCATCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGG 
CAACTCTTTGACAGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATG 
GTGGAAGGTACACTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAAT 
GGTCTTACTGCTCCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGAT 
TACGCGCAGACGAGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCAC 
GGTGAAGCTAACGAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGA 
AACACAAAGATCATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAG 
AAATTGGCGAAAACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTA 
AGCGGGATTCTGGTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCAT 
GTTTTCTCACAGCTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGA 
GCTTTTGGTGTGATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACA 
GATGAGGAATCGGGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAG 
TCAGAGAAGCACATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGAC 
TCCATTGTAGCTCTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAA 
GAAGATGCTGTGAAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCA 
CTTCTTGTTTCGCTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGG 
GTCGATGGCAATGTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCA 
GGTCTTAAGGAAAGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATC 
CCTCTCTCAGCTTCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATA 
GAGTTTTATCCATCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGT 
CTAATGGATGTTATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGAT 
AATGATCAAGTCTTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCA 
TAAATCATTTTGCTG
>AT1G61010.1 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
CTAACTGAAATTGCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAG 
AAAGACGAAACATGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGC 
GAGATGGAGATCAACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCT 
GTGTTTACATGTCCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAAT 
CAAGCAAATGTGTTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGT 
TGTGCAGTTTGATTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTT 
CGATGAGATTGATCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTT 
CTTCCTCTTTTGGCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGT 
CTTGATTTGAATAGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACA 
AAAACAGAAGGATGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTA 
GGAGGCTAGAGTTTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAA 
GAGGTTTATTGGGTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATA 
TAGATCATGCAGCATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATG 
ATTTTGTTTTTTGGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTT 
TGATCAGACGACATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAA 
GCTGTTGCTTACAGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGA 
TGAACAAGACATCAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTAT 
GACTATGTTTATACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAAT 
CTGCTTCAAAACTGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATT 
GACTTCCATCAAACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCAT 
GTTTTGGGTGCAGCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGC 
GACTATTCCCGTGAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCT 
GACATATGCATCATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGT 
GAGAAACGCTTCACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATC 
CCGGCTTTTGCACTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCG 
AACCACCCAGATCTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGT 
ATGGCGGTTTACCAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCA 
AATTCTAATCCGTTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAAT 
GATGTCGGTCCATCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGG 
CAACTCTTTGACAGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATG 
GTGGAAGGTACACTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAAT 
GGTCTTACTGCTCCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGAT 
TACGCGCAGACGAGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCAC 
GGTGAAGCTAACGAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGA 
AACACAAAGATCATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAG 
AAATTGGCGAAAACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTA 
AGCGGGATTCTGGTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCAT 
GTTTTCTCACAGCTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGA 
GCTTTTGGTGTGATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACA 
GATGAGGAATCGGGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAG 
TCAGAGAAGCACATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGAC 
TCCATTGTAGCTCTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAA 
GAAGATGCTGTGAAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCA 
CTTCTTGTTTCGCTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGG 
GTCGATGGCAATGTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCA 
GGTCTTAAGGAAAGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATC 
CCTCTCTCAGCTTCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATA 
GAGTTTTATCCATCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGT 
CTAATGGATGTTATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGAT 
AATGATCAAGTCTTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCA 
TAAATCATTTTGCTG
>AT1G61010.1 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
CTAACTGAAATTGCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAG 
AAAGACGAAACATGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGC 
GAGATGGAGATCAACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCT 
GTGTTTACATGTCCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAAT 
CAAGCAAATGTGTTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGT 
TGTGCAGTTTGATTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTT 
CGATGAGATTGATCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTT 
CTTCCTCTTTTGGCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGT 
CTTGATTTGAATAGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACA 
AAAACAGAAGGATGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTA 
GGAGGCTAGAGTTTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAA 
GAGGTTTATTGGGTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATA 
TAGATCATGCAGCATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATG 
ATTTTGTTTTTTGGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTT 
TGATCAGACGACATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAA 
GCTGTTGCTTACAGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGA 
TGAACAAGACATCAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTAT 
GACTATGTTTATACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAAT 
CTGCTTCAAAACTGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATT 
GACTTCCATCAAACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCAT 
GTTTTGGGTGCAGCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGC 
GACTATTCCCGTGAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCT 
GACATATGCATCATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGT 
GAGAAACGCTTCACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATC 
CCGGCTTTTGCACTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCG 
AACCACCCAGATCTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGT 
ATGGCGGTTTACCAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCA 
AATTCTAATCCGTTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAAT 
GATGTCGGTCCATCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGG 
CAACTCTTTGACAGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATG 
GTGGAAGGTACACTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAAT 
GGTCTTACTGCTCCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGAT 
TACGCGCAGACGAGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCAC 
GGTGAAGCTAACGAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGA 
AACACAAAGATCATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAG 
AAATTGGCGAAAACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTA 
AGCGGGATTCTGGTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCAT 
GTTTTCTCACAGCTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGA 
GCTTTTGGTGTGATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACA 
GATGAGGAATCGGGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAG 
TCAGAGAAGCACATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGAC 
TCCATTGTAGCTCTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAA 
GAAGATGCTGTGAAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCA 
CTTCTTGTTTCGCTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGG 
GTCGATGGCAATGTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCA 
GGTCTTAAGGAAAGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATC 
CCTCTCTCAGCTTCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATA 
GAGTTTTATCCATCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGT 
CTAATGGATGTTATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGAT 
AATGATCAAGTCTTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCA 
TAAATCATTTTGCTG
>AT1G61010.2 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
GCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAGAAAGACGAAACA 
TGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGCGAGATGGAGATC 
AACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCTGTGTTTACATGT 
CCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAATCAAGCAAATGTG 
TTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGTTGTGCAGTTTGA 
TTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTTCGATGAGATTGA 
TCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTTCTTCCTCTTTTG 
GCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGTCTTGATTTGAAT 
AGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACAAAAACAGAAGGA 
TGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTAGGAGGCTAGAGT 
TTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAAGAGGTTTATTGG 
GTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATATAGATCATGCAG 
CATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATGATTTTGTTTTTT 
GGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTTTGATCAGACGAC 
ATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAAGCTGTTGCTTAC 
AGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGATGAACAAGACAT 
CAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTATGACTATGTTTAT 
ACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAATCTGCTTCAAAAC 
TGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATTGACTTCCATCAA 
ACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCATGTTTTGGGTGCA 
GCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGCGACTATTCCCGT 
GAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCTGACATATGCATC 
ATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGTGAGAAACGCTTC 
ACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATCCCGGCTTTTGCA 
CTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCGAACCACCCAGAT 
CTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGTATGGCGGTTTAC 
CAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCAAATTCTAATCCG 
TTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAATGATGTCGGTCCA 
TCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGGCAACTCTTTGAC 
AGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATGGTGGAAGGTACA 
CTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAATGGTCTTACTGCT 
CCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGATTACGCGCAGACG 
AGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCACGGTGAAGCTAAC 
GAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGAAACACAAAGATC 
ATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAGAAATTGGCGAAA 
ACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTAAGCGGGATTCTG 
GTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCATGTTTTCTCACAG 
CTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGAGCTTTTGGTGTG 
ATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACAGATGAGGAATCG 
GGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAGTCAGAGAAGCAC 
ATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGACTCCATTGTAGCT 
CTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAAGAAGATGCTGTG 
AAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCACTTCTTGTTTCG 
CTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGGGTCGATGGCAAT 
GTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCAGGTCTTAAGGAA 
AGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATCCCTCTCTCAGCT 
TCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATAGAGTTTTATCCA 
TCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGTCTAATGGATGTT 
ATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGATAATGATCAAGTC 
TTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCATAAATCATTTTG 
CTGATTCGTGCTTTTCCCATATGCATTTTTCTATCATTATGCTGATCTAGGATATGGAAG 
CAAAAGCTTTGTGGTGCATCAAGTTAAGAGGTTTCTAAAGTTAAAAAAGTACTAGGCTTC 
TTCCAGATTCTTTGTAAGACATATTAGTGAGCCTTGCTTTTGATATTTGCAGTTTCATGA 
ATACACGGTGTCGTTTGATGCGTTTCTACCAAGCCTCTAAAGTACAAGGCAGGTCTGATT 
GAGCTAAAGTAAGGTAGAAGAGAGATTGTAATGAGCACATTTTCTATTATTTTTCCACGT 
ACAAAGTATACATTATTCACATCAGTGAATGTCTCTTGACCTCTATGTTTTGGCAAGATG 
TCTAGTGCATCAAGATATTAAGACCAAATCTCTACAATATTAAAATGCTTAATTTTTTTT 
TT
>AT1G61010.2 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
GCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAGAAAGACGAAACA 
TGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGCGAGATGGAGATC 
AACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCTGTGTTTACATGT 
CCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAATCAAGCAAATGTG 
TTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGTTGTGCAGTTTGA 
TTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTTCGATGAGATTGA 
TCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTTCTTCCTCTTTTG 
GCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGTCTTGATTTGAAT 
AGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACAAAAACAGAAGGA 
TGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTAGGAGGCTAGAGT 
TTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAAGAGGTTTATTGG 
GTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATATAGATCATGCAG 
CATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATGATTTTGTTTTTT 
GGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTTTGATCAGACGAC 
ATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAAGCTGTTGCTTAC 
AGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGATGAACAAGACAT 
CAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTATGACTATGTTTAT 
ACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAATCTGCTTCAAAAC 
TGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATTGACTTCCATCAA 
ACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCATGTTTTGGGTGCA 
GCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGCGACTATTCCCGT 
GAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCTGACATATGCATC 
ATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGTGAGAAACGCTTC 
ACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATCCCGGCTTTTGCA 
CTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCGAACCACCCAGAT 
CTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGTATGGCGGTTTAC 
CAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCAAATTCTAATCCG 
TTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAATGATGTCGGTCCA 
TCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGGCAACTCTTTGAC 
AGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATGGTGGAAGGTACA 
CTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAATGGTCTTACTGCT 
CCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGATTACGCGCAGACG 
AGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCACGGTGAAGCTAAC 
GAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGAAACACAAAGATC 
ATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAGAAATTGGCGAAA 
ACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTAAGCGGGATTCTG 
GTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCATGTTTTCTCACAG 
CTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGAGCTTTTGGTGTG 
ATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACAGATGAGGAATCG 
GGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAGTCAGAGAAGCAC 
ATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGACTCCATTGTAGCT 
CTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAAGAAGATGCTGTG 
AAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCACTTCTTGTTTCG 
CTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGGGTCGATGGCAAT 
GTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCAGGTCTTAAGGAA 
AGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATCCCTCTCTCAGCT 
TCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATAGAGTTTTATCCA 
TCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGTCTAATGGATGTT 
ATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGATAATGATCAAGTC 
TTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCATAAATCATTTTG 
CTGATTCGTGCTTTTCCCATATGCATTTTTCTATCATTATGCTGATCTAGGATATGGAAG 
CAAAAGCTTTGTGGTGCATCAAGTTAAGAGGTTTCTAAAGTTAAAAAAGTACTAGGCTTC 
TTCCAGATTCTTTGTAAGACATATTAGTGAGCCTTGCTTTTGATATTTGCAGTTTCATGA 
ATACACGGTGTCGTTTGATGCGTTTCTACCAAGCCTCTAAAGTACAAGGCAGGTCTGATT 
GAGCTAAAGTAAGGTAGAAGAGAGATTGTAATGAGCACATTTTCTATTATTTTTCCACGT 
ACAAAGTATACATTATTCACATCAGTGAATGTCTCTTGACCTCTATGTTTTGGCAAGATG 
TCTAGTGCATCAAGATATTAAGACCAAATCTCTACAATATTAAAATGCTTAATTTTTTTT 
TT
>AT1G61010.2 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
GCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAGAAAGACGAAACA 
TGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGCGAGATGGAGATC 
AACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCTGTGTTTACATGT 
CCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAATCAAGCAAATGTG 
TTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGTTGTGCAGTTTGA 
TTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTTCGATGAGATTGA 
TCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTTCTTCCTCTTTTG 
GCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGTCTTGATTTGAAT 
AGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACAAAAACAGAAGGA 
TGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTAGGAGGCTAGAGT 
TTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAAGAGGTTTATTGG 
GTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATATAGATCATGCAG 
CATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATGATTTTGTTTTTT 
GGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTTTGATCAGACGAC 
ATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAAGCTGTTGCTTAC 
AGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGATGAACAAGACAT 
CAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTATGACTATGTTTAT 
ACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAATCTGCTTCAAAAC 
TGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATTGACTTCCATCAA 
ACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCATGTTTTGGGTGCA 
GCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGCGACTATTCCCGT 
GAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCTGACATATGCATC 
ATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGTGAGAAACGCTTC 
ACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATCCCGGCTTTTGCA 
CTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCGAACCACCCAGAT 
CTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGTATGGCGGTTTAC 
CAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCAAATTCTAATCCG 
TTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAATGATGTCGGTCCA 
TCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGGCAACTCTTTGAC 
AGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATGGTGGAAGGTACA 
CTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAATGGTCTTACTGCT 
CCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGATTACGCGCAGACG 
AGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCACGGTGAAGCTAAC 
GAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGAAACACAAAGATC 
ATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAGAAATTGGCGAAA 
ACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTAAGCGGGATTCTG 
GTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCATGTTTTCTCACAG 
CTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGAGCTTTTGGTGTG 
ATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACAGATGAGGAATCG 
GGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAGTCAGAGAAGCAC 
ATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGACTCCATTGTAGCT 
CTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAAGAAGATGCTGTG 
AAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCACTTCTTGTTTCG 
CTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGGGTCGATGGCAAT 
GTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCAGGTCTTAAGGAA 
AGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATCCCTCTCTCAGCT 
TCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATAGAGTTTTATCCA 
TCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGTCTAATGGATGTT 
ATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGATAATGATCAAGTC 
TTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCATAAATCATTTTG 
CTGATTCGTGCTTTTCCCATATGCATTTTTCTATCATTATGCTGATCTAGGATATGGAAG 
CAAAAGCTTTGTGGTGCATCAAGTTAAGAGGTTTCTAAAGTTAAAAAAGTACTAGGCTTC 
TTCCAGATTCTTTGTAAGACATATTAGTGAGCCTTGCTTTTGATATTTGCAGTTTCATGA 
ATACACGGTGTCGTTTGATGCGTTTCTACCAAGCCTCTAAAGTACAAGGCAGGTCTGATT 
GAGCTAAAGTAAGGTAGAAGAGAGATTGTAATGAGCACATTTTCTATTATTTTTCCACGT 
ACAAAGTATACATTATTCACATCAGTGAATGTCTCTTGACCTCTATGTTTTGGCAAGATG 
TCTAGTGCATCAAGATATTAAGACCAAATCTCTACAATATTAAAATGCTTAATTTTTTTT 
TT
>AT1G61010.3 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
GCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAGAAAGACGAAACA 
TGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGCGAGATGGAGATC 
AACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCTGTGTTTACATGT 
CCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAATCAAGCAAATGTG 
TTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGTTGTGCAGTTTGA 
TTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTTCGATGAGATTGA 
TCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTTCTTCCTCTTTTG 
GCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGTCTTGATTTGAAT 
AGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACAAAAACAGAAGGA 
TGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTAGGAGGCTAGAGT 
TTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAAGAGGTTTATTGG 
GTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATATAGATCATGCAG 
CATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATGATTTTGTTTTTT 
GGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTTTGATCAGACGAC 
ATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAAGCTGTTGCTTAC 
AGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGATGAACAAGACAT 
CAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTATGACTATGTTTAT 
ACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAATCTGCTTCAAAAC 
TGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATTGACTTCCATCAA 
ACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCATGTTTTGGGTGCA 
GCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGCGACTATTCCCGT 
GAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCTGACATATGCATC 
ATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGTGAGAAACGCTTC 
ACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATCCCGGCTTTTGCA 
CTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCGAACCACCCAGAT 
CTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGTATGGCGGTTTAC 
CAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCAAATTCTAATCCG 
TTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAATGATGTCGGTCCA 
TCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGGCAACTCTTTGAC 
AGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATGGTGGAAGGTACA 
CTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAATGGTCTTACTGCT 
CCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGATTACGCGCAGACG 
AGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCACGGTGAAGCTAAC 
GAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGAAACACAAAGATC 
ATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAGAAATTGGCGAAA 
ACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTAAGCGGGATTCTG 
GTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCATGTTTTCTCACAG 
CTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGAGCTTTTGGTGTG 
ATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACAGATGAGGAATCG 
GGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAGTCAGAGAAGCAC 
ATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGACTCCATTGTAGCT 
CTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAAGAAGATGCTGTG 
AAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCACTTCTTGTTTCG 
CTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGGGTCGATGGCAAT 
GTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCAGGTCTTAAGGAA 
AGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATCCCTCTCTCAGCT 
TCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATAGAGTTTTATCCA 
TCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGTCTAATGGATGTT 
ATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGATAATGATCAAGTC 
TTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCATAAATCATTTTG 
CTGATTCGTGCTTTTCCCATATGCATTTTTCTATCATTATGCTGATCTAGGATATGGAAG 
CAAAAGCTTTGTGGTGCATCAAGTTAAGAGGTTTCTAAAGTTAAAAAAGTACTAGGCTTC 
TTCCAGATTCTTTGTAAGACATATTAGTGAGCCTTGCTTTTGATATTTGCAGTTTCATGA 
ATACACGGTGTCGTTTGATGCGTTTCTACCAAGCCTCTAAAGTACAAGGCAGGTCTGATT 
GAGCTAAAGTAAGGTAGAAGAGAGATTGTAATGAGCACATTTTCTATTATTTTTCCACGT 
ACAAAGTATACATTATTCACATCAGTGAATGTCTCTTGACCTCTATGTTTTGGCAAGATG 
TCTAGTGCATCAAGATATTAAGACCAAATCTCTACAATATTAAAATGCTTAATTTTTTT
>AT1G61010.3 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
GCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAGAAAGACGAAACA 
TGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGCGAGATGGAGATC 
AACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCTGTGTTTACATGT 
CCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAATCAAGCAAATGTG 
TTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGTTGTGCAGTTTGA 
TTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTTCGATGAGATTGA 
TCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTTCTTCCTCTTTTG 
GCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGTCTTGATTTGAAT 
AGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACAAAAACAGAAGGA 
TGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTAGGAGGCTAGAGT 
TTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAAGAGGTTTATTGG 
GTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATATAGATCATGCAG 
CATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATGATTTTGTTTTTT 
GGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTTTGATCAGACGAC 
ATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAAGCTGTTGCTTAC 
AGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGATGAACAAGACAT 
CAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTATGACTATGTTTAT 
ACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAATCTGCTTCAAAAC 
TGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATTGACTTCCATCAA 
ACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCATGTTTTGGGTGCA 
GCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGCGACTATTCCCGT 
GAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCTGACATATGCATC 
ATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGTGAGAAACGCTTC 
ACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATCCCGGCTTTTGCA 
CTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCGAACCACCCAGAT 
CTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGTATGGCGGTTTAC 
CAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCAAATTCTAATCCG 
TTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAATGATGTCGGTCCA 
TCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGGCAACTCTTTGAC 
AGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATGGTGGAAGGTACA 
CTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAATGGTCTTACTGCT 
CCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGATTACGCGCAGACG 
AGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCACGGTGAAGCTAAC 
GAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGAAACACAAAGATC 
ATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAGAAATTGGCGAAA 
ACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTAAGCGGGATTCTG 
GTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCATGTTTTCTCACAG 
CTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGAGCTTTTGGTGTG 
ATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACAGATGAGGAATCG 
GGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAGTCAGAGAAGCAC 
ATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGACTCCATTGTAGCT 
CTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAAGAAGATGCTGTG 
AAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCACTTCTTGTTTCG 
CTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGGGTCGATGGCAAT 
GTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCAGGTCTTAAGGAA 
AGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATCCCTCTCTCAGCT 
TCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATAGAGTTTTATCCA 
TCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGTCTAATGGATGTT 
ATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGATAATGATCAAGTC 
TTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCATAAATCATTTTG 
CTGATTCGTGCTTTTCCCATATGCATTTTTCTATCATTATGCTGATCTAGGATATGGAAG 
CAAAAGCTTTGTGGTGCATCAAGTTAAGAGGTTTCTAAAGTTAAAAAAGTACTAGGCTTC 
TTCCAGATTCTTTGTAAGACATATTAGTGAGCCTTGCTTTTGATATTTGCAGTTTCATGA 
ATACACGGTGTCGTTTGATGCGTTTCTACCAAGCCTCTAAAGTACAAGGCAGGTCTGATT 
GAGCTAAAGTAAGGTAGAAGAGAGATTGTAATGAGCACATTTTCTATTATTTTTCCACGT 
ACAAAGTATACATTATTCACATCAGTGAATGTCTCTTGACCTCTATGTTTTGGCAAGATG 
TCTAGTGCATCAAGATATTAAGACCAAATCTCTACAATATTAAAATGCTTAATTTTTTT
>AT1G61010.3 |  CPSF73-I (CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 73-I) protein binding 
GCTGTACTCAGTTCTTTGAGTTTCTTCTTCTCTTGGAGGAAAATCGAGAAAGACGAAACA 
TGGCTTCTTCTTCTACTTCTCTGAAAAGAAGAGAGCAACCAATTTCGCGAGATGGAGATC 
AACTTATCGTTACTCCGTTAGGAGCCGGAAGTGAAGTGGGTCGTTCCTGTGTTTACATGT 
CCTTCCGAGGCAAAAATATTCTGGTCAGCTTCTCCGTTTTGTTCTAATCAAGCAAATGTG 
TTTTGATTTTGTTGTTGGGGCATGTCTTATAGTTGATTTTGGTTGTGTTGTGCAGTTTGA 
TTGTGGGATTCATCCTGCGTACTCGGGCATGGCTGCGTTGCCTTACTTCGATGAGATTGA 
TCCTTCTTCCATTGATGTCCTCTTGATTACTCAGTATGTTTCCTTCTTCTTCCTCTTTTG 
GCTAATACCCATTAAGAAAAATTGAAACTTTGAAGAGAAAATGATAGTCTTGATTTGAAT 
AGAATGATAATTTGAGCAAAATCTTCGAAGTTTAAGTTTGTTTATACAAAAACAGAAGGA 
TGATGTGTAGTAGAGAGACCTTCTTGGATTAATTAGTTCAAGCTTGTAGGAGGCTAGAGT 
TTGTTCTGTCTCTGTTTGTCTACTTGAAAGAGTTTGTGTTTTGTGTAAGAGGTTTATTGG 
GTTAAGATAACATATAATGTGTTGATGCTTTTGGTTGCAGCTTTCATATAGATCATGCAG 
CATCTCTACCTTATTTTCTGGAGAAGGTTTGTTTCTCTTTTCAAAATGATTTTGTTTTTT 
GGGATGTGTTAAAACATAGCTGAGAACTAATTCAGGTTATTGATGTTTTGATCAGACGAC 
ATTCAATGGGCGGGTTTTCATGACACATGCAACAAAGGCCATCTACAAGCTGTTGCTTAC 
AGATTATGTAAAAGTGAGCAAAGTGTCTGTGGAAGATATGTTGTTCGATGAACAAGACAT 
CAACAAGTCTATGGACAAAATTGAGGTTAGTACTGCATTATATTCTATGACTATGTTTAT 
ACTTTGACTGCTCCACTAGGTTTGGGATAAGTTCAAAAGAAATTAAATCTGCTTCAAAAC 
TGTGATTGTTGAGTTAAGGTTTATATTTGATTTCCTCTATAGGTAATTGACTTCCATCAA 
ACAGTTGAAGTGAATGGCATAAAGTTCTGGTGTTACACGGCAGGCCATGTTTTGGGTGCA 
GCCATGTTTATGGTGGATATAGCTGGTGTCCGAATCCTCTATACAGGCGACTATTCCCGT 
GAGGAAGACCGACATCTGAGAGCAGCTGAGCTTCCTCAATTCTCCCCTGACATATGCATC 
ATTGAATCCACTTCTGGTGTCCAGCTTCATCAATCTCGTCATATTCGTGAGAAACGCTTC 
ACTGATGTAATCCATTCAACGGTTGCTCAGGGTGGACGTGTGCTGATCCCGGCTTTTGCA 
CTGGGCCGTGCTCAGGAACTTCTCTTGATTCTTGATGAATACTGGGCGAACCACCCAGAT 
CTACACAATATCCCAATCTACTATGCATCACCACTCGCCAAAAAGTGTATGGCGGTTTAC 
CAAACCTACATATTATCTATGAACGACAGAATCCGCAACCAGTTTGCAAATTCTAATCCG 
TTTGTGTTCAAGCACATTTCTCCATTAAACAGCATCGATGATTTTAATGATGTCGGTCCA 
TCTGTGGTAATGGCTACTCCTGGAGGTCTTCAAAGCGGTCTCTCAAGGCAACTCTTTGAC 
AGCTGGTGTTCAGATAAGAAGAATGCTTGTATCATACCAGGTTATATGGTGGAAGGTACA 
CTGGCCAAGACGATAATTAATGAACCAAAGGAGGTGACTCTTATGAATGGTCTTACTGCT 
CCGCTCAACATGCAAGTGCACTATATATCGTTCTCTGCTCATGCAGATTACGCGCAGACG 
AGCACGTTCTTGAAAGAGCTCATGCCTCCTAACATCATCCTTGTTCACGGTGAAGCTAAC 
GAGATGATGAGGCTCAAACAGAAGCTCTTAACAGAGTTTCCTGATGGAAACACAAAGATC 
ATGACCCCGAAGAACTGTGAGTCAGTGGAAATGTATTTTAATTCTGAGAAATTGGCGAAA 
ACCATTGGGAGATTGGCGGAAAAGACACCTGATGTTGGCGATACAGTAAGCGGGATTCTG 
GTGAAGAAAGGGTTCACTTATCAGATAATGGCACCTGACGAACTCCATGTTTTCTCACAG 
CTATCAACAGCAACTGTAACTCAGCGAATTACAATCCCGTTTGTAGGAGCTTTTGGTGTG 
ATAAAACATCGCCTGGAGAAGATTTTCGAGAGCGTGGAATTTTCAACAGATGAGGAATCG 
GGGCTTCCAGCACTGAAAGTTCATGAAAGAGTAACGGTGAAACAAGAGTCAGAGAAGCAC 
ATCTCACTTCAGTGGTCATCAGATCCAATAAGTGACATGGTTTCAGACTCCATTGTAGCT 
CTGATTCTCAACATCAGCCGAGAAGTCCCCAAGATCGTTATGGAAGAAGAAGATGCTGTG 
AAATCCGAGGAAGAGAACGGGAAGAAAGTTGAGAAAGTGATATACGCACTTCTTGTTTCG 
CTTTTCGGGGATGTGAAACTAGGAGAAAACGGGAAACTGGTGATTAGGGTCGATGGCAAT 
GTCGCTCAGCTGGATAAAGAGAGTGGAGAGGTAGAGAGTGAGCATTCAGGTCTTAAGGAA 
AGAGTGAGAGTAGCTTTTGAGCGGATTCAGAGCGCTGTGAAACCAATCCCTCTCTCAGCT 
TCTTAGTAGCTTTTTAAAGTCATCGTTGAGGTATCTTAAATCATCATAGAGTTTTATCCA 
TCTGATGATGTTTCTGTTCCCATGTTTAGTAATAGTGAATGATCAAGTCTAATGGATGTT 
ATTTAAGAAGGTGTTTATTGAGAAACTTTGCTACTACCCTACTGTGATAATGATCAAGTC 
TTATGGATGTTATCAACTATGAGTTTTTAACTTTTTTAGGTTTTTTCATAAATCATTTTG 
CTGATTCGTGCTTTTCCCATATGCATTTTTCTATCATTATGCTGATCTAGGATATGGAAG 
CAAAAGCTTTGTGGTGCATCAAGTTAAGAGGTTTCTAAAGTTAAAAAAGTACTAGGCTTC 
TTCCAGATTCTTTGTAAGACATATTAGTGAGCCTTGCTTTTGATATTTGCAGTTTCATGA 
ATACACGGTGTCGTTTGATGCGTTTCTACCAAGCCTCTAAAGTACAAGGCAGGTCTGATT 
GAGCTAAAGTAAGGTAGAAGAGAGATTGTAATGAGCACATTTTCTATTATTTTTCCACGT 
ACAAAGTATACATTATTCACATCAGTGAATGTCTCTTGACCTCTATGTTTTGGCAAGATG 
TCTAGTGCATCAAGATATTAAGACCAAATCTCTACAATATTAAAATGCTTAATTTTTTT
>AT2G39840.1 |  TOPP4 protein serine/threonine phosphatase 
CGTTTCTGATACTTTAATTAATACTCATTGAAAAAATCAATTCGAACTAAAAAAAATCTC 
GAAAGTCTTTGCGCGTAATTTTCTTCTTTATTTTGTTCTCACTGATTATTTTGCATTAGC 
TCTTTTCTTTTTTGGGGTCGAAAAAATTAGGTTTTTTTTTGGGATTCTGTTGATGGCGAC 
GACGACGACGACGCAGGGGCAGCAAACGGCGATTGACTCGGCGGTTCTCGATGATATAAT 
CAGGCGACTCACGGAGGTCCGGTTAGCTAGACCAGGAAAGCAAGTCCAGCTCTCTGAAGC 
TGAGATCAAACAGCTCTGTACTACAGCTAGAGATATTTTCCTTCAGCAACCCAATTTACT 
TGAGCTTGAGGCTCCCATCAAAATCTGTGGTATCTTCCCAATTTGATTCGTTGATTTTAA 
TAATTTCGTCGGAATTGATTTTAGGGTTCTTATTGTGTTTCTTAGATTTTCCAAAAGTGT 
GAACTTGGTTAGGTTTTGGGGATAAAGTTGTTAGACCATTGTGAGACCTTTTTGTTTGAT 
GTTGTGAAGTGACTAGAATCTGAGTGAGAAATGTTTTGGCTTTTTGTGGATAATGATTGA 
GTGGAGAGGCTTATCTTGTTGCTTATGATACTGTGTGTGTTCATGAAAAATCCTATCCCG 
TTCTGTGATTTCCTTATGGTTTGTGGTGTACATGTCTTAAACCAGGTGACATACATGGGC 
AATATAGTGATTTGTTGAGGCTATTTGAGTATGGTGGCTTCCCTCCTAGTGCCAATTATC 
TATTTCTTGGGGACTATGTGGACAGAGGCAAACAGAGTCTTGAAACAATATGTCTCTTAC 
TAGCTTACAAGATCAAATACCCTGGCAACTTTTTTCTACTAAGGGGAAACCACGAATGTG 
CTTCTATCAATAGGATATATGGATTTTATGATGAGTGTAAAAGGAGGTTCAATGTGAGAG 
TATGGAAGGTTTTTACTGATTGTTTTAACTGCCTTCCTGTTGCGGCGCTTATAGATGACA 
AAATATTGTGTATGCACGGTGGACTTTCGCCGGATCTTGACCATTTGGATGAGATTAGAA 
ACTTGCCGAGACCAACTATGATTCCGGATACCGGGCTTCTCTGTGATTTGCTCTGGTCTG 
ATCCTGGGAAAGATGTTAAAGGATGGGGAATGAATGATAGAGGTGTTTCATACACCTTTG 
GTCCAGATAAAGTTTCCGAGTTTCTTACGAAACATGATTTAGATCTTGTGTGTCGTGCCC 
ATCAGGTAGATATTTTTCAATCATGTCTCTTTGATACTACTGCTTTTGTGATGTTAACAA 
GGGAGTTGGATTTTTTATGGCAGGTCGTGGAGGATGGGTATGAGTTCTTTGCTGATAGAC 
AACTTGTGACGGTGTTTTCAGCTCCTAACTACTGTGGTGAATTTGATAATGCTGGTGCGA 
TGATGAGCGTGGACGAGAACCTTATGTGCTCGTTTCAGATTTTGAAGCCCGCTGAGAAGA 
AGACCAAGTTCATGATGTCCACAAAGATTTGATACTTTCATTGAGGTTAGTCAATAGTCT 
GTCCTTGGCGGAAACCAAAACGAAACTAGTGAATGAAAGGATTCTCTTGCACTGATTTGT 
TCATGTTATTCATTACAAAGTCAAGTTCACATTTCTGTTGAACATGATTTCTTTTGGATT 
CTTCCAGGCTAAACTTTTTACTTAAATGGGTCTTGATTTCGGCTTTTCCTTCTTTCACAG 
ATGGATTTGGTCTTTCTTGAGAAATTGATTGAAACCATTGAAGATTTGGCTGTGAAGTGT 
GTACTTATGGTAGTGAGAACTCTTGGAAAGGAGCAAGACCTTCTTAGTCTTCTAATCTCT 
TTCTTCCCCCAAATTCACTTTCAGCATTTTTTTTCTATCTTCTTTTATGGGTTTTACATG 
ATTTTCATCTGCCTGTTGGGATCACATAGTTGGTGTGTACATGCATATGGTCGTTTCTTG 
GATTTTAGGACACCAAATGAAAATGATGTTATAAAAAAGGTTTAGTATGATG
>AT5G13480.1 |  FY protein binding 
GCTCTTGGGTTGTCATCAATTCGCGAATTTGATACACGCACACCCTAAAGAGAGATCCAC 
GCTCGTTTCAAGGTAACCTAAATTCGAACACTTTCGCAGTTTCCCTTCGATTCGAATAAA 
TCACTGTTCTCCGTGGGCAACAATGTACGCCGGCGGCGATATGCACAGGGGTTCACAGAT 
GCCACAACCACCGATGATGCGGCAGTCGTCAGCTTCTTCCACTAACATCAATCCCGACTA 
CCACCACCCATCTGGCCCCTTCGACCGTAAGTAGACTTTGAGCGTCTTCCTTTTATCGGA 
TTAGTGATGACTGTGAGATTTAATGTCTCTCTGTCTGATGTTGCAGCCAATGTAGACAGT 
TTTGGGGCGAAACGAATGAGAAAGCATACACAGAGAAGAGCTGTTGATTACACCAGCACC 
GTTGTTAGATATATTCAGGTAATGTATTCCCATTGCTGCTCACAGTATTTCTTTGTTAGA 
ACCTTTTGTACTGCTTGATTATATTTCTCTTGTTTTCTGTAAAGTTTTAGTCTTGGTCTA 
TATACTCATAGCCTCTGCTTTCCCCAGTTGAATTCTTCGGTCCTTTTTATCTCAAAAGCC 
ATTAGATAGGATTGTCTTTATGTCATGGAACTGATATGGATATGTAGTTCAACGAACTCA 
TACTTTATATGGAACTAAAAGTAGAGAGTGTTTACTCCATATATGTTTTTGTTCAGGCTC 
GAACATGGCAGCGAGACTCAAGGGATAGGACCACTCTGCAACCAACCCCAGCTGCAGCAG 
TTGATGTTAGATTTCTTTGCTTTTCTGGGTTTTGCAATAAGATTGAATGGTTTACTGATC 
TAACTTTTATATCAATGCTTCAGATGCTTCCCACAGTTGCCTATTCGGATAATCCTTCAA 
CAAGCTTTGCTGCAAAGTTTGTTCACGCATCTCTAAACAAGAACCGTTGTTCAATCAACC 
GTGTATTGGTATATCCCTCTACCAGCTGTGTGTTTTGTATTATTCTCTGTTTGCCATGTT 
TATCTATTCAAGAAAGCAACATCTTTCTTTCTTTGTTTTAACTCTATTATGCCAACTTAA 
TGGGATCATTGCTGATTGGGTTTCTTTTATTTAGTGGACACCTTCAGGAAGACGTCTTAT 
CACGGGCTCCCAAAGTGGGGAGTTTACTCTTTGGAATGGGCAATCTTTTAATTTTGAAAT 
GATTCTTCAGGTTCGTTTCTCAGATTGTATAACTAATCTGTTGAAACTTCTGTTTTGATT 
CTTCTATAGTTGCTGCTCCTGGTATTGACTGTTTAAATTTGTTGTCAATATCAGGCACAT 
GATCAACCTATTAGGTCGATGGTATGGAGCCACAATGAAAATTATATGGTTTCTGGTGAT 
GATGGAGGCACATTAAAGTAAATTTGTTTTTCCCTTTCAGTCCCTAACTTATGATGTTGT 
AAACGAGAAGCTCAGAATTCTATGATTCAAATGCTGTGACAATAAGGATCAATTGTTTCT 
TATGTATCAGGTATTGGCAGAACAATATGAACAATGTGAAAGCCAATAAAACTGCTCACA 
AGGAATCAATTCGCGATTTAAGGTAAAAAAAAGTTTGATATGTTGAATTGCATTAAATGA 
ATCTCTCAAAACTGAACAATGTGTATCCAACAGTTTTTGTAAAACAGATTTGAAGTTCTG 
TTCGTGTTCTGATGATACGACTGTTAAAGTCTGGGATTTTACCAAGTGCGTAGATGAAAG 
CTCATTAACCGGTAATGTTATTTGAACAGATTGGCGGCAGATACTTTATTTCTTTGTTGC 
TTGCTCTTCTAATTTGAATTTAGAAGGCCGCTTGAGATGTGCTGTACGTTATTAGAATTG 
GATTCTTAGGCTACATAGGAAAAGGTGTCATTGAGATTCGCTTTGGTGTCATGCCATGTA 
ACGTTAGTTAGTTTTAAAGGTTCCAAATTGGTGCTTATAACAAGTTTCCTATCCTTTTGG 
AGGCATGTTTTCACAGTTTTCTTCATATTTGTAATATTTGAGAACTTTCGAAGTAATCAA 
AGGGTTCTTTATATTTTGAACTCAGGCAGGCCATGGTTGGGATGTCAAGAGCGTTGACTG 
GCACCCCACAAAGTCCCTACTAGTTTCTGGTACATTATTTTATAGACTTCTATTTGAATA 
ATGCAATAAAAAGAAACCGCTGTATATTTCAGAGCTTCTCTATGGCTGATCATTAACCGC 
TTTAATCTGTGTTGTCAGGTGGAAAAGACCAACTTGTCAAACTCTGGGATACTAGATCTG 
GGAGAGAGCTTTGCTCACTGTAAGTAGTACATAATGTAATATGTAATTTTATTATAGTTT 
CATGTTCAAAGCTTTGACGAATTTGATGGCCTATTCTTACTTCTGCAGCCATGGTCACAA 
AAACATAGTACTTAGCGTGAAGTGGAACCAAAATGGCAATTGGCTTTTAACGGCCTCGAA 
AGATCAGATAATTAAGGTAAGTCTCACTTTCTTTTGGGTGGGGGGGGGGGGGGGGGATAT 
TGATTTGTAAATGAGATTTTTTCCTTGCATTATGGAAGCATTTGTATGACACTTATGCAT 
GTAATCTGCAGCTGTATGATATAAGGACTATGAAGGAGCTTCAATCCTTTCGTGGGCACA 
CGAAAGATGTAACATGTAAGCTGTCAAATTCTATAATGATCATGTTTTAAACACGTGAAA 
TCAGACAAACTGGCCGCATCAAATTACTTTTCTGTACATTGACTAGGACTCTAGAGTATA 
TGCCTTTGAAAGATTATCATTGTACCCATGCTTTACTTGTCGACATATGAGACATTATCC 
CATGGATGCGAGTTTTCAATTTGTTTCTTCGATATTTCTAATTTGCAACTATTTCTAATT 
AAAAGTTGTCTTAACTCTTTTTAAGCTTTGGCGTGGCATCCCTGCCATGAAGAATATTTT 
GTCAGTGGGAGCTCTGACGGCTCCATTTGTCATTGGATTGTGGGGTAGGTACTGTTGTGC 
AGCAGTATGCTGTTTTATTTATTCGTTCATGCTGCTATTGTTTTAATCACTTATAAGGGT 
TTTTTAAATCATGTTTCTTCTCTACATTTTATATTCAGTCATGATGCATCTACATACTAG 
TAGTCTAGTAGCATCTTACTTTACCTTATATTTTGTGGTTTTTGTTTGAGGTGTATCTAA 
TTATGAAAACTTTTCTTAATTCCCAGGCATGAAAACCCGCAGATTGAAATCCCAAATGCT 
CATGATAACAGTGTTTGGGATCTTGCATGGCATCCTATTGGATATCTTCTTTGCAGGTAG 
CAATTTCAATAGTCTGGTGCTATGAGTTCCTTACAGTTTTATTCTATGATGTGTTGTGGT 
TCCCTGTGCTCTTGAATAACTAAATGCTTCAGATAATGATTTTTAACCCTATTATCTGCA 
GTGGTAGCAATGATCACACAACCAAGTTTTGGTGCAGAAACAGGCCTGCAGATAATCCCC 
GAGATGTTCTTATGCAGAACCAAGGTTTGTTTTTGGGCTATTAGTATCTGATTTTTTAGT 
AGGCATTGGGATGGATAGGTTGTGGGTAGTACATAATTACTATGTCCTTATCCATCTCAG 
TAGTAAGGATGTTGTGATAGGCTTAACTGGTCAGGCCCTGGCAGGGTCAGTCATATACTC 
CTATAATGGCTGGTTCGAAATGGACCTTGGCTTTTTAAGGTTCAGGCTCGGCCAGCCATA 
TGGCACCGTGATTAACTGAATTTTTTTGTAGAAAAGAACAGACTTGACTGGTCAAGCTGA 
GCTGATCTGATATAGGTGCAGATTTCTACAGGCTTTAAAAACTCAGACCCAAGTACTCGG 
TCATTAGTATCTCACTTACTGTTTTAATTTTGAGCATGTACTTTCAAGTTGCATTTGTCA 
GAAATTAGTGTTTTTTATTTAGTGTTTACTAACAAATTGAAGATGTGATTTGTGTGTACT 
GATAAGCGTAATTTGTATCAGGCTATAATGAACAAGGTTTTGGTCGCCAACCTGATAATT 
TCCAACCATCTGAGGCATCGCCAATCCCTGGAGCATTTGTGCCTGGGTTGACACGGAACG 
AGGGGACTATCCCAGGAATAGGAATAGCAATGCCATTTGATGCATCCTCTCAAGGGGATC 
ATAAACAGCCTCTTCCAGGTTCCATGGCACTGGGGGCTCCTCCTTTGCCACCTGGTCCCC 
ACCCATCGCTTCTTGGAAGTGGCCAGCAGCAAGGGTATCAGCAACAACAACAACACCAAG 
GTCATCCCCAGCAAATGCTTCCAATGCCCAATATGCCTCACCATCAGCTACCACCATCAT 
CTCATATGCCATTGCACCCTCATCATCTTCCCCGGCCTATGCAAATGCCTCCTCACGGTC 
ACATGCCACCTCCCTCAATGCCTATGTCTCATCAGATGCCTGGATCAATGGTATGGCCCT 
CAGATCTCTTGTAATTCAACCACAACTTAAGCCTGGCTTTTGTCGGTACCCCATGTGTTG 
GATTCCTCTTTGTTTTATTTTCTTAGTGATATCTTAGAGAGGTGTAGAAAGAGATATTAA 
TCCTCACTTGTTGTTGGAGTAGGGAATGCAAGGTGGCATGAATCCTCAGATGTCGCAAAG 
TCATTTTATGGGTGCTCCTTCAGGAGTATTTCAAGGACAACCAAACAGTGGCGGACCCCA 
AATGTATCCCCAAGGACGTGGTGGTTTCAACCGTCCACAGATGATTCCAGGCTACAACAA 
CCCTTTCCAACAGGTCCCATTTAAACACTAGTCTTTTGTTATTTAGTATACCCGTAAAGG 
TTTCACATGTATATATGTGCAAATAGGCAAAATGTCTACACAACAATGCAAAACACCTGA 
TACGATTGAACCACAATACAACTTTCTCAGCTAGTTTTAAACTCACTAGCTAGGTTCAAT 
GGTATGATTAGATGTTGAAAATGTAGAGCTAAAATAGCATAATCCGTTGACTAATCCGTT 
GTCTATATTTTATTTCGTGCAGCAGCAGCAGCCACCTTTACCTCCTGGCCCTCCACCAAA 
CAACAATCAGCAACATCAGTAGGCAGCCGTTGTATTAGTACATTAGTTTACAACCGCACT 
GTCTGCGGGATAAAACGATTGAAGTAAAACTATTATATGGGATTCAAATTTCGTTTCTAT 
AAAACAAAACAT
>AT5G14530.1 |  transducin family protein / WD-40 repeat family protein 
GTCCTCGGATTTTTCTCGTGCTTCACTGATAATCCAGCTTGACGATGTCGTTGACGGAGC 
TAGACGACGGACTGGTTCGCAGGATGGCCATGGGCGCAGTCTTCTCTGATTTTGTACGAA 
CGAATTTTTCTCTTTTTGTAATCTCATTTGATTTCGGATTAAACTTTGGTGGAATCCAGC 
TTCCGAGATTAATCCGTTCAATTTCTCGGTGTTGGTTTTACACAGGGAGGGAAGATACAT 
TCGGTGGGTTTCCATAGGACTGATGATCTATTGGTCACATCCAGCGAAGATGATTCACTT 
CGCCTCTTCGATATCGCCAACGCTAAGTCAGTTCTTCCTTCCTGTTTTTAGGTTTTATAC 
TTATCTGGTCAAGTTCTAGAGAAACTAGGTTACTTAAGGAATCAAGAAGAAGCTTTTTGA 
TTAACCGATTAGTTGAAATTCTTGTGGAGCAAAAAGAAGACTGAAATATTCAATTTGTAT 
GGATGTTTGTTAGACAGCTGAAGATTACATACCATAAGAAACATGGCACCGATCGTGTAT 
GCTTTACCCATCATCCTAGCTCTCTAATTTGCTCTTCTCGATACAATTTGGAGTCCACTG 
GTGGTGAGTCCTCCTTTTCTCTTGCTTGAGATTGGATAATCAAAGCGGTGGTGGATTATT 
ACTTACTTGTATACTTGTTTTTGTGTACCAGAATCCTTGAGATATCTCTCAATGTATGAT 
AATCGGATCCTACGCTACTTTAAAGGGCATAAAGACAGGTCTGCTTATAACCTCTGGAAT 
TGTGAATTTGGATTTTACTAGTATGTACATTGATGATGGAAAATGTTCTTCTGTTTCAGG 
GTTGTATCACTTTGTATGTCTCCTATAAATGATAGCTTCATGTCTGGTTCTCTCGACCGA 
AGTGTTAGACTCTGGGATCTTCGTGTAAATGCCTGCCAGGTTGGTTTCTATAGTTTTACA 
CTCTGAGAAGGCTAGATGGAATAAGTCTTAATATGCTAGAGTTTTAATGAGAAAAGTGCC 
TTTTTCTTTTTGTTAGCAAAAACCTCGTGATATATCACCTTGAAAGTTAAACTTGATGAA 
GATGCTGGAACCACGAAACATTGAGAATATTTAGGCTCTTTACCTTAATACTCTCTCTGT 
GAATTTATATGGTTTCATGATCTATGCTTACCCTTTTAGTCAATAGGGAATTCTACATCT 
ACGTGGTAGACCTGCAGTTGCGTATGACCAACAAGGCCTTGTGTTTGCAATTGCAATGGA 
AGGAGGTGCTGTTAAATTATTTGATTCCAGGTGTTATGACAAGGTTAGCTTCTTACAATG 
ATTCACACAGCCTTACGCATGACTGCTCTTGTTAGTTCTAACTTCTAAACCCAATTGATC 
TCTTATGTAGGGTCCCTTTGACACATTTCTGGTGGGTGGGGATACTGCTGAGGTTAACGA 
TATAAAATTCAGCAACGATGGGAAATCCATGCTCCTAACGACTACAAATAACAATATCTA 
CGTTCTTGATGCATATCGTGGAGAGAAGGTAATCACGTTCTCTATCTTTCACCTGAAGAA 
GACAGAACGTTAGGTTTCAAGTTGGTAAAAGACGGTATGTTATTTTGCAGAAATGTGGTT 
TTAGTTTGGAGCCTTCACAGGGTACACCCATAGAGGCCACCTTCACACCAGATGGCAAGT 
ATGTTCTGTCAGGTAATACGCGTTCCTAGATGATCTTTTATCATGACTCATCTACACAAT 
ATTCAAATTTAATCAGCTTAGTTTTCTTTTTCGGATACAGGTTCAGGTGATGGAACCTTA 
CATGCGTGGAACATCGAGAACCCATCTGAGGTAAAGTGCAGAATAATCAACACCACTAGG 
ACACTGATTCACTTAAAAGTGATGAATAATTTATAAAGTTGTAGATACTATTTTTGCGTT 
ATGCTTTCACAGTATTTAAATTTTAGTGGGGATTTTGTGTAAAAAGCAGGTGGCGAGGTG 
GGAGAACAACATAGGAGTAGTGTCGTGTCTGAAATGGGCACCACGTAGAGCCATGTTCGT 
TGCTGCTTCTACGGTTCTCACATTCTGGATCCCAAACGACGGTGAATCACCAGCCCCCGC 
CGATCCTCCTACCGATCAACAACAGTGACGACATATATGTTTCCATTATGCACTTGTGTA 
TCGTTTTTTAATGTTGACAATTAGAAAAATTTGGAAGCAGTAGTATGTTAATCAAATTTA 
GAGTTTATGAATTTGAGTCTAGATGGTTACAATATGTTTTCTTTAATGACTATTTACTCT 
TATTTTACGT
>AT5G46840.1 |  RNA recognition motif (RRM)-containing protein 
AATCTCTCTCTCCCTCTTTCTTCCTCTTCTCTCATTGAAATCGAACGAGGATGGGGAAGA 
AGAAATCGAAGGTAACGGAGCCGGAATCTCAAAACGATGAATCTCAGACAATCTTCTCCA 
CTCTCTTCTCCGGCGAGGTTGAAAGCTCTGGCTTTGCGAGTCTCTTCTCCGCTGATAACC 
CTTTCCGGCGAAAACAACCTCAAGAAATCAAAGAGTCGTCAATTCCTGATGAGAAGAAAG 
GGGATAAACGAAATGCAGAGAACGAAGAAGAAGAAGAAGAAACAGATTTGCCTGTGAAGA 
CGAAGAAATCTAAAAAGGAAAAAAAGCTTACAGATTCCGGCGACGAGAAAGAGACGATTT 
CGGAGGCTGTAGAAGAAAGTGGGTTGGTTTCAAAGAGGAAGAAGAGGAAGAGAGATGAGA 
TTGAGAACGAATACGAGACGAAGAAGTATGGAAGCGTTGAGATGAAAGAGAAGAAGGTTG 
GTGAGAAGAGGAAGAAAGCTGATGAAGTAGCTGATACAATGGTTTCAAAGGAAGGTTTTG 
ATGATGAGAGTAAGCTTCTTAGAACTGTTTTCGTTGGGAATTTGCCTTTGAAGGTTAAGA 
AAAAAGTCATCTTGAAGGAGTTTAGTAAATTTGGTGAGGTTGAATCTGTGAGGATACGCT 
CTGTGCCTATTGTTGATGTGAGTTTCTTATAGCTAAAGCCTAAAGATGAATTTAGGTTGA 
GTTTTTGTGTTCATTGGTTTCTGATTTCGTTTGATTTTTATTGATTGATTTAGTCGAAGA 
GGACAAGGAAAGGAGCTATAATGCTGAAACAAATCAATGAGAAAGCTTCAAGGTTTGTGC 
TTGAAACTCTATATAGTAATCATTTGATTTTGAAGTTTCAGTGATGAAAAAGTCTAATGT 
CAATGTTTGTGGAATTGCAGTGTTCATGCTTATGTTGTGTTTGAAACAGAGCAATCTGCT 
GCAGCTTCTCTGGCACATAACATGTCTCTGGTAATGTAACTTTTGCGCCTTTTGTTCTAT 
CTGGTTGATTTTTAAGGAGTTATGTGTAGATTGGCTAATAGTTTTATGTTATAATCAGAT 
TGATGGGAATCATGTCCGCGTTGATAGAGCATGTCCGCCTCGTAAGAAACAGAAAGGGCA 
TGATGATACTCATTTGTATGATCCTAAGAGGACAGTCTTTATGGGTAATCTCCCTTTCGA 
TGTGAAGGTTAGTAGTACTAGTCTTAAGGCTCTTCTTCTGTTTAATTTGCGATGATCGAA 
CTTTATCTTAGATTCTCAGTTTTGTTTGTTTCTAATGCAGGACGAGGAAGTGTATCAACT 
GTTTACGGGTAAGAGTAATCTGGAGAACAGTATAGAAGCTGTTCGTGTCATTAGAGATCC 
TCACTTGAACATTGGGAAAGGAATAGCTTACGTCTTGTTTAAAACACGGGTATGTTGAAG 
TAAACTTTGATCTTTGTAAGGTTTGAGTAATAAAAACTAATTAGATCTGATGAGTCCTTT 
TATTTTGTTAACTATAGGAAGCTGCAAATCTCGTACTCAAGAAAGGATACTTGAAGCTTA 
GAGAAAGAGAGTTACGGATTTCTCGAGTCAAACCTGATACGCCATCAAAGAGAAAGAGCA 
ATCCGTCTGAAGCTTACTCGCCGGCCCAGAAAAGACTGCAGAAGGACAAAGTGGTCACAC 
CAACTCCAACAGGGAAGGCTAATCTTTCATATCAAGGTGTACGAGCTTCAAAATCTGGTG 
ATGATAAGAAAACACCTTATCAGAAAAGCTCCGCGCAGACAAAGATGAGACCTAGAGGTA 
GCAGCAGCAATGACAACAAAAAATCTGGGAATAATAGTGCTTCAAAGGAAAGAAGTCAGA 
AGCGACCAGCTGTTGCAGCAAGAAAGGCGAAAGCAAACGCAAAAGGTTCAAAAGAGAGCG 
GTGGTAAGCGGTTTGCAGGGACAAAGCGTAAACAAGAAAACCGGACGCCTGAAAGCTTCT 
CTAAGAAGAAAAAAACAAAACGGTTTTAGACGGTTTCTTTCAACCATAATGGTGAACCTC 
TTTCTTCTTCCTTAGTTTTGATACTAGTAGTCGTTTTGTATTGTTCTCTTATATCAATCA 
ATGATGATATACTGTAATGTTGCAACAATTATGTTTTCGTGCAAGTTTAAAAGGAAAGCT 
ATTTTGATGA
>AT5G46840.1 |  RNA recognition motif (RRM)-containing protein 
AATCTCTCTCTCCCTCTTTCTTCCTCTTCTCTCATTGAAATCGAACGAGGATGGGGAAGA 
AGAAATCGAAGGTAACGGAGCCGGAATCTCAAAACGATGAATCTCAGACAATCTTCTCCA 
CTCTCTTCTCCGGCGAGGTTGAAAGCTCTGGCTTTGCGAGTCTCTTCTCCGCTGATAACC 
CTTTCCGGCGAAAACAACCTCAAGAAATCAAAGAGTCGTCAATTCCTGATGAGAAGAAAG 
GGGATAAACGAAATGCAGAGAACGAAGAAGAAGAAGAAGAAACAGATTTGCCTGTGAAGA 
CGAAGAAATCTAAAAAGGAAAAAAAGCTTACAGATTCCGGCGACGAGAAAGAGACGATTT 
CGGAGGCTGTAGAAGAAAGTGGGTTGGTTTCAAAGAGGAAGAAGAGGAAGAGAGATGAGA 
TTGAGAACGAATACGAGACGAAGAAGTATGGAAGCGTTGAGATGAAAGAGAAGAAGGTTG 
GTGAGAAGAGGAAGAAAGCTGATGAAGTAGCTGATACAATGGTTTCAAAGGAAGGTTTTG 
ATGATGAGAGTAAGCTTCTTAGAACTGTTTTCGTTGGGAATTTGCCTTTGAAGGTTAAGA 
AAAAAGTCATCTTGAAGGAGTTTAGTAAATTTGGTGAGGTTGAATCTGTGAGGATACGCT 
CTGTGCCTATTGTTGATGTGAGTTTCTTATAGCTAAAGCCTAAAGATGAATTTAGGTTGA 
GTTTTTGTGTTCATTGGTTTCTGATTTCGTTTGATTTTTATTGATTGATTTAGTCGAAGA 
GGACAAGGAAAGGAGCTATAATGCTGAAACAAATCAATGAGAAAGCTTCAAGGTTTGTGC 
TTGAAACTCTATATAGTAATCATTTGATTTTGAAGTTTCAGTGATGAAAAAGTCTAATGT 
CAATGTTTGTGGAATTGCAGTGTTCATGCTTATGTTGTGTTTGAAACAGAGCAATCTGCT 
GCAGCTTCTCTGGCACATAACATGTCTCTGGTAATGTAACTTTTGCGCCTTTTGTTCTAT 
CTGGTTGATTTTTAAGGAGTTATGTGTAGATTGGCTAATAGTTTTATGTTATAATCAGAT 
TGATGGGAATCATGTCCGCGTTGATAGAGCATGTCCGCCTCGTAAGAAACAGAAAGGGCA 
TGATGATACTCATTTGTATGATCCTAAGAGGACAGTCTTTATGGGTAATCTCCCTTTCGA 
TGTGAAGGTTAGTAGTACTAGTCTTAAGGCTCTTCTTCTGTTTAATTTGCGATGATCGAA 
CTTTATCTTAGATTCTCAGTTTTGTTTGTTTCTAATGCAGGACGAGGAAGTGTATCAACT 
GTTTACGGGTAAGAGTAATCTGGAGAACAGTATAGAAGCTGTTCGTGTCATTAGAGATCC 
TCACTTGAACATTGGGAAAGGAATAGCTTACGTCTTGTTTAAAACACGGGTATGTTGAAG 
TAAACTTTGATCTTTGTAAGGTTTGAGTAATAAAAACTAATTAGATCTGATGAGTCCTTT 
TATTTTGTTAACTATAGGAAGCTGCAAATCTCGTACTCAAGAAAGGATACTTGAAGCTTA 
GAGAAAGAGAGTTACGGATTTCTCGAGTCAAACCTGATACGCCATCAAAGAGAAAGAGCA 
ATCCGTCTGAAGCTTACTCGCCGGCCCAGAAAAGACTGCAGAAGGACAAAGTGGTCACAC 
CAACTCCAACAGGGAAGGCTAATCTTTCATATCAAGGTGTACGAGCTTCAAAATCTGGTG 
ATGATAAGAAAACACCTTATCAGAAAAGCTCCGCGCAGACAAAGATGAGACCTAGAGGTA 
GCAGCAGCAATGACAACAAAAAATCTGGGAATAATAGTGCTTCAAAGGAAAGAAGTCAGA 
AGCGACCAGCTGTTGCAGCAAGAAAGGCGAAAGCAAACGCAAAAGGTTCAAAAGAGAGCG 
GTGGTAAGCGGTTTGCAGGGACAAAGCGTAAACAAGAAAACCGGACGCCTGAAAGCTTCT 
CTAAGAAGAAAAAAACAAAACGGTTTTAGACGGTTTCTTTCAACCATAATGGTGAACCTC 
TTTCTTCTTCCTTAGTTTTGATACTAGTAGTCGTTTTGTATTGTTCTCTTATATCAATCA 
ATGATGATATACTGTAATGTTGCAACAATTATGTTTTCGTGCAAGTTTAAAAGGAAAGCT 
ATTTTGATGA
>AT5G46840.2 |  RNA recognition motif (RRM)-containing protein 
AATCTCTCTCTCCCTCTTTCTTCCTCTTCTCTCATTGAAATCGAACGAGGATGGGGAAGA 
AGAAATCGAAGGTAACGGAGCCGGAATCTCAAAACGATGAATCTCAGACAATCTTCTCCA 
CTCTCTTCTCCGGCGAGGTTGAAAGCTCTGGCTTTGCGAGTCTCTTCTCCGCTGATAACC 
CTTTCCGGCGAAAACAACCTCAAGAAATCAAAGAGTCGTCAATTCCTGATGAGAAGAAAG 
GGGATAAACGAAATGCAGAGAACGAAGAAGAAGAAGAAGAAACAGATTTGCCTGTGAAGA 
CGAAGAAATCTAAAAAGGAAAAAAAGCTTACAGATTCCGGCGACGAGAAAGAGACGATTT 
CGGAGGCTGTAGAAGAAAGTGGGTTGGTTTCAAAGAGGAAGAAGAGGAAGAGAGATGAGA 
TTGAGAACGAATACGAGACGAAGAAGTATGGAAGCGTTGAGATGAAAGAGAAGAAGGTTG 
GTGAGAAGAGGAAGAAAGCTGATGAAGTAGCTGATACAATGGTTTCAAAGGAAGGTTTTG 
ATGATGAGAGTAAGCTTCTTAGAACTGTTTTCGTTGGGAATTTGCCTTTGAAGGTTAAGA 
AAAAAGTCATCTTGAAGGAGTTTAGTAAATTTGGTGAGGTTGAATCTGTGAGGATACGCT 
CTGTGCCTATTGTTGATGTGAGTTTCTTATAGCTAAAGCCTAAAGATGAATTTAGGTTGA 
GTTTTTGTGTTCATTGGTTTCTGATTTCGTTTGATTTTTATTGATTGATTTAGTCGAAGA 
GGACAAGGAAAGGAGCTATAATGCTGAAACAAATCAATGAGAAAGCTTCAAGGTTTGTGC 
TTGAAACTCTATATAGTAATCATTTGATTTTGAAGTTTCAGTGATGAAAAAGTCTAATGT 
CAATGTTTGTGGAATTGCAGTGTTCATGCTTATGTTGTGTTTGAAACAGAGCAATCTGCT 
GCAGCTTCTCTGGCACATAACATGTCTCTGGTAATGTAACTTTTGCGCCTTTTGTTCTAT 
CTGGTTGATTTTTAAGGAGTTATGTGTAGATTGGCTAATAGTTTTATGTTATAATCAGAT 
TGATGGGAATCATGTCCGCGTTGATAGAGCATGTCCGCCTCGTAAGAAACAGAAAGGGCA 
TGATGATACTCATTTGTATGATCCTAAGAGGACAGTCTTTATGGGTAATCTCCCTTTCGA 
TGTGAAGGTTAGTAGTACTAGTCTTAAGGCTCTTCTTCTGTTTAATTTGCGATGATCGAA 
CTTTATCTTAGATTCTCAGTTTTGTTTGTTTCTAATGCAGGACGAGGAAGTGTATCAACT 
GTTTACGGGTAAGAGTAATCTGGAGAACAGTATAGAAGCTGTTCGTGTCATTAGAGATCC 
TCACTTGAACATTGGGAAAGGAATAGCTTACGTCTTGTTTAAAACACGGGTATGTTGAAG 
TAAACTTTGATCTTTGTAAGGTTTGAGTAATAAAAACTAATTAGATCTGATGAGTCCTTT 
TATTTTGTTAACTATAGGAAGCTGCAAATCTCGTACTCAAGAAAGGATACTTGAAGCTTA 
GAGAAAGAGAGTTACGGATTTCTCGAGTCAAACCTGATACGCCATCAAAGAGAAAGAGCA 
ATCCGTCTGAAGCTTACTCGCCGGCCCAGAAAAGACTGCAGAAGGACAAAGTGGTCACAC 
CAACTCCAACAGGGAAGGCTAATCTTTCATATCAAGGTGTACGAGCTTCAAAATCTGGTG 
ATGATAAGAAAACACCTTATCAGAAAAGCTCCGCGCAGACAAAGATGAGACCTAGAGGTA 
GCAGCAGCAATGACAACAAAAAATCTGGGAATAATAGTGCTTCAAAGGAAAGAAGTCAGA 
AGCGACCAGCTGTTGCAGCAAGAAAGGCGAAAGCAAACGCAAAAGGTTCAAAAGAGAGCG 
GTGGTAAGCGGTTTGCAGGGACAAAGCGTAAACAAGAAAACCGGACGCCTGAAAGCTTCT 
CTAAGAAGAAAAAAACAAAACGGTTTTAGACGGTTTCTTTCAACCATAATGGTGAACCTC 
TTTCTTCTTCCTTAGTTTTGATACTAGTAGTCGTTTTGTATTGTTCTCTTATATCAATCA 
ATGATGATATACTGTAATGTTGCAACAATTATGTTTTCGTGCAAGTTTAAAAGGAAAGCT 
ATTTTGA
>AT5G46840.2 |  RNA recognition motif (RRM)-containing protein 
AATCTCTCTCTCCCTCTTTCTTCCTCTTCTCTCATTGAAATCGAACGAGGATGGGGAAGA 
AGAAATCGAAGGTAACGGAGCCGGAATCTCAAAACGATGAATCTCAGACAATCTTCTCCA 
CTCTCTTCTCCGGCGAGGTTGAAAGCTCTGGCTTTGCGAGTCTCTTCTCCGCTGATAACC 
CTTTCCGGCGAAAACAACCTCAAGAAATCAAAGAGTCGTCAATTCCTGATGAGAAGAAAG 
GGGATAAACGAAATGCAGAGAACGAAGAAGAAGAAGAAGAAACAGATTTGCCTGTGAAGA 
CGAAGAAATCTAAAAAGGAAAAAAAGCTTACAGATTCCGGCGACGAGAAAGAGACGATTT 
CGGAGGCTGTAGAAGAAAGTGGGTTGGTTTCAAAGAGGAAGAAGAGGAAGAGAGATGAGA 
TTGAGAACGAATACGAGACGAAGAAGTATGGAAGCGTTGAGATGAAAGAGAAGAAGGTTG 
GTGAGAAGAGGAAGAAAGCTGATGAAGTAGCTGATACAATGGTTTCAAAGGAAGGTTTTG 
ATGATGAGAGTAAGCTTCTTAGAACTGTTTTCGTTGGGAATTTGCCTTTGAAGGTTAAGA 
AAAAAGTCATCTTGAAGGAGTTTAGTAAATTTGGTGAGGTTGAATCTGTGAGGATACGCT 
CTGTGCCTATTGTTGATGTGAGTTTCTTATAGCTAAAGCCTAAAGATGAATTTAGGTTGA 
GTTTTTGTGTTCATTGGTTTCTGATTTCGTTTGATTTTTATTGATTGATTTAGTCGAAGA 
GGACAAGGAAAGGAGCTATAATGCTGAAACAAATCAATGAGAAAGCTTCAAGGTTTGTGC 
TTGAAACTCTATATAGTAATCATTTGATTTTGAAGTTTCAGTGATGAAAAAGTCTAATGT 
CAATGTTTGTGGAATTGCAGTGTTCATGCTTATGTTGTGTTTGAAACAGAGCAATCTGCT 
GCAGCTTCTCTGGCACATAACATGTCTCTGGTAATGTAACTTTTGCGCCTTTTGTTCTAT 
CTGGTTGATTTTTAAGGAGTTATGTGTAGATTGGCTAATAGTTTTATGTTATAATCAGAT 
TGATGGGAATCATGTCCGCGTTGATAGAGCATGTCCGCCTCGTAAGAAACAGAAAGGGCA 
TGATGATACTCATTTGTATGATCCTAAGAGGACAGTCTTTATGGGTAATCTCCCTTTCGA 
TGTGAAGGTTAGTAGTACTAGTCTTAAGGCTCTTCTTCTGTTTAATTTGCGATGATCGAA 
CTTTATCTTAGATTCTCAGTTTTGTTTGTTTCTAATGCAGGACGAGGAAGTGTATCAACT 
GTTTACGGGTAAGAGTAATCTGGAGAACAGTATAGAAGCTGTTCGTGTCATTAGAGATCC 
TCACTTGAACATTGGGAAAGGAATAGCTTACGTCTTGTTTAAAACACGGGTATGTTGAAG 
TAAACTTTGATCTTTGTAAGGTTTGAGTAATAAAAACTAATTAGATCTGATGAGTCCTTT 
TATTTTGTTAACTATAGGAAGCTGCAAATCTCGTACTCAAGAAAGGATACTTGAAGCTTA 
GAGAAAGAGAGTTACGGATTTCTCGAGTCAAACCTGATACGCCATCAAAGAGAAAGAGCA 
ATCCGTCTGAAGCTTACTCGCCGGCCCAGAAAAGACTGCAGAAGGACAAAGTGGTCACAC 
CAACTCCAACAGGGAAGGCTAATCTTTCATATCAAGGTGTACGAGCTTCAAAATCTGGTG 
ATGATAAGAAAACACCTTATCAGAAAAGCTCCGCGCAGACAAAGATGAGACCTAGAGGTA 
GCAGCAGCAATGACAACAAAAAATCTGGGAATAATAGTGCTTCAAAGGAAAGAAGTCAGA 
AGCGACCAGCTGTTGCAGCAAGAAAGGCGAAAGCAAACGCAAAAGGTTCAAAAGAGAGCG 
GTGGTAAGCGGTTTGCAGGGACAAAGCGTAAACAAGAAAACCGGACGCCTGAAAGCTTCT 
CTAAGAAGAAAAAAACAAAACGGTTTTAGACGGTTTCTTTCAACCATAATGGTGAACCTC 
TTTCTTCTTCCTTAGTTTTGATACTAGTAGTCGTTTTGTATTGTTCTCTTATATCAATCA 
ATGATGATATACTGTAATGTTGCAACAATTATGTTTTCGTGCAAGTTTAAAAGGAAAGCT 
ATTTTGA
>AT1G15440.1 |  transducin family protein / WD-40 repeat family protein 
AATTATCGCCTCCGGCATATCAATCCTCCGCCTTCTCATTCTTCTCCAGACGCCATGGAG 
TTCCGTTTCGAGAATCTTCTTGGCGCTCCTTACAGAGGCGGGAACGCAGTCATCACTAAG 
AATACTCAGCTAATTTCACCGGTTGGTAATCGTGTCTCCGTCACCGACCTAAGTAAGAAC 
CATTCGGTCACTCTTCCGCTCGAAACCTCTACCAACATATGTCGCCTCGCTTCCTCACCC 
GACGGTACTTTCCTACTCGCCGTCGATGAACAAAACCGATGCCTTTTCATCAACTTGCCT 
CGGCGGGTAGTTCTTCACAGAATTACCTTCAAGGATAAAGTCGGTGCCTTGAAGTTCAGC 
CCTAATGGTAAGTTTATCGCTGTTGGAATTGGTAAGTTGGTGGAAATATGGCGATCACCT 
GGTTTCAGGCGAGCTGTTTTGCCCTTTGAGCGGGTTAGGACTTTTGCTAATTCTGATGAT 
AAAGTTGTCTCCTTGGAGTGGAGCTTGGACTCTGATTATTTGCTTGTTGGCTCAAGGGAT 
TTAGCTGCTAGGTTGTTTTGTGTTAGAAAGTTGAAGGGTGTTTTAAATAAGCCATTTTTG 
TTTCTGGGTCATAGAGATTCTGTTGTGGGTTGCTTCTTTGGTGTTGATAAAATGACTAAC 
AAGGTCAACAGGGCTTTCACGATTGCAAGGGATGGTTACATTTTTAGTTGGGGCTATACT 
GAAAAGGATGTCAAAATGGATGAATCAGAAGATGGCCACTCTGAGCCACCGTCACCTGTT 
ACTCCAGATAGGGCTGATGAGGTGATGGTGGAAAATGGTGGTGGTGTTGGTACTGAGCTT 
AAGAAACGAAAAGAGTATGACGGTAAAGGTCTTGAATCAGATGAAGAAGGAGATGATGAT 
GATGAAGAGTATATGCACAGAGGAAAATGGGTTTTGTTGAGGAAGGATGGGTGTAATCAG 
GCATCAGCAAAGGTGACCGCTTGCGACTATCATCAGGGACTTGACATGGTTGTGGTGGGG 
TTCTCAAATGGTGTTTTTGGGCTTTATCAGATGCCAGATTTCATCTGTATCCATCTGCTC 
TCTATTTCTAGGCAGAAGCTAACAACAGCTGTCTTCAATGAGCGTGGTAATTGGCTGACC 
TTTGGTTGCGCGAAACTTGGGCAACTGTTAGTCTGGGATTGGCGAACCGAAACCTATATA 
CTGAAGCAACAAGGACACTATTTTGACGTCAACTGTGTCACTTACTCACCGGATTCGCAG 
CTCTTGGCAACTGGTGCTGATGATAACAAAGTCAAGGTAATGAAATTTCATAGACTTAAC 
TGTTATGTTCTATACCATGCTTCTCATCTATTTCTGAATTTAACCAGCCCGTTTTTTATT 
ATGTTACATTTTTAAGGTGTGGAACGTTATGTCAGGAACATGTTTCATTACATTCACCGA 
GCATACCAATGCCGTGACTGCTCTTCATTTTATGGCTGACAACCACTCCCTCTTAAGTGC 
ATCTCTGGACGGCACTGTTCGTGCTTGGGATTTTAAAAGATACAAGAACTATAAGACATA 
CACAACCCCTACACCCCGACAATTTGTTTCCTTAACAGCAGACCCGAGTGGTGACGTCGT 
CTGTGCTGGGACCCTAGATTCATTCGAGGTAATTCAACTTAGGCCCTGAAGGATTTCAGT 
CACCTACTCACAAATACTTTGGTGAGGTGAATCACTTTATGCTTGCCTATGTGCAGATTT 
TTGTATGGTCCAAGAAGACTGGGCAAATAAAGGATATTCTGAGTGGGCATGAGGCTCCTG 
TTCATGGGTTGATGTTTTCTCCCTTAACGGTAAAGAAACTGTCATAGTCTCATACTTCTT 
TTAGTCAAAATACAATTTGCTTCGTGCCTCTGAACAATTATGTGAACTTCTGCCTTATGG 
TGTTATAACTTCCATGCCTTATCTAGTTCATATATTTCTTTCTCTGCAGCAACTTTTAGC 
TTCATCCTCATGGGACTATACAGTTCGGTTGTGGGATGTGTTTGCTAGCAAAGGCACCGT 
GGAAACGTTTCGACACAACCACGATGTTCTAACAGTTGCTTTCCGTCCTGATGGGAAGCA 
ATTAGCCTCGAGTACGCTAGATGGGCAGATCAATTTCTGGGACACCATTGAAGGTGTGTT 
AATGTACACCATAGAGGGGCGGAGAGATATCGCTGGAGGTCGGGTCATGACTGACCGTCG 
GTCTGCAGCTAATTCAAGTTCTGGAAAGTGTTTTACAACATTGTGCTATTCCGCTGATGG 
AGGGTATATTCTAGCCGCAGGAACTAGCAGATATATTTGCATGTATGATATCGCAGATCA 
GGTTAGCTAACTAGCTCCTCTTGGAGTTCAGGTTTTCTTAAAGCTTGTGTTCTTCTGATA 
AAGAAACTTAGTCAAAGTGTCTGGAATATCACCTTTTCAGGTTCTTCTGCGCCGGTTTCA 
GATATCCCATAATCTTTCGTTAGATGGGGTTCTGGACTTCTTGCACTCTAAGAAGATGAC 
AGAAGCAGGACCAATTGATCTGATCGATGATGACAACAGCGATGAAGAAGGTGGCATTGA 
TAAACAGTCGAGAGGGAATCTGGGTTACGATCTGCCTGGATCCAGGCCTAACCGTGGCAG 
GCCCATTATCCGGACAAAAAGCCTCAGCATTGCCCCAACTGGAAGGAGCTTTGCTGCTGC 
AACAACAGAAGGAGTCCTCATCTTTTCAATTGACGATACCTTCATCTTTGATCCGACCGA 
TCTAGATATAGATGTTACTCCAGAGGTGAGCCTTTTGTAAATCGCTGATGGTGGTTATAG 
TTCTGATTATTGGTTTTGAAATGTAAAGCTAAGGTGTTGTTTGTGTAGGCTGTTGAGGCT 
GCCATAGAAGAGGATGAAGTTAGCAGAGCACTTGCTCTAAGTATGCGTTTGAACGAAGAT 
AGCCTTATCAAAAAATGCATCTTCGCTGTAGCCCCTGCAGACATAAAAGCTGTTGCCATC 
TCTGTCCGCCAGAAATACTTAGAAAGGCTTATGGAAGCTTTGGTGGATCTGCTTGAGAAC 
TGTCCTCATCTGGAGTTCATACTTCACTGGTGTCAGGTAATGTCTCGTTTTCTTCTCTTT 
TTTGATAAATCTCTGCTCAAATGCTCTCAACTTAATCAAACTTTGTGTTGTCTTTTTATG 
TGCAGGAAATCTGCAAGGCTCACGGAAGCTCCATTCAGCGGAACTACAGAACTCTATTGC 
CTGCACTGAGATCGTTGCAGAAGGCGATCACCAGAGCCCATCAGGATCTGGCAGATATGT 
GTTCTTCCAATGAGTACACGCTTCGCTACTTGTGTTCTGTTCCAAACAATCATTGATTAT 
GTTTTCTGCATTATGTATCACCGGAAATTTTCATCTTCCTTTTTCGGTTAAACAAATTTT 
GAGATTTTGATATATGAGTTTCTAACATCTGAAT
>AT1G15440.1 |  transducin family protein / WD-40 repeat family protein 
AATTATCGCCTCCGGCATATCAATCCTCCGCCTTCTCATTCTTCTCCAGACGCCATGGAG 
TTCCGTTTCGAGAATCTTCTTGGCGCTCCTTACAGAGGCGGGAACGCAGTCATCACTAAG 
AATACTCAGCTAATTTCACCGGTTGGTAATCGTGTCTCCGTCACCGACCTAAGTAAGAAC 
CATTCGGTCACTCTTCCGCTCGAAACCTCTACCAACATATGTCGCCTCGCTTCCTCACCC 
GACGGTACTTTCCTACTCGCCGTCGATGAACAAAACCGATGCCTTTTCATCAACTTGCCT 
CGGCGGGTAGTTCTTCACAGAATTACCTTCAAGGATAAAGTCGGTGCCTTGAAGTTCAGC 
CCTAATGGTAAGTTTATCGCTGTTGGAATTGGTAAGTTGGTGGAAATATGGCGATCACCT 
GGTTTCAGGCGAGCTGTTTTGCCCTTTGAGCGGGTTAGGACTTTTGCTAATTCTGATGAT 
AAAGTTGTCTCCTTGGAGTGGAGCTTGGACTCTGATTATTTGCTTGTTGGCTCAAGGGAT 
TTAGCTGCTAGGTTGTTTTGTGTTAGAAAGTTGAAGGGTGTTTTAAATAAGCCATTTTTG 
TTTCTGGGTCATAGAGATTCTGTTGTGGGTTGCTTCTTTGGTGTTGATAAAATGACTAAC 
AAGGTCAACAGGGCTTTCACGATTGCAAGGGATGGTTACATTTTTAGTTGGGGCTATACT 
GAAAAGGATGTCAAAATGGATGAATCAGAAGATGGCCACTCTGAGCCACCGTCACCTGTT 
ACTCCAGATAGGGCTGATGAGGTGATGGTGGAAAATGGTGGTGGTGTTGGTACTGAGCTT 
AAGAAACGAAAAGAGTATGACGGTAAAGGTCTTGAATCAGATGAAGAAGGAGATGATGAT 
GATGAAGAGTATATGCACAGAGGAAAATGGGTTTTGTTGAGGAAGGATGGGTGTAATCAG 
GCATCAGCAAAGGTGACCGCTTGCGACTATCATCAGGGACTTGACATGGTTGTGGTGGGG 
TTCTCAAATGGTGTTTTTGGGCTTTATCAGATGCCAGATTTCATCTGTATCCATCTGCTC 
TCTATTTCTAGGCAGAAGCTAACAACAGCTGTCTTCAATGAGCGTGGTAATTGGCTGACC 
TTTGGTTGCGCGAAACTTGGGCAACTGTTAGTCTGGGATTGGCGAACCGAAACCTATATA 
CTGAAGCAACAAGGACACTATTTTGACGTCAACTGTGTCACTTACTCACCGGATTCGCAG 
CTCTTGGCAACTGGTGCTGATGATAACAAAGTCAAGGTAATGAAATTTCATAGACTTAAC 
TGTTATGTTCTATACCATGCTTCTCATCTATTTCTGAATTTAACCAGCCCGTTTTTTATT 
ATGTTACATTTTTAAGGTGTGGAACGTTATGTCAGGAACATGTTTCATTACATTCACCGA 
GCATACCAATGCCGTGACTGCTCTTCATTTTATGGCTGACAACCACTCCCTCTTAAGTGC 
ATCTCTGGACGGCACTGTTCGTGCTTGGGATTTTAAAAGATACAAGAACTATAAGACATA 
CACAACCCCTACACCCCGACAATTTGTTTCCTTAACAGCAGACCCGAGTGGTGACGTCGT 
CTGTGCTGGGACCCTAGATTCATTCGAGGTAATTCAACTTAGGCCCTGAAGGATTTCAGT 
CACCTACTCACAAATACTTTGGTGAGGTGAATCACTTTATGCTTGCCTATGTGCAGATTT 
TTGTATGGTCCAAGAAGACTGGGCAAATAAAGGATATTCTGAGTGGGCATGAGGCTCCTG 
TTCATGGGTTGATGTTTTCTCCCTTAACGGTAAAGAAACTGTCATAGTCTCATACTTCTT 
TTAGTCAAAATACAATTTGCTTCGTGCCTCTGAACAATTATGTGAACTTCTGCCTTATGG 
TGTTATAACTTCCATGCCTTATCTAGTTCATATATTTCTTTCTCTGCAGCAACTTTTAGC 
TTCATCCTCATGGGACTATACAGTTCGGTTGTGGGATGTGTTTGCTAGCAAAGGCACCGT 
GGAAACGTTTCGACACAACCACGATGTTCTAACAGTTGCTTTCCGTCCTGATGGGAAGCA 
ATTAGCCTCGAGTACGCTAGATGGGCAGATCAATTTCTGGGACACCATTGAAGGTGTGTT 
AATGTACACCATAGAGGGGCGGAGAGATATCGCTGGAGGTCGGGTCATGACTGACCGTCG 
GTCTGCAGCTAATTCAAGTTCTGGAAAGTGTTTTACAACATTGTGCTATTCCGCTGATGG 
AGGGTATATTCTAGCCGCAGGAACTAGCAGATATATTTGCATGTATGATATCGCAGATCA 
GGTTAGCTAACTAGCTCCTCTTGGAGTTCAGGTTTTCTTAAAGCTTGTGTTCTTCTGATA 
AAGAAACTTAGTCAAAGTGTCTGGAATATCACCTTTTCAGGTTCTTCTGCGCCGGTTTCA 
GATATCCCATAATCTTTCGTTAGATGGGGTTCTGGACTTCTTGCACTCTAAGAAGATGAC 
AGAAGCAGGACCAATTGATCTGATCGATGATGACAACAGCGATGAAGAAGGTGGCATTGA 
TAAACAGTCGAGAGGGAATCTGGGTTACGATCTGCCTGGATCCAGGCCTAACCGTGGCAG 
GCCCATTATCCGGACAAAAAGCCTCAGCATTGCCCCAACTGGAAGGAGCTTTGCTGCTGC 
AACAACAGAAGGAGTCCTCATCTTTTCAATTGACGATACCTTCATCTTTGATCCGACCGA 
TCTAGATATAGATGTTACTCCAGAGGTGAGCCTTTTGTAAATCGCTGATGGTGGTTATAG 
TTCTGATTATTGGTTTTGAAATGTAAAGCTAAGGTGTTGTTTGTGTAGGCTGTTGAGGCT 
GCCATAGAAGAGGATGAAGTTAGCAGAGCACTTGCTCTAAGTATGCGTTTGAACGAAGAT 
AGCCTTATCAAAAAATGCATCTTCGCTGTAGCCCCTGCAGACATAAAAGCTGTTGCCATC 
TCTGTCCGCCAGAAATACTTAGAAAGGCTTATGGAAGCTTTGGTGGATCTGCTTGAGAAC 
TGTCCTCATCTGGAGTTCATACTTCACTGGTGTCAGGTAATGTCTCGTTTTCTTCTCTTT 
TTTGATAAATCTCTGCTCAAATGCTCTCAACTTAATCAAACTTTGTGTTGTCTTTTTATG 
TGCAGGAAATCTGCAAGGCTCACGGAAGCTCCATTCAGCGGAACTACAGAACTCTATTGC 
CTGCACTGAGATCGTTGCAGAAGGCGATCACCAGAGCCCATCAGGATCTGGCAGATATGT 
GTTCTTCCAATGAGTACACGCTTCGCTACTTGTGTTCTGTTCCAAACAATCATTGATTAT 
GTTTTCTGCATTATGTATCACCGGAAATTTTCATCTTCCTTTTTCGGTTAAACAAATTTT 
GAGATTTTGATATATGAGTTTCTAACATCTGAAT
>AT1G15440.2 |  transducin family protein / WD-40 repeat family protein 
AATTATCGCCTCCGGCATATCAATCCTCCGCCTTCTCATTCTTCTCCAGACGCCATGGAG 
TTCCGTTTCGAGAATCTTCTTGGCGCTCCTTACAGAGGCGGGAACGCAGTCATCACTAAG 
AATACTCAGCTAATTTCACCGGTTGGTAATCGTGTCTCCGTCACCGACCTAAGTAAGAAC 
CATTCGGTCACTCTTCCGCTCGAAACCTCTACCAACATATGTCGCCTCGCTTCCTCACCC 
GACGGTACTTTCCTACTCGCCGTCGATGAACAAAACCGATGCCTTTTCATCAACTTGCCT 
CGGCGGGTAGTTCTTCACAGAATTACCTTCAAGGATAAAGTCGGTGCCTTGAAGTTCAGC 
CCTAATGGTAAGTTTATCGCTGTTGGAATTGGTAAGTTGGTGGAAATATGGCGATCACCT 
GGTTTCAGGCGAGCTGTTTTGCCCTTTGAGCGGGTTAGGACTTTTGCTAATTCTGATGAT 
AAAGTTGTCTCCTTGGAGTGGAGCTTGGACTCTGATTATTTGCTTGTTGGCTCAAGGGAT 
TTAGCTGCTAGGTTGTTTTGTGTTAGAAAGTTGAAGGGTGTTTTAAATAAGCCATTTTTG 
TTTCTGGGTCATAGAGATTCTGTTGTGGGTTGCTTCTTTGGTGTTGATAAAATGACTAAC 
AAGGTCAACAGGGCTTTCACGATTGCAAGGGATGGTTACATTTTTAGTTGGGGCTATACT 
GAAAAGGATGTCAAAATGGATGAATCAGAAGATGGCCACTCTGAGCCACCGTCACCTGTT 
ACTCCAGATAGGGCTGATGAGGTGATGGTGGAAAATGGTGGTGGTGTTGGTACTGAGCTT 
AAGAAACGAAAAGAGTATGACGGTAAAGGTCTTGAATCAGATGAAGAAGGAGATGATGAT 
GATGAAGAGTATATGCACAGAGGAAAATGGGTTTTGTTGAGGAAGGATGGGTGTAATCAG 
GCATCAGCAAAGGTGACCGCTTGCGACTATCATCAGGGACTTGACATGGTTGTGGTGGGG 
TTCTCAAATGGTGTTTTTGGGCTTTATCAGATGCCAGATTTCATCTGTATCCATCTGCTC 
TCTATTTCTAGGCAGAAGCTAACAACAGCTGTCTTCAATGAGCGTGGTAATTGGCTGACC 
TTTGGTTGCGCGAAACTTGGGCAACTGTTAGTCTGGGATTGGCGAACCGAAACCTATATA 
CTGAAGCAACAAGGACACTATTTTGACGTCAACTGTGTCACTTACTCACCGGATTCGCAG 
CTCTTGGCAACTGGTGCTGATGATAACAAAGTCAAGGTAATGAAATTTCATAGACTTAAC 
TGTTATGTTCTATACCATGCTTCTCATCTATTTCTGAATTTAACCAGCCCGTTTTTTATT 
ATGTTACATTTTTAAGGTGTGGAACGTTATGTCAGGAACATGTTTCATTACATTCACCGA 
GCATACCAATGCCGTGACTGCTCTTCATTTTATGGCTGACAACCACTCCCTCTTAAGTGC 
ATCTCTGGACGGCACTGTTCGTGCTTGGGATTTTAAAAGATACAAGAACTATAAGACATA 
CACAACCCCTACACCCCGACAATTTGTTTCCTTAACAGCAGACCCGAGTGGTGACGTCGT 
CTGTGCTGGGACCCTAGATTCATTCGAGGTAATTCAACTTAGGCCCTGAAGGATTTCAGT 
CACCTACTCACAAATACTTTGGTGAGGTGAATCACTTTATGCTTGCCTATGTGCAGATTT 
TTGTATGGTCCAAGAAGACTGGGCAAATAAAGGATATTCTGAGTGGGCATGAGGCTCCTG 
TTCATGGGTTGATGTTTTCTCCCTTAACGGTAAAGAAACTGTCATAGTCTCATACTTCTT 
TTAGTCAAAATACAATTTGCTTCGTGCCTCTGAACAATTATGTGAACTTCTGCCTTATGG 
TGTTATAACTTCCATGCCTTATCTAGTTCATATATTTCTTTCTCTGCAGCAACTTTTAGC 
TTCATCCTCATGGGACTATACAGTTCGGTTGTGGGATGTGTTTGCTAGCAAAGGCACCGT 
GGAAACGTTTCGACACAACCACGATGTTCTAACAGTTGCTTTCCGTCCTGATGGGAAGCA 
ATTAGCCTCGAGTACGCTAGATGGGCAGATCAATTTCTGGGACACCATTGAAGGTGTGTT 
AATGTACACCATAGAGGGGCGGAGAGATATCGCTGGAGGTCGGGTCATGACTGACCGTCG 
GTCTGCAGCTAATTCAAGTTCTGGAAAGTGTTTTACAACATTGTGCTATTCCGCTGATGG 
AGGGTATATTCTAGCCGCAGGAACTAGCAGATATATTTGCATGTATGATATCGCAGATCA 
GGTTAGCTAACTAGCTCCTCTTGGAGTTCAGGTTTTCTTAAAGCTTGTGTTCTTCTGATA 
AAGAAACTTAGTCAAAGTGTCTGGAATATCACCTTTTCAGGTTCTTCTGCGCCGGTTTCA 
GATATCCCATAATCTTTCGTTAGATGGGGTTCTGGACTTCTTGCACTCTAAGAAGATGAC 
AGAAGCAGGACCAATTGATCTGATCGATGATGACAACAGCGATGAAGAAGGTGGCATTGA 
TAAACAGTCGAGAGGGAATCTGGGTTACGATCTGCCTGGATCCAGGCCTAACCGTGGCAG 
GCCCATTATCCGGACAAAAAGCCTCAGCATTGCCCCAACTGGAAGGAGCTTTGCTGCTGC 
AACAACAGAAGGAGTCCTCATCTTTTCAATTGACGATACCTTCATCTTTGATCCGACCGA 
TCTAGATATAGATGTTACTCCAGAGGTGAGCCTTTTGTAAATCGCTGATGGTGGTTATAG 
TTCTGATTATTGGTTTTGAAATGTAAAGCTAAGGTGTTGTTTGTGTAGGCTGTTGAGGCT 
GCCATAGAAGAGGATGAAGTTAGCAGAGCACTTGCTCTAAGTATGCGTTTGAACGAAGAT 
AGCCTTATCAAAAAATGCATCTTCGCTGTAGCCCCTGCAGACATAAAAGCTGTTGCCATC 
TCTGTCCGCCAGAAATACTTAGAAAGGCTTATGGAAGCTTTGGTGGATCTGCTTGAGAAC 
TGTCCTCATCTGGAGTTCATACTTCACTGGTGTCAGGTAATGTCTCGTTTTCTTCTCTTT 
TTTGATAAATCTCTGCTCAAATGCTCTCAACTTAATCAAACTTTGTGTTGTCTTTTTATG 
TGCAGGAAATCTGCAAGGCTCACGGAAGCTCCATTCAGCGGAACTACAGAACTCTATTGC 
CTGCACTGAGATCGTTGCAGAAGGCGATCACCAGAGCCCATCAGGATCTGGCAGATATGT 
GTTCTTCCAATGAGTACACGCTTCGCTACTTGTGTTCTGTTCCAAACAATCATTGATTAT 
GTTTTCTGCATTATGTATCACCGGAAATTTTCATCTTCCTTTTTCGGTTAAACAAATTTT 
GAGATTTTGATATATGAGTTTCTAACATCTGAAT
>AT1G15440.2 |  transducin family protein / WD-40 repeat family protein 
AATTATCGCCTCCGGCATATCAATCCTCCGCCTTCTCATTCTTCTCCAGACGCCATGGAG 
TTCCGTTTCGAGAATCTTCTTGGCGCTCCTTACAGAGGCGGGAACGCAGTCATCACTAAG 
AATACTCAGCTAATTTCACCGGTTGGTAATCGTGTCTCCGTCACCGACCTAAGTAAGAAC 
CATTCGGTCACTCTTCCGCTCGAAACCTCTACCAACATATGTCGCCTCGCTTCCTCACCC 
GACGGTACTTTCCTACTCGCCGTCGATGAACAAAACCGATGCCTTTTCATCAACTTGCCT 
CGGCGGGTAGTTCTTCACAGAATTACCTTCAAGGATAAAGTCGGTGCCTTGAAGTTCAGC 
CCTAATGGTAAGTTTATCGCTGTTGGAATTGGTAAGTTGGTGGAAATATGGCGATCACCT 
GGTTTCAGGCGAGCTGTTTTGCCCTTTGAGCGGGTTAGGACTTTTGCTAATTCTGATGAT 
AAAGTTGTCTCCTTGGAGTGGAGCTTGGACTCTGATTATTTGCTTGTTGGCTCAAGGGAT 
TTAGCTGCTAGGTTGTTTTGTGTTAGAAAGTTGAAGGGTGTTTTAAATAAGCCATTTTTG 
TTTCTGGGTCATAGAGATTCTGTTGTGGGTTGCTTCTTTGGTGTTGATAAAATGACTAAC 
AAGGTCAACAGGGCTTTCACGATTGCAAGGGATGGTTACATTTTTAGTTGGGGCTATACT 
GAAAAGGATGTCAAAATGGATGAATCAGAAGATGGCCACTCTGAGCCACCGTCACCTGTT 
ACTCCAGATAGGGCTGATGAGGTGATGGTGGAAAATGGTGGTGGTGTTGGTACTGAGCTT 
AAGAAACGAAAAGAGTATGACGGTAAAGGTCTTGAATCAGATGAAGAAGGAGATGATGAT 
GATGAAGAGTATATGCACAGAGGAAAATGGGTTTTGTTGAGGAAGGATGGGTGTAATCAG 
GCATCAGCAAAGGTGACCGCTTGCGACTATCATCAGGGACTTGACATGGTTGTGGTGGGG 
TTCTCAAATGGTGTTTTTGGGCTTTATCAGATGCCAGATTTCATCTGTATCCATCTGCTC 
TCTATTTCTAGGCAGAAGCTAACAACAGCTGTCTTCAATGAGCGTGGTAATTGGCTGACC 
TTTGGTTGCGCGAAACTTGGGCAACTGTTAGTCTGGGATTGGCGAACCGAAACCTATATA 
CTGAAGCAACAAGGACACTATTTTGACGTCAACTGTGTCACTTACTCACCGGATTCGCAG 
CTCTTGGCAACTGGTGCTGATGATAACAAAGTCAAGGTAATGAAATTTCATAGACTTAAC 
TGTTATGTTCTATACCATGCTTCTCATCTATTTCTGAATTTAACCAGCCCGTTTTTTATT 
ATGTTACATTTTTAAGGTGTGGAACGTTATGTCAGGAACATGTTTCATTACATTCACCGA 
GCATACCAATGCCGTGACTGCTCTTCATTTTATGGCTGACAACCACTCCCTCTTAAGTGC 
ATCTCTGGACGGCACTGTTCGTGCTTGGGATTTTAAAAGATACAAGAACTATAAGACATA 
CACAACCCCTACACCCCGACAATTTGTTTCCTTAACAGCAGACCCGAGTGGTGACGTCGT 
CTGTGCTGGGACCCTAGATTCATTCGAGGTAATTCAACTTAGGCCCTGAAGGATTTCAGT 
CACCTACTCACAAATACTTTGGTGAGGTGAATCACTTTATGCTTGCCTATGTGCAGATTT 
TTGTATGGTCCAAGAAGACTGGGCAAATAAAGGATATTCTGAGTGGGCATGAGGCTCCTG 
TTCATGGGTTGATGTTTTCTCCCTTAACGGTAAAGAAACTGTCATAGTCTCATACTTCTT 
TTAGTCAAAATACAATTTGCTTCGTGCCTCTGAACAATTATGTGAACTTCTGCCTTATGG 
TGTTATAACTTCCATGCCTTATCTAGTTCATATATTTCTTTCTCTGCAGCAACTTTTAGC 
TTCATCCTCATGGGACTATACAGTTCGGTTGTGGGATGTGTTTGCTAGCAAAGGCACCGT 
GGAAACGTTTCGACACAACCACGATGTTCTAACAGTTGCTTTCCGTCCTGATGGGAAGCA 
ATTAGCCTCGAGTACGCTAGATGGGCAGATCAATTTCTGGGACACCATTGAAGGTGTGTT 
AATGTACACCATAGAGGGGCGGAGAGATATCGCTGGAGGTCGGGTCATGACTGACCGTCG 
GTCTGCAGCTAATTCAAGTTCTGGAAAGTGTTTTACAACATTGTGCTATTCCGCTGATGG 
AGGGTATATTCTAGCCGCAGGAACTAGCAGATATATTTGCATGTATGATATCGCAGATCA 
GGTTAGCTAACTAGCTCCTCTTGGAGTTCAGGTTTTCTTAAAGCTTGTGTTCTTCTGATA 
AAGAAACTTAGTCAAAGTGTCTGGAATATCACCTTTTCAGGTTCTTCTGCGCCGGTTTCA 
GATATCCCATAATCTTTCGTTAGATGGGGTTCTGGACTTCTTGCACTCTAAGAAGATGAC 
AGAAGCAGGACCAATTGATCTGATCGATGATGACAACAGCGATGAAGAAGGTGGCATTGA 
TAAACAGTCGAGAGGGAATCTGGGTTACGATCTGCCTGGATCCAGGCCTAACCGTGGCAG 
GCCCATTATCCGGACAAAAAGCCTCAGCATTGCCCCAACTGGAAGGAGCTTTGCTGCTGC 
AACAACAGAAGGAGTCCTCATCTTTTCAATTGACGATACCTTCATCTTTGATCCGACCGA 
TCTAGATATAGATGTTACTCCAGAGGTGAGCCTTTTGTAAATCGCTGATGGTGGTTATAG 
TTCTGATTATTGGTTTTGAAATGTAAAGCTAAGGTGTTGTTTGTGTAGGCTGTTGAGGCT 
GCCATAGAAGAGGATGAAGTTAGCAGAGCACTTGCTCTAAGTATGCGTTTGAACGAAGAT 
AGCCTTATCAAAAAATGCATCTTCGCTGTAGCCCCTGCAGACATAAAAGCTGTTGCCATC 
TCTGTCCGCCAGAAATACTTAGAAAGGCTTATGGAAGCTTTGGTGGATCTGCTTGAGAAC 
TGTCCTCATCTGGAGTTCATACTTCACTGGTGTCAGGTAATGTCTCGTTTTCTTCTCTTT 
TTTGATAAATCTCTGCTCAAATGCTCTCAACTTAATCAAACTTTGTGTTGTCTTTTTATG 
TGCAGGAAATCTGCAAGGCTCACGGAAGCTCCATTCAGCGGAACTACAGAACTCTATTGC 
CTGCACTGAGATCGTTGCAGAAGGCGATCACCAGAGCCCATCAGGATCTGGCAGATATGT 
GTTCTTCCAATGAGTACACGCTTCGCTACTTGTGTTCTGTTCCAAACAATCATTGATTAT 
GTTTTCTGCATTATGTATCACCGGAAATTTTCATCTTCCTTTTTCGGTTAAACAAATTTT 
GAGATTTTGATATATGAGTTTCTAACATCTGAAT
>AT2G20980.1 |  MCM10 
ACGAAATTCAGTCTCCCGCCCACGAGATGTTGTTTTGTGTTCTTGTGCATCGCTATTGGA 
TCGTGAAATTGAAAAATGGAAAACGACCAAGAGGATCTTGAATTGCTTCTGTCTCTTGAC 
GATAGGGTTCTCGAAACTCCTCCTGGTTCTCCTTCTGCTGCACCCGGTGAGTTTCTCTCT 
CACTTTTGTAGGGTTTTGTTTTTTGCTTTCTTAAATCCAGTGTGCGATTCCGATTTGCAT 
CTCTGATTCGATCAATCACTTGCGTAATAGATCTTATGATTCGAATATTGATCTGGGGGC 
GTCTTGTTTCCATCTAATTCGCTCAAGAATCTGTAAAGTTTGATGCTTTTCTCTCAGTTG 
GATTGTTCTTGTCCTTAATGCGAGGTAACGTTTGTGCAGGATATCTCACGGATGATGAAT 
CCCCCAAGCGTAGGGGTCACTCTGACTTGTCTGACTTCAGAAGTGTTGTTCAAGATTGCA 
TTGACTATAATCCTAAACCAATCGCCAAAAACACTAAACCCAAAGGCTCCAACAACTCCA 
ATACCAATGACATTGAGAAGTTTTCTGGCTTGCGCATTAGGTAAAGCTAAACCCTTTTCA 
CTCTAGCAATGTGAGTCACAGCTACTATAGTCGTAGATTGTTTTTTCAGTTCCAATCTAT 
AGCTGAAATAGCCAATCTTTTGATGTATTTGTAGGAATCAATTACTTAGCCCTGCAGAGA 
TAAGTGATCTGTTTTCAGATATCCGTTTCGTTCGATTGCCAACAATAAAGTAAGTTGTTC 
ACTTCTTAGATAGATAAACATTACTTACTACTCTTGGGAAGCAGAAGAGATTTAAAACAA 
GTTTCTGTGTAGGAACTTGCTAATGGGTGACAAACTCTCTGGCTGCTGGGCGACAATGGG 
AGTGATAACAGAGAAAGGACAACCCAAAACAAGCTCCATTGGGCAGGCTTATGGTATATG 
GAAGATCGGTAGCTTAAATGAAAACAATGTCTCCTTGTTCTTGTTTGGTGATGCTTACAA 
AAAGAATGAGACAGAAAAGGCAGGAACGGTTTTCGGTCTGTTTAATTGCTCACTTCGCAA 
GGACAATGGGGTAAGTATATAGCATCAGCTTTTCCAGTAGCCGGATGGCTTAACTAAATC 
TTCTTTTTAAAAAATTTATGTTTGTGGCAGGGACGTGAGTTCTCATTGAGTGTCAACTCT 
GCTAAACAAATGGTTAAACTGGGGGTTTCAGCTGATTATGGAGTCTGCACAGCAAAGCGG 
AAAGATGGAACAACTTGTACATCTGTTGTAAACAAGTAAGTTTACCTTAGCGATGCATCT 
CTCTTTGTATTGTTTCCTGAATGTTGAGTTACAACTTTGAATTTGGTTTCAGGCGCCAAG 
GAGCATTCTGCAAGATTCATAAACTGGTACATTTTGGTAATACTTTGGTCTTGTTTTCTG 
GCGTCAATGCAATGAACCATGTTTTTCACTAACTATGAATTTTTCACAGAATGCATCAGA 
CAAATTTGCTACAATGAGAACTGAACTCAAAGGAGGGTATGCTAATCCTACCTAGTCGTG 
TTCATAGGTTGGTCATACCACGAGTTGGAAATTTTCATGATTCTTGGGATGTTTTTCTAT 
TTCAGGAACTTGAGAACAGCGTTCAGAGATCTAAAATCGCAAGGGATTTACACAGTTGAG 
CCACCAGCAGATAGAAGCGGAAACAAAAAGACCACTCAGCCTGTTCGAGTGCTATCAGTG 
GAAGGTCTCCGAAAGGCTCTAAGGTTGGAAACTCTCAACAAGTTTTTTACTTTTAACATA 
ACGAACAGAACCCGCTTCTCAGATTCTAAAGCCAATTGTGATTATGCAGTGGCGCGGATA 
AAGTGACCCCTAATGTACACTCACAAGGAATACGTTTCTTGAACGAGATGGCCAGTATGC 
TTCTTCTTTCTCATTTGACACAATACAAATAAAGCTTATAAGGTGAAATGTGTGACTGAT 
CTTGAAATTACAGGACAAAAGGCATCAAAGAACGTAAACAAGAAATCTGAAGCTGTGAAT 
AAGTCGACAGAGAAGAGGTACCATCTTCCTGAGTTGTTACTTTTTTTAGTTGTACTGATG 
TATAAAAGTTATCTCAAAGGAGATGTTCTGGAATCTCCTCTTCAGGAAAGCATCAACGAA 
AGAAACACAAGTAAATGGTGAGCCAAAGAGAAAGAAAACAGAGCACAGGAAGGAAACTCC 
CGAGATTTCCACCGGAAAAATGATGCTCCTAGATTTCTGCAGCTCTGACGAAGAATGACT 
CCTCAATAGACAGACATTGTCAAACAGGTACTCAGGCCTTAAGATTTGGGCCAAATGTGA 
TGTTATATGAAACCATAGAAACCGGTTTTTTTGTGGCTTTTGCCGGTTTATTCAATATTG 
AGATAGATTTTGTGGTTCTCAAGATTAGTCTTGAAACCGGCAAAACAAATATCCGTCATG 
CAAAAAACCTTCCATTTCAACCAAAATATATAGATGGACACATTTATTTAATGCATCAAG 
CAGTACCATATATATATTTCCTC
>AT2G37840.1 |  protein kinase family protein 
TTTCACTAACCTCTCTCTATCTCTCTCTTCATTATCCGAATTAAGCCAATCGAATCCTTT 
TCAACCCGACGGGTCGTGAAATTCCCCAAAAGATTCCTCTTTCTCAGCTCAATTTCCAAA 
AGCTCCGACCTTTACGATCCTCTAGATTCTCGGCGCCGGTTTCTCGGAGTAAATAATGGC 
TCAGTTCACGGGTCGGGTCGTTGGAGACTACTTGGTGGGTCGTCAAATCGGGTCGGGTTC 
GTTCTCTGTTGTTTGGGAAGCGAGGCACCGCGTTGACGGTACTGAGGTTGCTATCAAAGA 
GATCGCCATGGACAGGCTTAACAAGAAGCTGCAGGAAAGTCTCATGTCTGAGATTTTTAT 
CTTGAGGAGGATCAATCATCCTAACATCATCCGTCTGATCGACATGATCAAGGTTTCTTT 
TTTTGATTTGAAGTTTCGATTTTTTTGGTCGGTTCTCATTTTTTAGCTGAGAATTTTGAA 
TTGAGGTTAGCTTTGTTACTATATATGTTTCTCATTTGCTCATCCCAATGCCAATTTTGT 
GTCATAATGCCATGATTTTGCCGGTGAATTTTGGATCATATACATGGAATTAAGCTTCAA 
TTGTGGAACAAAATTTGGGTCTAGTTTGATGTTGTTCTGATTTGGGCAATGTGATGCAGT 
CTCCTGGGAAAGTACATTTGGTGTTGGAGTACTGCAAAGGAGGTGACTTGTCTGTGTATG 
TCCAAAGACATGGGATTGTCCCTGAAGCTACTGCTAAGCATTTCATGCAGCAGTTAGGTA 
AATTCTAGTGGCACTTACTTACTCTCTGTTTTGTTGTTTTTCTTGGTTGCCAGAAACATG 
TTTTGTAATCTCTGACGGGTTTTATTTTATGTAACAGCGGCCGGCTTACAAGTTCTTCGT 
GACAATAATATTATTCACCGAGATTTAAAGCCTCAGGTGTGTCTGATTCTCATTCCTTTC 
ATTTCAATGATCTTCTGTGCACCAGGTGTTTTTTATTGTTAATCAGATTAGTGTGTTAGT 
TGATCTCACTGTTAAATGATACAACTTTCAGAATGATGAAAGGATGCTGTAGAAGGGTGC 
TCTGTTAGTTTCCAATAAAACATGTTTTTGGATATGTTGGGGTTTCCTTGTCCAAGTCTT 
GGAGATTCCATCTTTGTTGAAATTTAATTCTTAAGGTTCTTTCGTTTTTGAAACAGAATC 
TTCTTCTATCCACAAATGAAAATGATGCAGATCTGAAGATTGCTGATTTTGGATTTGCAA 
GGTATTGTCATCAGCACCCCTTGTTACTAGATCAAAGAGTGTAATATGAATGAATTAGAG 
AAGGTTTCAAATGGGCTCAAGCTGCTTTTGAATGTATATTGTCGAATTTCTAGGTAATTT 
CATTGTTTTCTTGGGGGATTATACTTATTATACGCCTCCCCCATTTTGAACATCGCTCTT 
TTCTTGACGCAGATCGTTGCAACCTAGGGGGCTCGCAGAGACTTTATGTGGTTCACCATT 
GTATATGGCCCCAGAGATCATGCAACTCCAGAAGTATGATGCAAAGGTCAGACCTTTCTC 
TTACTAAGCTACCTAGGCCCTTCTCTTGACATTATCTCCTTACAATCCTAGCTGAATACA 
CAGGCAGATCTCTGGAGTGTTGGTGCTATTTTATTTCAACTTGTGACAGGCAGAACCCCT 
TTTACAGGAAACAGCCAAATTCAGGTTTTGTGTTCTGTCTCATTGACTTCTATATTATGT 
ATGTGTTTGTATTCTGGTGCATTAAACTAATACGTTCTCCATCGTGTGTTTACAGTTGCT 
CCAAAACATTATAAGATCAACCGAATTACATTTTCCAGGGGACTGTAGAGATTTAAGCTT 
GGACTGCATAGACCTGTGTCAGAAGTTACTGCGCCGTAATCCAGGTCAGCACTAATTCTG 
CTTGAAGTAGTGGAGACTACTATTCTTTTGCATGAAACCATATGCCCCAGGTTCTATTGG 
CATGTGTGTTGATCTAAAAATGTGAAATTATATTGAATTGTGGCCACGTTGGATTGGCGA 
TTCAAGCATTTTATAATTTGTACCGTGTTCAGAGTTTTTTGTTTGATTAGCACAATTAAA 
AACACAAATTGTACTGTTGCCATTTCAGTCTGTCCTAACTTTCCGAGTAACTCATATCAA 
CGGGAGTTGCGGAGTTTTCCAGAACTTGGAATTGTGATTTGAATAGCGGTTTATACTAAA 
CTCTAGTCATCTCCTACAGTTCACCGCGTATTTTATTCGAGAGAGCATGGTCCTACTCTG 
TGTGTATCCAAATACGATTACAAATCATTCTTGAATATATTGTCTTTTGCAGTGGAACGT 
TTGACATTTGAAGAGTTCTTTAATCACCCTTTCCTTTCGGACAGGCAGTCATATGATTTC 
TCCAGGTAGATGTGACAATTGTGGGGGCTAATGCTTTTCTCTATTTTATGCAGAAATTTG 
TACTGATTAAACTATCTGTGCTACAGGAGTAGATTGGGGTTAAGAACAATGGACGGTTTT 
CTTTCGTCTGGAAGCAGTCCCTCGAGAAACATGGAAGAAAGTTCTCAAGAAGACTGTTTG 
CCGTTCCTTCTAGATGATGATTCTAGTGGACCTGAGGGGAGCCCTTCATATTTAAAAAAG 
ACATCCTCAATGAAGTCGTCCTCTGGAATTAAAGTCGATACGAGAATTGAGAGGAAGGAG 
GTGGAATCTAGTCCTTTAAAACATACAGAACTTACTTCTGGATATAGTAGTTTCAACCAA 
AAAGTGGAAAACGATAGATTTAGATTTGAAACTCAAATAAATTCAGATAGGAGAAACCGC 
AGGGAACCGACAGGATTGACTGATTCTAGATCACTTATTGCTCCAGGAAGAGGTAATTGA 
ATCTTTACCATTTTATCCACCGTAGAGAATGATAAAGCTTTCTTGTTCTGTTTCTCACAT 
ATGTCAGTTCTGCAGTAGATGATTCTCAAGACTCCATGGATCAAGACTTCGTTCTCGTAT 
CTGGACCACCAGTAGATATGCCATCATCTTCATCAAGTTCTTCGAAGCCTTATAATTTTC 
CATTCAAGTCTCAGTCTCCTCCTGTAGAGTTATTCAACAGAAGCATAAGTTCAACGGCTC 
CCATGCCAATAATTGGTGCTACTAGCAACAGCATTGGTCAGTTTGGGAGCCTTGACAGTC 
AGTATTCTGCCCCGAGCACTTCTCATGGGTCTCTGGATCTTGGTGATGCTTTTGAACAGC 
CATCAACTCACAGCCTGACAAGAATCAGGTCTCTGAGAAAATATGCAGCAACAATTGCAG 
AACTAGTTTATGAAAGGGTAACGAAACTTTTCACTGTTTGTAGATAGTCACATATTATCA 
TCGTGACATCACTGGCCATCATGAGTTTCTGAGTAGATTATTTTCATGATTCTTTGTATA 
GATTGAATCTGACAAACATCTAGAAGCTTTCTCGATCCAATTGGCGATTCTGGCAATTTG 
GAAACAGGCACTGCACATATGTCATACTCAGGCAATTTCAGGTTTGGAAGGAAGCCCAAG 
CCAAGACATTAACAAACTAAGAAGTAGCAGCCTGAAACACGATACTCACAGTTCTAATAA 
AGTCACTGATCTCAGCCATGATGGATCGGAGGAGATATCCTCTCAGATTCAGAGGCAATT 
TATACAGGAGATTGAGCTTGCTGAAGAACTTGCCAAGAGTATTGAACCTGGTATGTTTTT 
TTTTCTCTTGGGAAAAAATAAACATTTGTTTTTGAGGTATTAAAGATCTTAAAAGGTTTT 
CATCTACATGTTTGTAGGAAATACAAAAATGCCAGATGCAATGGAGACGATATTTGAAGC 
AGCACTTGATCTTGGAAAACTTGGAGGAGTAAGTTTCCTTTGTCTTTTCACAAAGAATAT 
TGATGAACAATCCAAAAACAATGAAAACAAAACAATCAACTTGTCTATACTCATTCTCAT 
ATATGGTGCCTGTGGCTTTTTCTGCAGGTTAAGGAGGTTATGGGAGATACAGAGAACGCC 
GGAAACCAATATTCGAAAGCAGTGCGTTTGCTGGTATTCCTTTTAGTAGAAGCACCAATG 
CTGATTCTGAATCCGCCACTGTCTCTCACAAACTCAGTCAGGTATCGTCTCAGGACATAT 
ATTGATTTCCTCAGCAGAAGATTAAAACATCTGCAGTCACATAGAAGAAGTTCAGCTGGT 
CAGATGCAAGGATCATCGTTAGCTATGATGAACAGACAATCATAAATCCATTCACTTGGG 
TTGGGTTCTCTTGTTTCTTGTGTTCTTTTATGAAAAAAAAAAAAAAATCTAAAAGAGAAA 
AATGTATATGTTTTTGTACAGCAACATCATATATTCTTATTCTTTTGGGGTTAATCTGGA 
GGGACGTTGGGGAAATGATCTGTGTGATGGATGTTGTAACTTGTAACATTTTCTTGTTCT 
ATTTTGATCTTAATCCTATGTTTTTTACTTGACTTTATGCAAAAATATATGTTATGATG
>AT2G37840.1 |  protein kinase family protein 
TTTCACTAACCTCTCTCTATCTCTCTCTTCATTATCCGAATTAAGCCAATCGAATCCTTT 
TCAACCCGACGGGTCGTGAAATTCCCCAAAAGATTCCTCTTTCTCAGCTCAATTTCCAAA 
AGCTCCGACCTTTACGATCCTCTAGATTCTCGGCGCCGGTTTCTCGGAGTAAATAATGGC 
TCAGTTCACGGGTCGGGTCGTTGGAGACTACTTGGTGGGTCGTCAAATCGGGTCGGGTTC 
GTTCTCTGTTGTTTGGGAAGCGAGGCACCGCGTTGACGGTACTGAGGTTGCTATCAAAGA 
GATCGCCATGGACAGGCTTAACAAGAAGCTGCAGGAAAGTCTCATGTCTGAGATTTTTAT 
CTTGAGGAGGATCAATCATCCTAACATCATCCGTCTGATCGACATGATCAAGGTTTCTTT 
TTTTGATTTGAAGTTTCGATTTTTTTGGTCGGTTCTCATTTTTTAGCTGAGAATTTTGAA 
TTGAGGTTAGCTTTGTTACTATATATGTTTCTCATTTGCTCATCCCAATGCCAATTTTGT 
GTCATAATGCCATGATTTTGCCGGTGAATTTTGGATCATATACATGGAATTAAGCTTCAA 
TTGTGGAACAAAATTTGGGTCTAGTTTGATGTTGTTCTGATTTGGGCAATGTGATGCAGT 
CTCCTGGGAAAGTACATTTGGTGTTGGAGTACTGCAAAGGAGGTGACTTGTCTGTGTATG 
TCCAAAGACATGGGATTGTCCCTGAAGCTACTGCTAAGCATTTCATGCAGCAGTTAGGTA 
AATTCTAGTGGCACTTACTTACTCTCTGTTTTGTTGTTTTTCTTGGTTGCCAGAAACATG 
TTTTGTAATCTCTGACGGGTTTTATTTTATGTAACAGCGGCCGGCTTACAAGTTCTTCGT 
GACAATAATATTATTCACCGAGATTTAAAGCCTCAGGTGTGTCTGATTCTCATTCCTTTC 
ATTTCAATGATCTTCTGTGCACCAGGTGTTTTTTATTGTTAATCAGATTAGTGTGTTAGT 
TGATCTCACTGTTAAATGATACAACTTTCAGAATGATGAAAGGATGCTGTAGAAGGGTGC 
TCTGTTAGTTTCCAATAAAACATGTTTTTGGATATGTTGGGGTTTCCTTGTCCAAGTCTT 
GGAGATTCCATCTTTGTTGAAATTTAATTCTTAAGGTTCTTTCGTTTTTGAAACAGAATC 
TTCTTCTATCCACAAATGAAAATGATGCAGATCTGAAGATTGCTGATTTTGGATTTGCAA 
GGTATTGTCATCAGCACCCCTTGTTACTAGATCAAAGAGTGTAATATGAATGAATTAGAG 
AAGGTTTCAAATGGGCTCAAGCTGCTTTTGAATGTATATTGTCGAATTTCTAGGTAATTT 
CATTGTTTTCTTGGGGGATTATACTTATTATACGCCTCCCCCATTTTGAACATCGCTCTT 
TTCTTGACGCAGATCGTTGCAACCTAGGGGGCTCGCAGAGACTTTATGTGGTTCACCATT 
GTATATGGCCCCAGAGATCATGCAACTCCAGAAGTATGATGCAAAGGTCAGACCTTTCTC 
TTACTAAGCTACCTAGGCCCTTCTCTTGACATTATCTCCTTACAATCCTAGCTGAATACA 
CAGGCAGATCTCTGGAGTGTTGGTGCTATTTTATTTCAACTTGTGACAGGCAGAACCCCT 
TTTACAGGAAACAGCCAAATTCAGGTTTTGTGTTCTGTCTCATTGACTTCTATATTATGT 
ATGTGTTTGTATTCTGGTGCATTAAACTAATACGTTCTCCATCGTGTGTTTACAGTTGCT 
CCAAAACATTATAAGATCAACCGAATTACATTTTCCAGGGGACTGTAGAGATTTAAGCTT 
GGACTGCATAGACCTGTGTCAGAAGTTACTGCGCCGTAATCCAGGTCAGCACTAATTCTG 
CTTGAAGTAGTGGAGACTACTATTCTTTTGCATGAAACCATATGCCCCAGGTTCTATTGG 
CATGTGTGTTGATCTAAAAATGTGAAATTATATTGAATTGTGGCCACGTTGGATTGGCGA 
TTCAAGCATTTTATAATTTGTACCGTGTTCAGAGTTTTTTGTTTGATTAGCACAATTAAA 
AACACAAATTGTACTGTTGCCATTTCAGTCTGTCCTAACTTTCCGAGTAACTCATATCAA 
CGGGAGTTGCGGAGTTTTCCAGAACTTGGAATTGTGATTTGAATAGCGGTTTATACTAAA 
CTCTAGTCATCTCCTACAGTTCACCGCGTATTTTATTCGAGAGAGCATGGTCCTACTCTG 
TGTGTATCCAAATACGATTACAAATCATTCTTGAATATATTGTCTTTTGCAGTGGAACGT 
TTGACATTTGAAGAGTTCTTTAATCACCCTTTCCTTTCGGACAGGCAGTCATATGATTTC 
TCCAGGTAGATGTGACAATTGTGGGGGCTAATGCTTTTCTCTATTTTATGCAGAAATTTG 
TACTGATTAAACTATCTGTGCTACAGGAGTAGATTGGGGTTAAGAACAATGGACGGTTTT 
CTTTCGTCTGGAAGCAGTCCCTCGAGAAACATGGAAGAAAGTTCTCAAGAAGACTGTTTG 
CCGTTCCTTCTAGATGATGATTCTAGTGGACCTGAGGGGAGCCCTTCATATTTAAAAAAG 
ACATCCTCAATGAAGTCGTCCTCTGGAATTAAAGTCGATACGAGAATTGAGAGGAAGGAG 
GTGGAATCTAGTCCTTTAAAACATACAGAACTTACTTCTGGATATAGTAGTTTCAACCAA 
AAAGTGGAAAACGATAGATTTAGATTTGAAACTCAAATAAATTCAGATAGGAGAAACCGC 
AGGGAACCGACAGGATTGACTGATTCTAGATCACTTATTGCTCCAGGAAGAGGTAATTGA 
ATCTTTACCATTTTATCCACCGTAGAGAATGATAAAGCTTTCTTGTTCTGTTTCTCACAT 
ATGTCAGTTCTGCAGTAGATGATTCTCAAGACTCCATGGATCAAGACTTCGTTCTCGTAT 
CTGGACCACCAGTAGATATGCCATCATCTTCATCAAGTTCTTCGAAGCCTTATAATTTTC 
CATTCAAGTCTCAGTCTCCTCCTGTAGAGTTATTCAACAGAAGCATAAGTTCAACGGCTC 
CCATGCCAATAATTGGTGCTACTAGCAACAGCATTGGTCAGTTTGGGAGCCTTGACAGTC 
AGTATTCTGCCCCGAGCACTTCTCATGGGTCTCTGGATCTTGGTGATGCTTTTGAACAGC 
CATCAACTCACAGCCTGACAAGAATCAGGTCTCTGAGAAAATATGCAGCAACAATTGCAG 
AACTAGTTTATGAAAGGGTAACGAAACTTTTCACTGTTTGTAGATAGTCACATATTATCA 
TCGTGACATCACTGGCCATCATGAGTTTCTGAGTAGATTATTTTCATGATTCTTTGTATA 
GATTGAATCTGACAAACATCTAGAAGCTTTCTCGATCCAATTGGCGATTCTGGCAATTTG 
GAAACAGGCACTGCACATATGTCATACTCAGGCAATTTCAGGTTTGGAAGGAAGCCCAAG 
CCAAGACATTAACAAACTAAGAAGTAGCAGCCTGAAACACGATACTCACAGTTCTAATAA 
AGTCACTGATCTCAGCCATGATGGATCGGAGGAGATATCCTCTCAGATTCAGAGGCAATT 
TATACAGGAGATTGAGCTTGCTGAAGAACTTGCCAAGAGTATTGAACCTGGTATGTTTTT 
TTTTCTCTTGGGAAAAAATAAACATTTGTTTTTGAGGTATTAAAGATCTTAAAAGGTTTT 
CATCTACATGTTTGTAGGAAATACAAAAATGCCAGATGCAATGGAGACGATATTTGAAGC 
AGCACTTGATCTTGGAAAACTTGGAGGAGTAAGTTTCCTTTGTCTTTTCACAAAGAATAT 
TGATGAACAATCCAAAAACAATGAAAACAAAACAATCAACTTGTCTATACTCATTCTCAT 
ATATGGTGCCTGTGGCTTTTTCTGCAGGTTAAGGAGGTTATGGGAGATACAGAGAACGCC 
GGAAACCAATATTCGAAAGCAGTGCGTTTGCTGGTATTCCTTTTAGTAGAAGCACCAATG 
CTGATTCTGAATCCGCCACTGTCTCTCACAAACTCAGTCAGGTATCGTCTCAGGACATAT 
ATTGATTTCCTCAGCAGAAGATTAAAACATCTGCAGTCACATAGAAGAAGTTCAGCTGGT 
CAGATGCAAGGATCATCGTTAGCTATGATGAACAGACAATCATAAATCCATTCACTTGGG 
TTGGGTTCTCTTGTTTCTTGTGTTCTTTTATGAAAAAAAAAAAAAAATCTAAAAGAGAAA 
AATGTATATGTTTTTGTACAGCAACATCATATATTCTTATTCTTTTGGGGTTAATCTGGA 
GGGACGTTGGGGAAATGATCTGTGTGATGGATGTTGTAACTTGTAACATTTTCTTGTTCT 
ATTTTGATCTTAATCCTATGTTTTTTACTTGACTTTATGCAAAAATATATGTTATGATG
>AT2G37840.2 |  protein kinase family protein 
AAAAGATTCCTCTTTCTCAGCTCAATTTCCAAAAGCTCCGACCTTTACGATCCTCTAGAT 
TCTCGGCGCCGGTTTCTCGGAGTAAATAATGGCTCAGTTCACGGGTCGGGTCGTTGGAGA 
CTACTTGGTGGGTCGTCAAATCGGGTCGGGTTCGTTCTCTGTTGTTTGGGAAGCGAGGCA 
CCGCGTTGACGGTACTGAGGTTGCTATCAAAGAGATCGCCATGGACAGGCTTAACAAGAA 
GCTGCAGGAAAGTCTCATGTCTGAGATTTTTATCTTGAGGAGGATCAATCATCCTAACAT 
CATCCGTCTGATCGACATGATCAAGGTTTCTTTTTTTGATTTGAAGTTTCGATTTTTTTG 
GTCGGTTCTCATTTTTTAGCTGAGAATTTTGAATTGAGGTTAGCTTTGTTACTATATATG 
TTTCTCATTTGCTCATCCCAATGCCAATTTTGTGTCATAATGCCATGATTTTGCCGGTGA 
ATTTTGGATCATATACATGGAATTAAGCTTCAATTGTGGAACAAAATTTGGGTCTAGTTT 
GATGTTGTTCTGATTTGGGCAATGTGATGCAGTCTCCTGGGAAAGTACATTTGGTGTTGG 
AGTACTGCAAAGGAGGTGACTTGTCTGTGTATGTCCAAAGACATGGGATTGTCCCTGAAG 
CTACTGCTAAGCATTTCATGCAGCAGTTAGGTAAATTCTAGTGGCACTTACTTACTCTCT 
GTTTTGTTGTTTTTCTTGGTTGCCAGAAACATGTTTTGTAATCTCTGACGGGTTTTATTT 
TATGTAACAGCGGCCGGCTTACAAGTTCTTCGTGACAATAATATTATTCACCGAGATTTA 
AAGCCTCAGGTGTGTCTGATTCTCATTCCTTTCATTTCAATGATCTTCTGTGCACCAGGT 
GTTTTTTATTGTTAATCAGATTAGTGTGTTAGTTGATCTCACTGTTAAATGATACAACTT 
TCAGAATGATGAAAGGATGCTGTAGAAGGGTGCTCTGTTAGTTTCCAATAAAACATGTTT 
TTGGATATGTTGGGGTTTCCTTGTCCAAGTCTTGGAGATTCCATCTTTGTTGAAATTTAA 
TTCTTAAGGTTCTTTCGTTTTTGAAACAGAATCTTCTTCTATCCACAAATGAAAATGATG 
CAGATCTGAAGATTGCTGATTTTGGATTTGCAAGGTATTGTCATCAGCACCCCTTGTTAC 
TAGATCAAAGAGTGTAATATGAATGAATTAGAGAAGGTTTCAAATGGGCTCAAGCTGCTT 
TTGAATGTATATTGTCGAATTTCTAGGTAATTTCATTGTTTTCTTGGGGGATTATACTTA 
TTATACGCCTCCCCCATTTTGAACATCGCTCTTTTCTTGACGCAGATCGTTGCAACCTAG 
GGGGCTCGCAGAGACTTTATGTGGTTCACCATTGTATATGGCCCCAGAGATCATGCAACT 
CCAGAAGTATGATGCAAAGGTCAGACCTTTCTCTTACTAAGCTACCTAGGCCCTTCTCTT 
GACATTATCTCCTTACAATCCTAGCTGAATACACAGGCAGATCTCTGGAGTGTTGGTGCT 
ATTTTATTTCAACTTGTGACAGGCAGAACCCCTTTTACAGGAAACAGCCAAATTCAGGTT 
TTGTGTTCTGTCTCATTGACTTCTATATTATGTATGTGTTTGTATTCTGGTGCATTAAAC 
TAATACGTTCTCCATCGTGTGTTTACAGTTGCTCCAAAACATTATAAGATCAACCGAATT 
ACATTTTCCAGGGGACTGTAGAGATTTAAGCTTGGACTGCATAGACCTGTGTCAGAAGTT 
ACTGCGCCGTAATCCAGGTCAGCACTAATTCTGCTTGAAGTAGTGGAGACTACTATTCTT 
TTGCATGAAACCATATGCCCCAGGTTCTATTGGCATGTGTGTTGATCTAAAAATGTGAAA 
TTATATTGAATTGTGGCCACGTTGGATTGGCGATTCAAGCATTTTATAATTTGTACCGTG 
TTCAGAGTTTTTTGTTTGATTAGCACAATTAAAAACACAAATTGTACTGTTGCCATTTCA 
GTCTGTCCTAACTTTCCGAGTAACTCATATCAACGGGAGTTGCGGAGTTTTCCAGAACTT 
GGAATTGTGATTTGAATAGCGGTTTATACTAAACTCTAGTCATCTCCTACAGTTCACCGC 
GTATTTTATTCGAGAGAGCATGGTCCTACTCTGTGTGTATCCAAATACGATTACAAATCA 
TTCTTGAATATATTGTCTTTTGCAGTGGAACGTTTGACATTTGAAGAGTTCTTTAATCAC 
CCTTTCCTTTCGGACAGGCAGTCATATGATTTCTCCAGGTAGATGTGACAATTGTGGGGG 
CTAATGCTTTTCTCTATTTTATGCAGAAATTTGTACTGATTAAACTATCTGTGCTACAGG 
AGTAGATTGGGGTTAAGAACAATGGACGGTTTTCTTTCGTCTGGAAGCAGTCCCTCGAGA 
AACATGGAAGAAAGTTCTCAAGAAGACTGTTTGCCGTTCCTTCTAGATGATGATTCTAGT 
GGACCTGAGGGGAGCCCTTCATATTTAAAAAAGACATCCTCAATGAAGTCGTCCTCTGGA 
ATTAAAGTCGATACGAGAATTGAGAGGAAGGAGGTGGAATCTAGTCCTTTAAAACATACA 
GAACTTACTTCTGGATATAGTAGTTTCAACCAAAAAGTGGAAAACGATAGATTTAGATTT 
GAAACTCAAATAAATTCAGATAGGAGAAACCGCAGGGAACCGACAGGATTGACTGATTCT 
AGATCACTTATTGCTCCAGGAAGAGGTAATTGAATCTTTACCATTTTATCCACCGTAGAG 
AATGATAAAGCTTTCTTGTTCTGTTTCTCACATATGTCAGTTCTGCAGTAGATGATTCTC 
AAGACTCCATGGATCAAGACTTCGTTCTCGTATCTGGACCACCAGTAGATATGCCATCAT 
CTTCATCAAGTTCTTCGAAGCCTTATAATTTTCCATTCAAGTCTCAGTCTCCTCCTGTAG 
AGTTATTCAACAGAAGCATAAGTTCAACGGCTCCCATGCCAATAATTGGTGCTACTAGCA 
ACAGCATTGGTCAGTTTGGGAGCCTTGACAGTCAGTATTCTGCCCCGAGCACTTCTCATG 
GGTCTCTGGATCTTGGTGATGCTTTTGAACAGCCATCAACTCACAGCCTGACAAGAATCA 
GGTCTCTGAGAAAATATGCAGCAACAATTGCAGAACTAGTTTATGAAAGGGTAACGAAAC 
TTTTCACTGTTTGTAGATAGTCACATATTATCATCGTGACATCACTGGCCATCATGAGTT 
TCTGAGTAGATTATTTTCATGATTCTTTGTATAGATTGAATCTGACAAACATCTAGAAGC 
TTTCTCGATCCAATTGGCGATTCTGGCAATTTGGAAACAGGCACTGCACATATGTCATAC 
TCAGGCAATTTCAGGTTTGGAAGGAAGCCCAAGCCAAGACATTAACAAACTAAGAAGTAG 
CAGCCTGAAACACGATACTCACAGTTCTAATAAAGTCACTGATCTCAGCCATGATGGATC 
GGAGGAGATATCCTCTCAGATTCAGAGGCAATTTATACAGGAGATTGAGCTTGCTGAAGA 
ACTTGCCAAGAGTATTGAACCTGGTATGTTTTTTTTTCTCTTGGGAAAAAATAAACATTT 
GTTTTTGAGGTATTAAAGATCTTAAAAGGTTTTCATCTACATGTTTGTAGGAAATACAAA 
AATGCCAGATGCAATGGAGACGATATTTGAAGCAGCACTTGATCTTGGAAAACTTGGAGG 
AGTAAGTTTCCTTTGTCTTTTCACAAAGAATATTGATGAACAATCCAAAAACAATGAAAA 
CAAAACAATCAACTTGTCTATACTCATTCTCATATATGGTGCCTGTGGCTTTTTCTGCAG 
GTTAAGGAGGTTATGGGAGATACAGAGAACGCCGGAAACCAATATTCGAAAGCAGTGCGT 
TTGCTGGTATTCCTTTTAGTAGAAGCACCAATGCTGATTCTGAATCCGCCACTGTCTCTC 
ACAAACTCAGTCAGGTATCGTCTCAGGACATATATTGATTTCCTCAGCAGAAGATTAAAA 
CATCTGCAGTCACATAGAAGAAGTTCAGCTGGTCAGATGCAAGGATCATCGTTAGCTATG 
ATGAACAGACAATCATAAATCCATTCACTTGGGTTGGGTTCTCTTGTTTCTTGTGTTCTT 
TTATGAAAAAAAAAAAAAAATCTAAAAGAGAAAAATGTATATGTTTTTGTACAGCAACAT 
CATATATTCTTATTCTTTTGGGGTTAATCTGGAGGGACGTTGGGGAAATGATCTGTGTGA 
TGGATGTTGTAACTTGTAACATTTTCTTGTTCTATTTTGATCTTAATCCTATGTTTTTTA 
CTTGACTTTATGCAAAAATATATGTTATGATG
>AT2G37840.2 |  protein kinase family protein 
AAAAGATTCCTCTTTCTCAGCTCAATTTCCAAAAGCTCCGACCTTTACGATCCTCTAGAT 
TCTCGGCGCCGGTTTCTCGGAGTAAATAATGGCTCAGTTCACGGGTCGGGTCGTTGGAGA 
CTACTTGGTGGGTCGTCAAATCGGGTCGGGTTCGTTCTCTGTTGTTTGGGAAGCGAGGCA 
CCGCGTTGACGGTACTGAGGTTGCTATCAAAGAGATCGCCATGGACAGGCTTAACAAGAA 
GCTGCAGGAAAGTCTCATGTCTGAGATTTTTATCTTGAGGAGGATCAATCATCCTAACAT 
CATCCGTCTGATCGACATGATCAAGGTTTCTTTTTTTGATTTGAAGTTTCGATTTTTTTG 
GTCGGTTCTCATTTTTTAGCTGAGAATTTTGAATTGAGGTTAGCTTTGTTACTATATATG 
TTTCTCATTTGCTCATCCCAATGCCAATTTTGTGTCATAATGCCATGATTTTGCCGGTGA 
ATTTTGGATCATATACATGGAATTAAGCTTCAATTGTGGAACAAAATTTGGGTCTAGTTT 
GATGTTGTTCTGATTTGGGCAATGTGATGCAGTCTCCTGGGAAAGTACATTTGGTGTTGG 
AGTACTGCAAAGGAGGTGACTTGTCTGTGTATGTCCAAAGACATGGGATTGTCCCTGAAG 
CTACTGCTAAGCATTTCATGCAGCAGTTAGGTAAATTCTAGTGGCACTTACTTACTCTCT 
GTTTTGTTGTTTTTCTTGGTTGCCAGAAACATGTTTTGTAATCTCTGACGGGTTTTATTT 
TATGTAACAGCGGCCGGCTTACAAGTTCTTCGTGACAATAATATTATTCACCGAGATTTA 
AAGCCTCAGGTGTGTCTGATTCTCATTCCTTTCATTTCAATGATCTTCTGTGCACCAGGT 
GTTTTTTATTGTTAATCAGATTAGTGTGTTAGTTGATCTCACTGTTAAATGATACAACTT 
TCAGAATGATGAAAGGATGCTGTAGAAGGGTGCTCTGTTAGTTTCCAATAAAACATGTTT 
TTGGATATGTTGGGGTTTCCTTGTCCAAGTCTTGGAGATTCCATCTTTGTTGAAATTTAA 
TTCTTAAGGTTCTTTCGTTTTTGAAACAGAATCTTCTTCTATCCACAAATGAAAATGATG 
CAGATCTGAAGATTGCTGATTTTGGATTTGCAAGGTATTGTCATCAGCACCCCTTGTTAC 
TAGATCAAAGAGTGTAATATGAATGAATTAGAGAAGGTTTCAAATGGGCTCAAGCTGCTT 
TTGAATGTATATTGTCGAATTTCTAGGTAATTTCATTGTTTTCTTGGGGGATTATACTTA 
TTATACGCCTCCCCCATTTTGAACATCGCTCTTTTCTTGACGCAGATCGTTGCAACCTAG 
GGGGCTCGCAGAGACTTTATGTGGTTCACCATTGTATATGGCCCCAGAGATCATGCAACT 
CCAGAAGTATGATGCAAAGGTCAGACCTTTCTCTTACTAAGCTACCTAGGCCCTTCTCTT 
GACATTATCTCCTTACAATCCTAGCTGAATACACAGGCAGATCTCTGGAGTGTTGGTGCT 
ATTTTATTTCAACTTGTGACAGGCAGAACCCCTTTTACAGGAAACAGCCAAATTCAGGTT 
TTGTGTTCTGTCTCATTGACTTCTATATTATGTATGTGTTTGTATTCTGGTGCATTAAAC 
TAATACGTTCTCCATCGTGTGTTTACAGTTGCTCCAAAACATTATAAGATCAACCGAATT 
ACATTTTCCAGGGGACTGTAGAGATTTAAGCTTGGACTGCATAGACCTGTGTCAGAAGTT 
ACTGCGCCGTAATCCAGGTCAGCACTAATTCTGCTTGAAGTAGTGGAGACTACTATTCTT 
TTGCATGAAACCATATGCCCCAGGTTCTATTGGCATGTGTGTTGATCTAAAAATGTGAAA 
TTATATTGAATTGTGGCCACGTTGGATTGGCGATTCAAGCATTTTATAATTTGTACCGTG 
TTCAGAGTTTTTTGTTTGATTAGCACAATTAAAAACACAAATTGTACTGTTGCCATTTCA 
GTCTGTCCTAACTTTCCGAGTAACTCATATCAACGGGAGTTGCGGAGTTTTCCAGAACTT 
GGAATTGTGATTTGAATAGCGGTTTATACTAAACTCTAGTCATCTCCTACAGTTCACCGC 
GTATTTTATTCGAGAGAGCATGGTCCTACTCTGTGTGTATCCAAATACGATTACAAATCA 
TTCTTGAATATATTGTCTTTTGCAGTGGAACGTTTGACATTTGAAGAGTTCTTTAATCAC 
CCTTTCCTTTCGGACAGGCAGTCATATGATTTCTCCAGGTAGATGTGACAATTGTGGGGG 
CTAATGCTTTTCTCTATTTTATGCAGAAATTTGTACTGATTAAACTATCTGTGCTACAGG 
AGTAGATTGGGGTTAAGAACAATGGACGGTTTTCTTTCGTCTGGAAGCAGTCCCTCGAGA 
AACATGGAAGAAAGTTCTCAAGAAGACTGTTTGCCGTTCCTTCTAGATGATGATTCTAGT 
GGACCTGAGGGGAGCCCTTCATATTTAAAAAAGACATCCTCAATGAAGTCGTCCTCTGGA 
ATTAAAGTCGATACGAGAATTGAGAGGAAGGAGGTGGAATCTAGTCCTTTAAAACATACA 
GAACTTACTTCTGGATATAGTAGTTTCAACCAAAAAGTGGAAAACGATAGATTTAGATTT 
GAAACTCAAATAAATTCAGATAGGAGAAACCGCAGGGAACCGACAGGATTGACTGATTCT 
AGATCACTTATTGCTCCAGGAAGAGGTAATTGAATCTTTACCATTTTATCCACCGTAGAG 
AATGATAAAGCTTTCTTGTTCTGTTTCTCACATATGTCAGTTCTGCAGTAGATGATTCTC 
AAGACTCCATGGATCAAGACTTCGTTCTCGTATCTGGACCACCAGTAGATATGCCATCAT 
CTTCATCAAGTTCTTCGAAGCCTTATAATTTTCCATTCAAGTCTCAGTCTCCTCCTGTAG 
AGTTATTCAACAGAAGCATAAGTTCAACGGCTCCCATGCCAATAATTGGTGCTACTAGCA 
ACAGCATTGGTCAGTTTGGGAGCCTTGACAGTCAGTATTCTGCCCCGAGCACTTCTCATG 
GGTCTCTGGATCTTGGTGATGCTTTTGAACAGCCATCAACTCACAGCCTGACAAGAATCA 
GGTCTCTGAGAAAATATGCAGCAACAATTGCAGAACTAGTTTATGAAAGGGTAACGAAAC 
TTTTCACTGTTTGTAGATAGTCACATATTATCATCGTGACATCACTGGCCATCATGAGTT 
TCTGAGTAGATTATTTTCATGATTCTTTGTATAGATTGAATCTGACAAACATCTAGAAGC 
TTTCTCGATCCAATTGGCGATTCTGGCAATTTGGAAACAGGCACTGCACATATGTCATAC 
TCAGGCAATTTCAGGTTTGGAAGGAAGCCCAAGCCAAGACATTAACAAACTAAGAAGTAG 
CAGCCTGAAACACGATACTCACAGTTCTAATAAAGTCACTGATCTCAGCCATGATGGATC 
GGAGGAGATATCCTCTCAGATTCAGAGGCAATTTATACAGGAGATTGAGCTTGCTGAAGA 
ACTTGCCAAGAGTATTGAACCTGGTATGTTTTTTTTTCTCTTGGGAAAAAATAAACATTT 
GTTTTTGAGGTATTAAAGATCTTAAAAGGTTTTCATCTACATGTTTGTAGGAAATACAAA 
AATGCCAGATGCAATGGAGACGATATTTGAAGCAGCACTTGATCTTGGAAAACTTGGAGG 
AGTAAGTTTCCTTTGTCTTTTCACAAAGAATATTGATGAACAATCCAAAAACAATGAAAA 
CAAAACAATCAACTTGTCTATACTCATTCTCATATATGGTGCCTGTGGCTTTTTCTGCAG 
GTTAAGGAGGTTATGGGAGATACAGAGAACGCCGGAAACCAATATTCGAAAGCAGTGCGT 
TTGCTGGTATTCCTTTTAGTAGAAGCACCAATGCTGATTCTGAATCCGCCACTGTCTCTC 
ACAAACTCAGTCAGGTATCGTCTCAGGACATATATTGATTTCCTCAGCAGAAGATTAAAA 
CATCTGCAGTCACATAGAAGAAGTTCAGCTGGTCAGATGCAAGGATCATCGTTAGCTATG 
ATGAACAGACAATCATAAATCCATTCACTTGGGTTGGGTTCTCTTGTTTCTTGTGTTCTT 
TTATGAAAAAAAAAAAAAAATCTAAAAGAGAAAAATGTATATGTTTTTGTACAGCAACAT 
CATATATTCTTATTCTTTTGGGGTTAATCTGGAGGGACGTTGGGGAAATGATCTGTGTGA 
TGGATGTTGTAACTTGTAACATTTTCTTGTTCTATTTTGATCTTAATCCTATGTTTTTTA 
CTTGACTTTATGCAAAAATATATGTTATGATG
>AT3G01090.1 |  AKIN10 (Arabidopsis SNF1 kinase homolog 10) protein binding / protein kinase 
GATACTTGCTTGCGCCTTATAGGCTACAGGAGCGAGAGCAATGAAAGCGAGAGGAAGAAT 
CTATCAATAATTTCTGGGTTTAAGCTGATCTCTGGATCTTCCTCAATTTTACTTTTTCAG 
CTCAGAAAATTTTGGGACTTTTTTTTGCTGCATTTTTTGGTTCCGAATTTTCTCCTCCGC 
CTTTTTTAATTTTTGGTAAGTTTCGATATCTCTCAATTTTCTTATTTCGGAAATAAAAAA 
AATTCTCGCCCTTTTGCAAATCAATGGATTGATCTTGAAATCGTCATTTCTGAATCGGGT 
ACGAGAGATCCAGTAATCCTCTGCGATTGAATTATTATTAGGGTTCATATTCCGAATTGG 
GGATAGTCTGAAAATTGCTATTTTAAGCTCTCTTCTTAGTGTTGGTTGGTTTATTCTGGA 
TAATAAAAGGGATCCTAATTCTCGCTAAATTCTCATGTTCAAACGAGTAGATGAGTTTAA 
TTTAGTTTCTTCAACGATCGATCACAGAATCTTCAAAAGTGTAAAAATTACTTGCTTTTT 
GTTCCTATTACTCTTTTGCAGTTTGTTTTGTGTGTTGTGTACTAGTAGATCTAATATCTC 
TCTCTCTTTTTTTGTAGAGAATGGATGGATCAGGCACAGGCAGTAGAAGTGGGGTAGAAT 
CGATTCTACCAAATTACAAGCTTGGGAGAACTCTTGGTATTGGTTCCTTTGGTAGGGTGA 
AGATAGCTGAGCATGCATTGACAGGACATAAGGTTGCTATCAAGATCCTCAATCGTCGCA 
AAATCAAGAACATGGAGATGGAGGAGAAAGGTACAAGTTTTGTTTTGTGTATCCATTCCA 
CCTTAGTTGTGACTTCACGGTACTCTTGGAATATATAAATATATAGCTTCTTTTTCGTCT 
TCCTTCCTTTGAACTTATTTGGTCTTTGATGCAGTGAGGAGAGAGATCAAAATCTTGAGA 
CTATTTATGCATCCTCACATCATCCGTCTCTATGAGGTTATAGAGACTCCCACAGATATT 
TATCTTGTCATGGAGTATGTGAACTCTGGTGAGCTATTTGACTATATTGTTGAGAAGGGT 
AGATTGCAGGAGGATGAGGCGAGGAACTTTTTTCAGCAGGTATGTTTTTATTTTATTTTA 
TCAACATGTAACTTTCCAAGCAACCATTCGATTTTATATTATATTTGAGAGTTAAGAATT 
AGCTACTTGGCTTTGATGTAGATAATATCAGGAGTGGAATACTGCCATCGAAACATGGTG 
GTTCACAGAGACCTCAAGCCTGAAAACTTGCTTTTGGACTCTAAATGCAATGTAAAGATT 
GCTGATTTTGGCCTGAGCAACATAATGCGAGATGGTCATTTTTTGAAGACAAGTTGTGGA 
AGTCCAAATTATGCCGCTCCAGAGGTAAGTGCTTCAGCCCTCAGGTATCTGAGGAATACT 
ATAATTAGGCTTGTTTCAAATGATAGGTTATAGTCGAGATCTATAAATTGTTTCAGGTAA 
TTTCGGGCAAGTTATATGCTGGCCCTGAAGTAGATGTCTGGAGCTGTGGTGTGATACTCT 
ACGCTCTTCTCTGTGGGACGCTTCCATTTGATGATGAAAACATTCCCAACCTTTTTAAGA 
AGATAAAGGTACATTCTATTACTCCTCCTCTTTCGTCTATTTGAACTAATGCTTGAATTT 
TTTATTTTATTTTTCGTATCACCCTTCGACTGTAACCTTTTTTTTTTCTCTTTTCGTCCT 
ATAGGGAGGGATATACACATTACCTAGCCATTTATCTCCTGGTGCTAGAGATTTGATCCC 
CCGGATGCTTGTAGTTGACCCCATGAAACGAGTAACCATCCCTGAGATCCGGCAACACCC 
TTGGTTCCAAGCTCATCTTCCGAGGTATTTAGCTGTTCCTCCTCCAGATACTGTGCAACA 
GGCAAAAAAGGTAAGCCTAACGTATCTACTCTTATTTTCATTAGAGAAATCTCTATTCCC 
ATTTTTCGATAAAGGCGTAAAAGCGCTGTCTTCATTTGTAGATTGACGAGGAGATTCTCC 
AAGAAGTTATCAATATGGGATTTGACAGAAACCACCTCATCGAATCGCTCCGCAACCGAA 
CCCAGAATGATGTATGTGTTTCCCACCCACTTGTTCTTTTGCTGTTTCTTTCATTTCAAA 
GATTAAAAAAAATTCCATCAAAAGATCTTAAATACTGTATTCTTACCGACTGTCTTCCAG 
GGCACTGTGACGTACTATCTGATACTGGACAATCGTTTCCGTGCCTCTAGTGGTTATCTC 
GGGGCTGAGTTTCAAGAGACCATGGTTAGTCTTTTTTGTCCTTTTCGACTTTAGCAAAAG 
ATCTTTGACGTAATGCTTCATTGTTTGATTTAATCAGGAAGGTACTCCCCGTATGCATCC 
AGCAGAAAGCGTTGCTTCACCTGTTAGCCATCGGCTTCCAGGACTGATGGAATATCAAGG 
AGTTGGCTTGAGATCTCAATACCCTGTTGAGAGAAAATGGGCTCTTGGACTTCAGGTTTT 
GATATTTTCTGTATTTATGGTATAAAGACTTCAGCTTTTGATATATATGTGATTAATATT 
GTAACAATTTGATCGCACAGTCTCGGGCTCATCCCCGTGAAATAATGACGGAAGTCCTGA 
AAGCCCTGCAAGATTTGAATGTATGTTGGAAGAAGATAGGGCACTACAACATGAAGTGCA 
GATGGGTTCCTAACAGCAGCGCAGATGGTATGCTCAGTAACTCGATGCACGATAACAACT 
ACTTTGGAGACGAGTCCAGCATAATAGAGAACGAAGCAGCTGTTAAGTCGCCCAATGTTG 
TCAAGTTTGAAATTCAGGTAAATCCTCTTCTCCACTTCATGATACATATCGGTTTCCCGT 
ACGACATTGTTTCTGATGTGTGATTTCGAGTGAAAGAAAGCTTTGTGTATTAGTGTCCAT 
GGCCATTTTTGTAACTGAATTAGAACTAGAGTGAATCTTCATGAATCTAACTATCAATCA 
ATATTTTCTGGGCTTGATGACGTTTGTTATTGTTGATGGTGAAACAGTTGTATAAAACTC 
GGGACGACAAGTATCTACTGGATTTGCAGAGAGTACAAGGTCCTCAGTTCTTGTTCTTGG 
ATCTGTGTGCTGCTTTTCTTGCTCAGCTCCGAGTCCTCTGAATACTAAACCGGACCTCTT 
CAAGAATAATCCCCACTTATTCCTTTTTTTTTTTTTTTCTTATTCGTCTAAGAAATTATT 
TAGAAAACGTAACCCTTTTTTTCTTCTTCTCTTTCTTTCTATTTCTATATGCGTGCTCTA 
CTCAAATACCTCTTTTAACTTAAATGTAAGACTGAGCAAGAGTAAAAAAAAGACACTTTG 
TACATAACTTGTAGTGCATCATGCCACCAAGATTGATTTTTGTTTTTGTTTACTCCA
>AT3G01090.1 |  AKIN10 (Arabidopsis SNF1 kinase homolog 10) protein binding / protein kinase 
GATACTTGCTTGCGCCTTATAGGCTACAGGAGCGAGAGCAATGAAAGCGAGAGGAAGAAT 
CTATCAATAATTTCTGGGTTTAAGCTGATCTCTGGATCTTCCTCAATTTTACTTTTTCAG 
CTCAGAAAATTTTGGGACTTTTTTTTGCTGCATTTTTTGGTTCCGAATTTTCTCCTCCGC 
CTTTTTTAATTTTTGGTAAGTTTCGATATCTCTCAATTTTCTTATTTCGGAAATAAAAAA 
AATTCTCGCCCTTTTGCAAATCAATGGATTGATCTTGAAATCGTCATTTCTGAATCGGGT 
ACGAGAGATCCAGTAATCCTCTGCGATTGAATTATTATTAGGGTTCATATTCCGAATTGG 
GGATAGTCTGAAAATTGCTATTTTAAGCTCTCTTCTTAGTGTTGGTTGGTTTATTCTGGA 
TAATAAAAGGGATCCTAATTCTCGCTAAATTCTCATGTTCAAACGAGTAGATGAGTTTAA 
TTTAGTTTCTTCAACGATCGATCACAGAATCTTCAAAAGTGTAAAAATTACTTGCTTTTT 
GTTCCTATTACTCTTTTGCAGTTTGTTTTGTGTGTTGTGTACTAGTAGATCTAATATCTC 
TCTCTCTTTTTTTGTAGAGAATGGATGGATCAGGCACAGGCAGTAGAAGTGGGGTAGAAT 
CGATTCTACCAAATTACAAGCTTGGGAGAACTCTTGGTATTGGTTCCTTTGGTAGGGTGA 
AGATAGCTGAGCATGCATTGACAGGACATAAGGTTGCTATCAAGATCCTCAATCGTCGCA 
AAATCAAGAACATGGAGATGGAGGAGAAAGGTACAAGTTTTGTTTTGTGTATCCATTCCA 
CCTTAGTTGTGACTTCACGGTACTCTTGGAATATATAAATATATAGCTTCTTTTTCGTCT 
TCCTTCCTTTGAACTTATTTGGTCTTTGATGCAGTGAGGAGAGAGATCAAAATCTTGAGA 
CTATTTATGCATCCTCACATCATCCGTCTCTATGAGGTTATAGAGACTCCCACAGATATT 
TATCTTGTCATGGAGTATGTGAACTCTGGTGAGCTATTTGACTATATTGTTGAGAAGGGT 
AGATTGCAGGAGGATGAGGCGAGGAACTTTTTTCAGCAGGTATGTTTTTATTTTATTTTA 
TCAACATGTAACTTTCCAAGCAACCATTCGATTTTATATTATATTTGAGAGTTAAGAATT 
AGCTACTTGGCTTTGATGTAGATAATATCAGGAGTGGAATACTGCCATCGAAACATGGTG 
GTTCACAGAGACCTCAAGCCTGAAAACTTGCTTTTGGACTCTAAATGCAATGTAAAGATT 
GCTGATTTTGGCCTGAGCAACATAATGCGAGATGGTCATTTTTTGAAGACAAGTTGTGGA 
AGTCCAAATTATGCCGCTCCAGAGGTAAGTGCTTCAGCCCTCAGGTATCTGAGGAATACT 
ATAATTAGGCTTGTTTCAAATGATAGGTTATAGTCGAGATCTATAAATTGTTTCAGGTAA 
TTTCGGGCAAGTTATATGCTGGCCCTGAAGTAGATGTCTGGAGCTGTGGTGTGATACTCT 
ACGCTCTTCTCTGTGGGACGCTTCCATTTGATGATGAAAACATTCCCAACCTTTTTAAGA 
AGATAAAGGTACATTCTATTACTCCTCCTCTTTCGTCTATTTGAACTAATGCTTGAATTT 
TTTATTTTATTTTTCGTATCACCCTTCGACTGTAACCTTTTTTTTTTCTCTTTTCGTCCT 
ATAGGGAGGGATATACACATTACCTAGCCATTTATCTCCTGGTGCTAGAGATTTGATCCC 
CCGGATGCTTGTAGTTGACCCCATGAAACGAGTAACCATCCCTGAGATCCGGCAACACCC 
TTGGTTCCAAGCTCATCTTCCGAGGTATTTAGCTGTTCCTCCTCCAGATACTGTGCAACA 
GGCAAAAAAGGTAAGCCTAACGTATCTACTCTTATTTTCATTAGAGAAATCTCTATTCCC 
ATTTTTCGATAAAGGCGTAAAAGCGCTGTCTTCATTTGTAGATTGACGAGGAGATTCTCC 
AAGAAGTTATCAATATGGGATTTGACAGAAACCACCTCATCGAATCGCTCCGCAACCGAA 
CCCAGAATGATGTATGTGTTTCCCACCCACTTGTTCTTTTGCTGTTTCTTTCATTTCAAA 
GATTAAAAAAAATTCCATCAAAAGATCTTAAATACTGTATTCTTACCGACTGTCTTCCAG 
GGCACTGTGACGTACTATCTGATACTGGACAATCGTTTCCGTGCCTCTAGTGGTTATCTC 
GGGGCTGAGTTTCAAGAGACCATGGTTAGTCTTTTTTGTCCTTTTCGACTTTAGCAAAAG 
ATCTTTGACGTAATGCTTCATTGTTTGATTTAATCAGGAAGGTACTCCCCGTATGCATCC 
AGCAGAAAGCGTTGCTTCACCTGTTAGCCATCGGCTTCCAGGACTGATGGAATATCAAGG 
AGTTGGCTTGAGATCTCAATACCCTGTTGAGAGAAAATGGGCTCTTGGACTTCAGGTTTT 
GATATTTTCTGTATTTATGGTATAAAGACTTCAGCTTTTGATATATATGTGATTAATATT 
GTAACAATTTGATCGCACAGTCTCGGGCTCATCCCCGTGAAATAATGACGGAAGTCCTGA 
AAGCCCTGCAAGATTTGAATGTATGTTGGAAGAAGATAGGGCACTACAACATGAAGTGCA 
GATGGGTTCCTAACAGCAGCGCAGATGGTATGCTCAGTAACTCGATGCACGATAACAACT 
ACTTTGGAGACGAGTCCAGCATAATAGAGAACGAAGCAGCTGTTAAGTCGCCCAATGTTG 
TCAAGTTTGAAATTCAGGTAAATCCTCTTCTCCACTTCATGATACATATCGGTTTCCCGT 
ACGACATTGTTTCTGATGTGTGATTTCGAGTGAAAGAAAGCTTTGTGTATTAGTGTCCAT 
GGCCATTTTTGTAACTGAATTAGAACTAGAGTGAATCTTCATGAATCTAACTATCAATCA 
ATATTTTCTGGGCTTGATGACGTTTGTTATTGTTGATGGTGAAACAGTTGTATAAAACTC 
GGGACGACAAGTATCTACTGGATTTGCAGAGAGTACAAGGTCCTCAGTTCTTGTTCTTGG 
ATCTGTGTGCTGCTTTTCTTGCTCAGCTCCGAGTCCTCTGAATACTAAACCGGACCTCTT 
CAAGAATAATCCCCACTTATTCCTTTTTTTTTTTTTTTCTTATTCGTCTAAGAAATTATT 
TAGAAAACGTAACCCTTTTTTTCTTCTTCTCTTTCTTTCTATTTCTATATGCGTGCTCTA 
CTCAAATACCTCTTTTAACTTAAATGTAAGACTGAGCAAGAGTAAAAAAAAGACACTTTG 
TACATAACTTGTAGTGCATCATGCCACCAAGATTGATTTTTGTTTTTGTTTACTCCA
>AT3G01090.1 |  AKIN10 (Arabidopsis SNF1 kinase homolog 10) protein binding / protein kinase 
GATACTTGCTTGCGCCTTATAGGCTACAGGAGCGAGAGCAATGAAAGCGAGAGGAAGAAT 
CTATCAATAATTTCTGGGTTTAAGCTGATCTCTGGATCTTCCTCAATTTTACTTTTTCAG 
CTCAGAAAATTTTGGGACTTTTTTTTGCTGCATTTTTTGGTTCCGAATTTTCTCCTCCGC 
CTTTTTTAATTTTTGGTAAGTTTCGATATCTCTCAATTTTCTTATTTCGGAAATAAAAAA 
AATTCTCGCCCTTTTGCAAATCAATGGATTGATCTTGAAATCGTCATTTCTGAATCGGGT 
ACGAGAGATCCAGTAATCCTCTGCGATTGAATTATTATTAGGGTTCATATTCCGAATTGG 
GGATAGTCTGAAAATTGCTATTTTAAGCTCTCTTCTTAGTGTTGGTTGGTTTATTCTGGA 
TAATAAAAGGGATCCTAATTCTCGCTAAATTCTCATGTTCAAACGAGTAGATGAGTTTAA 
TTTAGTTTCTTCAACGATCGATCACAGAATCTTCAAAAGTGTAAAAATTACTTGCTTTTT 
GTTCCTATTACTCTTTTGCAGTTTGTTTTGTGTGTTGTGTACTAGTAGATCTAATATCTC 
TCTCTCTTTTTTTGTAGAGAATGGATGGATCAGGCACAGGCAGTAGAAGTGGGGTAGAAT 
CGATTCTACCAAATTACAAGCTTGGGAGAACTCTTGGTATTGGTTCCTTTGGTAGGGTGA 
AGATAGCTGAGCATGCATTGACAGGACATAAGGTTGCTATCAAGATCCTCAATCGTCGCA 
AAATCAAGAACATGGAGATGGAGGAGAAAGGTACAAGTTTTGTTTTGTGTATCCATTCCA 
CCTTAGTTGTGACTTCACGGTACTCTTGGAATATATAAATATATAGCTTCTTTTTCGTCT 
TCCTTCCTTTGAACTTATTTGGTCTTTGATGCAGTGAGGAGAGAGATCAAAATCTTGAGA 
CTATTTATGCATCCTCACATCATCCGTCTCTATGAGGTTATAGAGACTCCCACAGATATT 
TATCTTGTCATGGAGTATGTGAACTCTGGTGAGCTATTTGACTATATTGTTGAGAAGGGT 
AGATTGCAGGAGGATGAGGCGAGGAACTTTTTTCAGCAGGTATGTTTTTATTTTATTTTA 
TCAACATGTAACTTTCCAAGCAACCATTCGATTTTATATTATATTTGAGAGTTAAGAATT 
AGCTACTTGGCTTTGATGTAGATAATATCAGGAGTGGAATACTGCCATCGAAACATGGTG 
GTTCACAGAGACCTCAAGCCTGAAAACTTGCTTTTGGACTCTAAATGCAATGTAAAGATT 
GCTGATTTTGGCCTGAGCAACATAATGCGAGATGGTCATTTTTTGAAGACAAGTTGTGGA 
AGTCCAAATTATGCCGCTCCAGAGGTAAGTGCTTCAGCCCTCAGGTATCTGAGGAATACT 
ATAATTAGGCTTGTTTCAAATGATAGGTTATAGTCGAGATCTATAAATTGTTTCAGGTAA 
TTTCGGGCAAGTTATATGCTGGCCCTGAAGTAGATGTCTGGAGCTGTGGTGTGATACTCT 
ACGCTCTTCTCTGTGGGACGCTTCCATTTGATGATGAAAACATTCCCAACCTTTTTAAGA 
AGATAAAGGTACATTCTATTACTCCTCCTCTTTCGTCTATTTGAACTAATGCTTGAATTT 
TTTATTTTATTTTTCGTATCACCCTTCGACTGTAACCTTTTTTTTTTCTCTTTTCGTCCT 
ATAGGGAGGGATATACACATTACCTAGCCATTTATCTCCTGGTGCTAGAGATTTGATCCC 
CCGGATGCTTGTAGTTGACCCCATGAAACGAGTAACCATCCCTGAGATCCGGCAACACCC 
TTGGTTCCAAGCTCATCTTCCGAGGTATTTAGCTGTTCCTCCTCCAGATACTGTGCAACA 
GGCAAAAAAGGTAAGCCTAACGTATCTACTCTTATTTTCATTAGAGAAATCTCTATTCCC 
ATTTTTCGATAAAGGCGTAAAAGCGCTGTCTTCATTTGTAGATTGACGAGGAGATTCTCC 
AAGAAGTTATCAATATGGGATTTGACAGAAACCACCTCATCGAATCGCTCCGCAACCGAA 
CCCAGAATGATGTATGTGTTTCCCACCCACTTGTTCTTTTGCTGTTTCTTTCATTTCAAA 
GATTAAAAAAAATTCCATCAAAAGATCTTAAATACTGTATTCTTACCGACTGTCTTCCAG 
GGCACTGTGACGTACTATCTGATACTGGACAATCGTTTCCGTGCCTCTAGTGGTTATCTC 
GGGGCTGAGTTTCAAGAGACCATGGTTAGTCTTTTTTGTCCTTTTCGACTTTAGCAAAAG 
ATCTTTGACGTAATGCTTCATTGTTTGATTTAATCAGGAAGGTACTCCCCGTATGCATCC 
AGCAGAAAGCGTTGCTTCACCTGTTAGCCATCGGCTTCCAGGACTGATGGAATATCAAGG 
AGTTGGCTTGAGATCTCAATACCCTGTTGAGAGAAAATGGGCTCTTGGACTTCAGGTTTT 
GATATTTTCTGTATTTATGGTATAAAGACTTCAGCTTTTGATATATATGTGATTAATATT 
GTAACAATTTGATCGCACAGTCTCGGGCTCATCCCCGTGAAATAATGACGGAAGTCCTGA 
AAGCCCTGCAAGATTTGAATGTATGTTGGAAGAAGATAGGGCACTACAACATGAAGTGCA 
GATGGGTTCCTAACAGCAGCGCAGATGGTATGCTCAGTAACTCGATGCACGATAACAACT 
ACTTTGGAGACGAGTCCAGCATAATAGAGAACGAAGCAGCTGTTAAGTCGCCCAATGTTG 
TCAAGTTTGAAATTCAGGTAAATCCTCTTCTCCACTTCATGATACATATCGGTTTCCCGT 
ACGACATTGTTTCTGATGTGTGATTTCGAGTGAAAGAAAGCTTTGTGTATTAGTGTCCAT 
GGCCATTTTTGTAACTGAATTAGAACTAGAGTGAATCTTCATGAATCTAACTATCAATCA 
ATATTTTCTGGGCTTGATGACGTTTGTTATTGTTGATGGTGAAACAGTTGTATAAAACTC 
GGGACGACAAGTATCTACTGGATTTGCAGAGAGTACAAGGTCCTCAGTTCTTGTTCTTGG 
ATCTGTGTGCTGCTTTTCTTGCTCAGCTCCGAGTCCTCTGAATACTAAACCGGACCTCTT 
CAAGAATAATCCCCACTTATTCCTTTTTTTTTTTTTTTCTTATTCGTCTAAGAAATTATT 
TAGAAAACGTAACCCTTTTTTTCTTCTTCTCTTTCTTTCTATTTCTATATGCGTGCTCTA 
CTCAAATACCTCTTTTAACTTAAATGTAAGACTGAGCAAGAGTAAAAAAAAGACACTTTG 
TACATAACTTGTAGTGCATCATGCCACCAAGATTGATTTTTGTTTTTGTTTACTCCA
>AT3G01090.2 |  AKIN10 (Arabidopsis SNF1 kinase homolog 10) protein binding / protein kinase 
ACTTTTTCAGCTCAGAAAATTTTGGGACTTTTTTTTGCTGCATTTTTTGGTTCCGAATTT 
TCTCCTCCGCCTTTTTTAATTTTTGGTAAGTTTCGATATCTCTCAATTTTCTTATTTCGG 
AAATAAAAAAAATTCTCGCCCTTTTGCAAATCAATGGATTGATCTTGAAATCGTCATTTC 
TGAATCGGGTACGAGAGATCCAGTAATCCTCTGCGATTGAATTATTATTAGGGTTCATAT 
TCCGAATTGGGGATAGTCTGAAAATTGCTATTTTAAGCTCTCTTCTTAGTGTTGGTTGGT 
TTATTCTGGATAATAAAAGGGATCCTAATTCTCGCTAAATTCTCATGTTCAAACGAGTAG 
ATGAGTTTAATTTAGTTTCTTCAACGATCGATCACAGAATCTTCAAAAGTGTAAAAATTA 
CTTGCTTTTTGTTCCTATTACTCTTTTGCAGTTTGTTTTGTGTGTTGTGTACTAGTAGAT 
CTAATATCTCTCTCTCTTTTTTTGTAGAGAATGGATGGATCAGGCACAGGCAGTAGAAGT 
GGGGTAGAATCGATTCTACCAAATTACAAGCTTGGGAGAACTCTTGGTATTGGTTCCTTT 
GGTAGGGTGAAGATAGCTGAGCATGCATTGACAGGACATAAGGTTGCTATCAAGATCCTC 
AATCGTCGCAAAATCAAGAACATGGAGATGGAGGAGAAAGGTACAAGTTTTGTTTTGTGT 
ATCCATTCCACCTTAGTTGTGACTTCACGGTACTCTTGGAATATATAAATATATAGCTTC 
TTTTTCGTCTTCCTTCCTTTGAACTTATTTGGTCTTTGATGCAGTGAGGAGAGAGATCAA 
AATCTTGAGACTATTTATGCATCCTCACATCATCCGTCTCTATGAGGTTATAGAGACTCC 
CACAGATATTTATCTTGTCATGGAGTATGTGAACTCTGGTGAGCTATTTGACTATATTGT 
TGAGAAGGGTAGATTGCAGGAGGATGAGGCGAGGAACTTTTTTCAGCAGGTATGTTTTTA 
TTTTATTTTATCAACATGTAACTTTCCAAGCAACCATTCGATTTTATATTATATTTGAGA 
GTTAAGAATTAGCTACTTGGCTTTGATGTAGATAATATCAGGAGTGGAATACTGCCATCG 
AAACATGGTGGTTCACAGAGACCTCAAGCCTGAAAACTTGCTTTTGGACTCTAAATGCAA 
TGTAAAGATTGCTGATTTTGGCCTGAGCAACATAATGCGAGATGGTCATTTTTTGAAGAC 
AAGTTGTGGAAGTCCAAATTATGCCGCTCCAGAGGTAAGTGCTTCAGCCCTCAGGTATCT 
GAGGAATACTATAATTAGGCTTGTTTCAAATGATAGGTTATAGTCGAGATCTATAAATTG 
TTTCAGGTAATTTCGGGCAAGTTATATGCTGGCCCTGAAGTAGATGTCTGGAGCTGTGGT 
GTGATACTCTACGCTCTTCTCTGTGGGACGCTTCCATTTGATGATGAAAACATTCCCAAC 
CTTTTTAAGAAGATAAAGGTACATTCTATTACTCCTCCTCTTTCGTCTATTTGAACTAAT 
GCTTGAATTTTTTATTTTATTTTTCGTATCACCCTTCGACTGTAACCTTTTTTTTTTCTC 
TTTTCGTCCTATAGGGAGGGATATACACATTACCTAGCCATTTATCTCCTGGTGCTAGAG 
ATTTGATCCCCCGGATGCTTGTAGTTGACCCCATGAAACGAGTAACCATCCCTGAGATCC 
GGCAACACCCTTGGTTCCAAGCTCATCTTCCGAGGTATTTAGCTGTTCCTCCTCCAGATA 
CTGTGCAACAGGCAAAAAAGGTAAGCCTAACGTATCTACTCTTATTTTCATTAGAGAAAT 
CTCTATTCCCATTTTTCGATAAAGGCGTAAAAGCGCTGTCTTCATTTGTAGATTGACGAG 
GAGATTCTCCAAGAAGTTATCAATATGGGATTTGACAGAAACCACCTCATCGAATCGCTC 
CGCAACCGAACCCAGAATGATGTATGTGTTTCCCACCCACTTGTTCTTTTGCTGTTTCTT 
TCATTTCAAAGATTAAAAAAAATTCCATCAAAAGATCTTAAATACTGTATTCTTACCGAC 
TGTCTTCCAGGGCACTGTGACGTACTATCTGATACTGGACAATCGTTTCCGTGCCTCTAG 
TGGTTATCTCGGGGCTGAGTTTCAAGAGACCATGGTTAGTCTTTTTTGTCCTTTTCGACT 
TTAGCAAAAGATCTTTGACGTAATGCTTCATTGTTTGATTTAATCAGGAAGGTACTCCCC 
GTATGCATCCAGCAGAAAGCGTTGCTTCACCTGTTAGCCATCGGCTTCCAGGACTGATGG 
AATATCAAGGAGTTGGCTTGAGATCTCAATACCCTGTTGAGAGAAAATGGGCTCTTGGAC 
TTCAGGTTTTGATATTTTCTGTATTTATGGTATAAAGACTTCAGCTTTTGATATATATGT 
GATTAATATTGTAACAATTTGATCGCACAGTCTCGGGCTCATCCCCGTGAAATAATGACG 
GAAGTCCTGAAAGCCCTGCAAGATTTGAATGTATGTTGGAAGAAGATAGGGCACTACAAC 
ATGAAGTGCAGATGGGTTCCTAACAGCAGCGCAGATGGTATGCTCAGTAACTCGATGCAC 
GATAACAACTACTTTGGAGACGAGTCCAGCATAATAGAGAACGAAGCAGCTGTTAAGTCG 
CCCAATGTTGTCAAGTTTGAAATTCAGGTAAATCCTCTTCTCCACTTCATGATACATATC 
GGTTTCCCGTACGACATTGTTTCTGATGTGTGATTTCGAGTGAAAGAAAGCTTTGTGTAT 
TAGTGTCCATGGCCATTTTTGTAACTGAATTAGAACTAGAGTGAATCTTCATGAATCTAA 
CTATCAATCAATATTTTCTGGGCTTGATGACGTTTGTTATTGTTGATGGTGAAACAGTTG 
TATAAAACTCGGGACGACAAGTATCTACTGGATTTGCAGAGAGTACAAGGTCCTCAGTTC 
TTGTTCTTGGATCTGTGTGCTGCTTTTCTTGCTCAGCTCCGAGTCCTCTGAATACTAAAC 
CGGACCTCTTCAAGAATAATCCCCACTTATTCCTTTTTTTTTTTTTTTCTTATTCGTCTA 
AGAAATTATTTAGAAAACGTAACCCTTTTTTTCTTCTTCTCTTTCTTTCTATTTCTATAT 
GCGTGCTCTACTCAAATACCTCTTTTAACTTAAATGTAAGACTGAGCAAGAGTAAAAAAA 
AGACACTTTGTACATAACTTGTAGTGCATCATGCCACCAAGATTGATTTTTGTTTTTGTT 
TACTCCA
>AT3G01090.2 |  AKIN10 (Arabidopsis SNF1 kinase homolog 10) protein binding / protein kinase 
ACTTTTTCAGCTCAGAAAATTTTGGGACTTTTTTTTGCTGCATTTTTTGGTTCCGAATTT 
TCTCCTCCGCCTTTTTTAATTTTTGGTAAGTTTCGATATCTCTCAATTTTCTTATTTCGG 
AAATAAAAAAAATTCTCGCCCTTTTGCAAATCAATGGATTGATCTTGAAATCGTCATTTC 
TGAATCGGGTACGAGAGATCCAGTAATCCTCTGCGATTGAATTATTATTAGGGTTCATAT 
TCCGAATTGGGGATAGTCTGAAAATTGCTATTTTAAGCTCTCTTCTTAGTGTTGGTTGGT 
TTATTCTGGATAATAAAAGGGATCCTAATTCTCGCTAAATTCTCATGTTCAAACGAGTAG 
ATGAGTTTAATTTAGTTTCTTCAACGATCGATCACAGAATCTTCAAAAGTGTAAAAATTA 
CTTGCTTTTTGTTCCTATTACTCTTTTGCAGTTTGTTTTGTGTGTTGTGTACTAGTAGAT 
CTAATATCTCTCTCTCTTTTTTTGTAGAGAATGGATGGATCAGGCACAGGCAGTAGAAGT 
GGGGTAGAATCGATTCTACCAAATTACAAGCTTGGGAGAACTCTTGGTATTGGTTCCTTT 
GGTAGGGTGAAGATAGCTGAGCATGCATTGACAGGACATAAGGTTGCTATCAAGATCCTC 
AATCGTCGCAAAATCAAGAACATGGAGATGGAGGAGAAAGGTACAAGTTTTGTTTTGTGT 
ATCCATTCCACCTTAGTTGTGACTTCACGGTACTCTTGGAATATATAAATATATAGCTTC 
TTTTTCGTCTTCCTTCCTTTGAACTTATTTGGTCTTTGATGCAGTGAGGAGAGAGATCAA 
AATCTTGAGACTATTTATGCATCCTCACATCATCCGTCTCTATGAGGTTATAGAGACTCC 
CACAGATATTTATCTTGTCATGGAGTATGTGAACTCTGGTGAGCTATTTGACTATATTGT 
TGAGAAGGGTAGATTGCAGGAGGATGAGGCGAGGAACTTTTTTCAGCAGGTATGTTTTTA 
TTTTATTTTATCAACATGTAACTTTCCAAGCAACCATTCGATTTTATATTATATTTGAGA 
GTTAAGAATTAGCTACTTGGCTTTGATGTAGATAATATCAGGAGTGGAATACTGCCATCG 
AAACATGGTGGTTCACAGAGACCTCAAGCCTGAAAACTTGCTTTTGGACTCTAAATGCAA 
TGTAAAGATTGCTGATTTTGGCCTGAGCAACATAATGCGAGATGGTCATTTTTTGAAGAC 
AAGTTGTGGAAGTCCAAATTATGCCGCTCCAGAGGTAAGTGCTTCAGCCCTCAGGTATCT 
GAGGAATACTATAATTAGGCTTGTTTCAAATGATAGGTTATAGTCGAGATCTATAAATTG 
TTTCAGGTAATTTCGGGCAAGTTATATGCTGGCCCTGAAGTAGATGTCTGGAGCTGTGGT 
GTGATACTCTACGCTCTTCTCTGTGGGACGCTTCCATTTGATGATGAAAACATTCCCAAC 
CTTTTTAAGAAGATAAAGGTACATTCTATTACTCCTCCTCTTTCGTCTATTTGAACTAAT 
GCTTGAATTTTTTATTTTATTTTTCGTATCACCCTTCGACTGTAACCTTTTTTTTTTCTC 
TTTTCGTCCTATAGGGAGGGATATACACATTACCTAGCCATTTATCTCCTGGTGCTAGAG 
ATTTGATCCCCCGGATGCTTGTAGTTGACCCCATGAAACGAGTAACCATCCCTGAGATCC 
GGCAACACCCTTGGTTCCAAGCTCATCTTCCGAGGTATTTAGCTGTTCCTCCTCCAGATA 
CTGTGCAACAGGCAAAAAAGGTAAGCCTAACGTATCTACTCTTATTTTCATTAGAGAAAT 
CTCTATTCCCATTTTTCGATAAAGGCGTAAAAGCGCTGTCTTCATTTGTAGATTGACGAG 
GAGATTCTCCAAGAAGTTATCAATATGGGATTTGACAGAAACCACCTCATCGAATCGCTC 
CGCAACCGAACCCAGAATGATGTATGTGTTTCCCACCCACTTGTTCTTTTGCTGTTTCTT 
TCATTTCAAAGATTAAAAAAAATTCCATCAAAAGATCTTAAATACTGTATTCTTACCGAC 
TGTCTTCCAGGGCACTGTGACGTACTATCTGATACTGGACAATCGTTTCCGTGCCTCTAG 
TGGTTATCTCGGGGCTGAGTTTCAAGAGACCATGGTTAGTCTTTTTTGTCCTTTTCGACT 
TTAGCAAAAGATCTTTGACGTAATGCTTCATTGTTTGATTTAATCAGGAAGGTACTCCCC 
GTATGCATCCAGCAGAAAGCGTTGCTTCACCTGTTAGCCATCGGCTTCCAGGACTGATGG 
AATATCAAGGAGTTGGCTTGAGATCTCAATACCCTGTTGAGAGAAAATGGGCTCTTGGAC 
TTCAGGTTTTGATATTTTCTGTATTTATGGTATAAAGACTTCAGCTTTTGATATATATGT 
GATTAATATTGTAACAATTTGATCGCACAGTCTCGGGCTCATCCCCGTGAAATAATGACG 
GAAGTCCTGAAAGCCCTGCAAGATTTGAATGTATGTTGGAAGAAGATAGGGCACTACAAC 
ATGAAGTGCAGATGGGTTCCTAACAGCAGCGCAGATGGTATGCTCAGTAACTCGATGCAC 
GATAACAACTACTTTGGAGACGAGTCCAGCATAATAGAGAACGAAGCAGCTGTTAAGTCG 
CCCAATGTTGTCAAGTTTGAAATTCAGGTAAATCCTCTTCTCCACTTCATGATACATATC 
GGTTTCCCGTACGACATTGTTTCTGATGTGTGATTTCGAGTGAAAGAAAGCTTTGTGTAT 
TAGTGTCCATGGCCATTTTTGTAACTGAATTAGAACTAGAGTGAATCTTCATGAATCTAA 
CTATCAATCAATATTTTCTGGGCTTGATGACGTTTGTTATTGTTGATGGTGAAACAGTTG 
TATAAAACTCGGGACGACAAGTATCTACTGGATTTGCAGAGAGTACAAGGTCCTCAGTTC 
TTGTTCTTGGATCTGTGTGCTGCTTTTCTTGCTCAGCTCCGAGTCCTCTGAATACTAAAC 
CGGACCTCTTCAAGAATAATCCCCACTTATTCCTTTTTTTTTTTTTTTCTTATTCGTCTA 
AGAAATTATTTAGAAAACGTAACCCTTTTTTTCTTCTTCTCTTTCTTTCTATTTCTATAT 
GCGTGCTCTACTCAAATACCTCTTTTAACTTAAATGTAAGACTGAGCAAGAGTAAAAAAA 
AGACACTTTGTACATAACTTGTAGTGCATCATGCCACCAAGATTGATTTTTGTTTTTGTT 
TACTCCA
>AT3G01090.2 |  AKIN10 (Arabidopsis SNF1 kinase homolog 10) protein binding / protein kinase 
ACTTTTTCAGCTCAGAAAATTTTGGGACTTTTTTTTGCTGCATTTTTTGGTTCCGAATTT 
TCTCCTCCGCCTTTTTTAATTTTTGGTAAGTTTCGATATCTCTCAATTTTCTTATTTCGG 
AAATAAAAAAAATTCTCGCCCTTTTGCAAATCAATGGATTGATCTTGAAATCGTCATTTC 
TGAATCGGGTACGAGAGATCCAGTAATCCTCTGCGATTGAATTATTATTAGGGTTCATAT 
TCCGAATTGGGGATAGTCTGAAAATTGCTATTTTAAGCTCTCTTCTTAGTGTTGGTTGGT 
TTATTCTGGATAATAAAAGGGATCCTAATTCTCGCTAAATTCTCATGTTCAAACGAGTAG 
ATGAGTTTAATTTAGTTTCTTCAACGATCGATCACAGAATCTTCAAAAGTGTAAAAATTA 
CTTGCTTTTTGTTCCTATTACTCTTTTGCAGTTTGTTTTGTGTGTTGTGTACTAGTAGAT 
CTAATATCTCTCTCTCTTTTTTTGTAGAGAATGGATGGATCAGGCACAGGCAGTAGAAGT 
GGGGTAGAATCGATTCTACCAAATTACAAGCTTGGGAGAACTCTTGGTATTGGTTCCTTT 
GGTAGGGTGAAGATAGCTGAGCATGCATTGACAGGACATAAGGTTGCTATCAAGATCCTC 
AATCGTCGCAAAATCAAGAACATGGAGATGGAGGAGAAAGGTACAAGTTTTGTTTTGTGT 
ATCCATTCCACCTTAGTTGTGACTTCACGGTACTCTTGGAATATATAAATATATAGCTTC 
TTTTTCGTCTTCCTTCCTTTGAACTTATTTGGTCTTTGATGCAGTGAGGAGAGAGATCAA 
AATCTTGAGACTATTTATGCATCCTCACATCATCCGTCTCTATGAGGTTATAGAGACTCC 
CACAGATATTTATCTTGTCATGGAGTATGTGAACTCTGGTGAGCTATTTGACTATATTGT 
TGAGAAGGGTAGATTGCAGGAGGATGAGGCGAGGAACTTTTTTCAGCAGGTATGTTTTTA 
TTTTATTTTATCAACATGTAACTTTCCAAGCAACCATTCGATTTTATATTATATTTGAGA 
GTTAAGAATTAGCTACTTGGCTTTGATGTAGATAATATCAGGAGTGGAATACTGCCATCG 
AAACATGGTGGTTCACAGAGACCTCAAGCCTGAAAACTTGCTTTTGGACTCTAAATGCAA 
TGTAAAGATTGCTGATTTTGGCCTGAGCAACATAATGCGAGATGGTCATTTTTTGAAGAC 
AAGTTGTGGAAGTCCAAATTATGCCGCTCCAGAGGTAAGTGCTTCAGCCCTCAGGTATCT 
GAGGAATACTATAATTAGGCTTGTTTCAAATGATAGGTTATAGTCGAGATCTATAAATTG 
TTTCAGGTAATTTCGGGCAAGTTATATGCTGGCCCTGAAGTAGATGTCTGGAGCTGTGGT 
GTGATACTCTACGCTCTTCTCTGTGGGACGCTTCCATTTGATGATGAAAACATTCCCAAC 
CTTTTTAAGAAGATAAAGGTACATTCTATTACTCCTCCTCTTTCGTCTATTTGAACTAAT 
GCTTGAATTTTTTATTTTATTTTTCGTATCACCCTTCGACTGTAACCTTTTTTTTTTCTC 
TTTTCGTCCTATAGGGAGGGATATACACATTACCTAGCCATTTATCTCCTGGTGCTAGAG 
ATTTGATCCCCCGGATGCTTGTAGTTGACCCCATGAAACGAGTAACCATCCCTGAGATCC 
GGCAACACCCTTGGTTCCAAGCTCATCTTCCGAGGTATTTAGCTGTTCCTCCTCCAGATA 
CTGTGCAACAGGCAAAAAAGGTAAGCCTAACGTATCTACTCTTATTTTCATTAGAGAAAT 
CTCTATTCCCATTTTTCGATAAAGGCGTAAAAGCGCTGTCTTCATTTGTAGATTGACGAG 
GAGATTCTCCAAGAAGTTATCAATATGGGATTTGACAGAAACCACCTCATCGAATCGCTC 
CGCAACCGAACCCAGAATGATGTATGTGTTTCCCACCCACTTGTTCTTTTGCTGTTTCTT 
TCATTTCAAAGATTAAAAAAAATTCCATCAAAAGATCTTAAATACTGTATTCTTACCGAC 
TGTCTTCCAGGGCACTGTGACGTACTATCTGATACTGGACAATCGTTTCCGTGCCTCTAG 
TGGTTATCTCGGGGCTGAGTTTCAAGAGACCATGGTTAGTCTTTTTTGTCCTTTTCGACT 
TTAGCAAAAGATCTTTGACGTAATGCTTCATTGTTTGATTTAATCAGGAAGGTACTCCCC 
GTATGCATCCAGCAGAAAGCGTTGCTTCACCTGTTAGCCATCGGCTTCCAGGACTGATGG 
AATATCAAGGAGTTGGCTTGAGATCTCAATACCCTGTTGAGAGAAAATGGGCTCTTGGAC 
TTCAGGTTTTGATATTTTCTGTATTTATGGTATAAAGACTTCAGCTTTTGATATATATGT 
GATTAATATTGTAACAATTTGATCGCACAGTCTCGGGCTCATCCCCGTGAAATAATGACG 
GAAGTCCTGAAAGCCCTGCAAGATTTGAATGTATGTTGGAAGAAGATAGGGCACTACAAC 
ATGAAGTGCAGATGGGTTCCTAACAGCAGCGCAGATGGTATGCTCAGTAACTCGATGCAC 
GATAACAACTACTTTGGAGACGAGTCCAGCATAATAGAGAACGAAGCAGCTGTTAAGTCG 
CCCAATGTTGTCAAGTTTGAAATTCAGGTAAATCCTCTTCTCCACTTCATGATACATATC 
GGTTTCCCGTACGACATTGTTTCTGATGTGTGATTTCGAGTGAAAGAAAGCTTTGTGTAT 
TAGTGTCCATGGCCATTTTTGTAACTGAATTAGAACTAGAGTGAATCTTCATGAATCTAA 
CTATCAATCAATATTTTCTGGGCTTGATGACGTTTGTTATTGTTGATGGTGAAACAGTTG 
TATAAAACTCGGGACGACAAGTATCTACTGGATTTGCAGAGAGTACAAGGTCCTCAGTTC 
TTGTTCTTGGATCTGTGTGCTGCTTTTCTTGCTCAGCTCCGAGTCCTCTGAATACTAAAC 
CGGACCTCTTCAAGAATAATCCCCACTTATTCCTTTTTTTTTTTTTTTCTTATTCGTCTA 
AGAAATTATTTAGAAAACGTAACCCTTTTTTTCTTCTTCTCTTTCTTTCTATTTCTATAT 
GCGTGCTCTACTCAAATACCTCTTTTAACTTAAATGTAAGACTGAGCAAGAGTAAAAAAA 
AGACACTTTGTACATAACTTGTAGTGCATCATGCCACCAAGATTGATTTTTGTTTTTGTT 
TACTCCA
>AT3G01090.3 |  AKIN10 (Arabidopsis SNF1 kinase homolog 10) protein binding / protein kinase 
GCTGCATTTTTTGGTTCCGAATTTTCTCCTCCGCCTTTTTTAATTTTTGGTAAGTTTCGA 
TATCTCTCAATTTTCTTATTTCGGAAATAAAAAAAATTCTCGCCCTTTTGCAAATCAATG 
GATTGATCTTGAAATCGTCATTTCTGAATCGGGTACGAGAGATCCAGTAATCCTCTGCGA 
TTGAATTATTATTAGGGTTCATATTCCGAATTGGGGATAGTCTGAAAATTGCTATTTTAA 
GCTCTCTTCTTAGTGTTGGTTGGTTTATTCTGGATAATAAAAGGGATCCTAATTCTCGCT 
AAATTCTCATGTTCAAACGAGTAGATGAGTTTAATTTAGTTTCTTCAACGATCGATCACA 
GAATCTTCAAAAGTGTAAAAATTACTTGCTTTTTGTTCCTATTACTCTTTTGCAGTTTGT 
TTTGTGTGTTGTGTACTAGTAGATCTAATATCTCTCTCTCTTTTTTTGTAGAGAATGGAT 
GGATCAGGCACAGGCAGTAGAAGTGGGGTAGAATCGATTCTACCAAATTACAAGCTTGGG 
AGAACTCTTGGTATTGGTTCCTTTGGTAGGGTGAAGATAGCTGAGCATGCATTGACAGGA 
CATAAGGTTGCTATCAAGATCCTCAATCGTCGCAAAATCAAGAACATGGAGATGGAGGAG 
AAAGGTACAAGTTTTGTTTTGTGTATCCATTCCACCTTAGTTGTGACTTCACGGTACTCT 
TGGAATATATAAATATATAGCTTCTTTTTCGTCTTCCTTCCTTTGAACTTATTTGGTCTT 
TGATGCAGTGAGGAGAGAGATCAAAATCTTGAGACTATTTATGCATCCTCACATCATCCG 
TCTCTATGAGGTTATAGAGACTCCCACAGATATTTATCTTGTCATGGAGTATGTGAACTC 
TGGTGAGCTATTTGACTATATTGTTGAGAAGGGTAGATTGCAGGAGGATGAGGCGAGGAA 
CTTTTTTCAGCAGGTATGTTTTTATTTTATTTTATCAACATGTAACTTTCCAAGCAACCA 
TTCGATTTTATATTATATTTGAGAGTTAAGAATTAGCTACTTGGCTTTGATGTAGATAAT 
ATCAGGAGTGGAATACTGCCATCGAAACATGGTGGTTCACAGAGACCTCAAGCCTGAAAA 
CTTGCTTTTGGACTCTAAATGCAATGTAAAGATTGCTGATTTTGGCCTGAGCAACATAAT 
GCGAGATGGTCATTTTTTGAAGACAAGTTGTGGAAGTCCAAATTATGCCGCTCCAGAGGT 
AAGTGCTTCAGCCCTCAGGTATCTGAGGAATACTATAATTAGGCTTGTTTCAAATGATAG 
GTTATAGTCGAGATCTATAAATTGTTTCAGGTAATTTCGGGCAAGTTATATGCTGGCCCT 
GAAGTAGATGTCTGGAGCTGTGGTGTGATACTCTACGCTCTTCTCTGTGGGACGCTTCCA 
TTTGATGATGAAAACATTCCCAACCTTTTTAAGAAGATAAAGGTACATTCTATTACTCCT 
CCTCTTTCGTCTATTTGAACTAATGCTTGAATTTTTTATTTTATTTTTCGTATCACCCTT 
CGACTGTAACCTTTTTTTTTTCTCTTTTCGTCCTATAGGGAGGGATATACACATTACCTA 
GCCATTTATCTCCTGGTGCTAGAGATTTGATCCCCCGGATGCTTGTAGTTGACCCCATGA 
AACGAGTAACCATCCCTGAGATCCGGCAACACCCTTGGTTCCAAGCTCATCTTCCGAGGT 
ATTTAGCTGTTCCTCCTCCAGATACTGTGCAACAGGCAAAAAAGGTAAGCCTAACGTATC 
TACTCTTATTTTCATTAGAGAAATCTCTATTCCCATTTTTCGATAAAGGCGTAAAAGCGC 
TGTCTTCATTTGTAGATTGACGAGGAGATTCTCCAAGAAGTTATCAATATGGGATTTGAC 
AGAAACCACCTCATCGAATCGCTCCGCAACCGAACCCAGAATGATGTATGTGTTTCCCAC 
CCACTTGTTCTTTTGCTGTTTCTTTCATTTCAAAGATTAAAAAAAATTCCATCAAAAGAT 
CTTAAATACTGTATTCTTACCGACTGTCTTCCAGGGCACTGTGACGTACTATCTGATACT 
GGACAATCGTTTCCGTGCCTCTAGTGGTTATCTCGGGGCTGAGTTTCAAGAGACCATGGT 
TAGTCTTTTTTGTCCTTTTCGACTTTAGCAAAAGATCTTTGACGTAATGCTTCATTGTTT 
GATTTAATCAGGAAGGTACTCCCCGTATGCATCCAGCAGAAAGCGTTGCTTCACCTGTTA 
GCCATCGGCTTCCAGGACTGATGGAATATCAAGGAGTTGGCTTGAGATCTCAATACCCTG 
TTGAGAGAAAATGGGCTCTTGGACTTCAGGTTTTGATATTTTCTGTATTTATGGTATAAA 
GACTTCAGCTTTTGATATATATGTGATTAATATTGTAACAATTTGATCGCACAGTCTCGG 
GCTCATCCCCGTGAAATAATGACGGAAGTCCTGAAAGCCCTGCAAGATTTGAATGTATGT 
TGGAAGAAGATAGGGCACTACAACATGAAGTGCAGATGGGTTCCTAACAGCAGCGCAGAT 
GGTATGCTCAGTAACTCGATGCACGATAACAACTACTTTGGAGACGAGTCCAGCATAATA 
GAGAACGAAGCAGCTGTTAAGTCGCCCAATGTTGTCAAGTTTGAAATTCAGGTAAATCCT 
CTTCTCCACTTCATGATACATATCGGTTTCCCGTACGACATTGTTTCTGATGTGTGATTT 
CGAGTGAAAGAAAGCTTTGTGTATTAGTGTCCATGGCCATTTTTGTAACTGAATTAGAAC 
TAGAGTGAATCTTCATGAATCTAACTATCAATCAATATTTTCTGGGCTTGATGACGTTTG 
TTATTGTTGATGGTGAAACAGTTGTATAAAACTCGGGACGACAAGTATCTACTGGATTTG 
CAGAGAGTACAAGGTCCTCAGTTCTTGTTCTTGGATCTGTGTGCTGCTTTTCTTGCTCAG 
CTCCGAGTCCTCTGAATACTAAACCGGACCTCTTCAAGAATAATCCCCACTTATTCCTTT 
TTTTTTTTTTTTCTTATTCGTCTAAGAAATTATTTAGAAAACGTAACCCTTTTTTTCTTC 
TTCTCTTTCTTTCTATTTCTATATGCGTGCTCTACTCAAATACCTCTTTTAACTTAAATG 
TAAGACTGAGCAAGAGTAAAAAAAAGACACTTTGTACATAACTTGTAGTGCATCATGCCA 
CCAAGATTGATTTTTGTTTTTGTTT
>AT3G01090.3 |  AKIN10 (Arabidopsis SNF1 kinase homolog 10) protein binding / protein kinase 
GCTGCATTTTTTGGTTCCGAATTTTCTCCTCCGCCTTTTTTAATTTTTGGTAAGTTTCGA 
TATCTCTCAATTTTCTTATTTCGGAAATAAAAAAAATTCTCGCCCTTTTGCAAATCAATG 
GATTGATCTTGAAATCGTCATTTCTGAATCGGGTACGAGAGATCCAGTAATCCTCTGCGA 
TTGAATTATTATTAGGGTTCATATTCCGAATTGGGGATAGTCTGAAAATTGCTATTTTAA 
GCTCTCTTCTTAGTGTTGGTTGGTTTATTCTGGATAATAAAAGGGATCCTAATTCTCGCT 
AAATTCTCATGTTCAAACGAGTAGATGAGTTTAATTTAGTTTCTTCAACGATCGATCACA 
GAATCTTCAAAAGTGTAAAAATTACTTGCTTTTTGTTCCTATTACTCTTTTGCAGTTTGT 
TTTGTGTGTTGTGTACTAGTAGATCTAATATCTCTCTCTCTTTTTTTGTAGAGAATGGAT 
GGATCAGGCACAGGCAGTAGAAGTGGGGTAGAATCGATTCTACCAAATTACAAGCTTGGG 
AGAACTCTTGGTATTGGTTCCTTTGGTAGGGTGAAGATAGCTGAGCATGCATTGACAGGA 
CATAAGGTTGCTATCAAGATCCTCAATCGTCGCAAAATCAAGAACATGGAGATGGAGGAG 
AAAGGTACAAGTTTTGTTTTGTGTATCCATTCCACCTTAGTTGTGACTTCACGGTACTCT 
TGGAATATATAAATATATAGCTTCTTTTTCGTCTTCCTTCCTTTGAACTTATTTGGTCTT 
TGATGCAGTGAGGAGAGAGATCAAAATCTTGAGACTATTTATGCATCCTCACATCATCCG 
TCTCTATGAGGTTATAGAGACTCCCACAGATATTTATCTTGTCATGGAGTATGTGAACTC 
TGGTGAGCTATTTGACTATATTGTTGAGAAGGGTAGATTGCAGGAGGATGAGGCGAGGAA 
CTTTTTTCAGCAGGTATGTTTTTATTTTATTTTATCAACATGTAACTTTCCAAGCAACCA 
TTCGATTTTATATTATATTTGAGAGTTAAGAATTAGCTACTTGGCTTTGATGTAGATAAT 
ATCAGGAGTGGAATACTGCCATCGAAACATGGTGGTTCACAGAGACCTCAAGCCTGAAAA 
CTTGCTTTTGGACTCTAAATGCAATGTAAAGATTGCTGATTTTGGCCTGAGCAACATAAT 
GCGAGATGGTCATTTTTTGAAGACAAGTTGTGGAAGTCCAAATTATGCCGCTCCAGAGGT 
AAGTGCTTCAGCCCTCAGGTATCTGAGGAATACTATAATTAGGCTTGTTTCAAATGATAG 
GTTATAGTCGAGATCTATAAATTGTTTCAGGTAATTTCGGGCAAGTTATATGCTGGCCCT 
GAAGTAGATGTCTGGAGCTGTGGTGTGATACTCTACGCTCTTCTCTGTGGGACGCTTCCA 
TTTGATGATGAAAACATTCCCAACCTTTTTAAGAAGATAAAGGTACATTCTATTACTCCT 
CCTCTTTCGTCTATTTGAACTAATGCTTGAATTTTTTATTTTATTTTTCGTATCACCCTT 
CGACTGTAACCTTTTTTTTTTCTCTTTTCGTCCTATAGGGAGGGATATACACATTACCTA 
GCCATTTATCTCCTGGTGCTAGAGATTTGATCCCCCGGATGCTTGTAGTTGACCCCATGA 
AACGAGTAACCATCCCTGAGATCCGGCAACACCCTTGGTTCCAAGCTCATCTTCCGAGGT 
ATTTAGCTGTTCCTCCTCCAGATACTGTGCAACAGGCAAAAAAGGTAAGCCTAACGTATC 
TACTCTTATTTTCATTAGAGAAATCTCTATTCCCATTTTTCGATAAAGGCGTAAAAGCGC 
TGTCTTCATTTGTAGATTGACGAGGAGATTCTCCAAGAAGTTATCAATATGGGATTTGAC 
AGAAACCACCTCATCGAATCGCTCCGCAACCGAACCCAGAATGATGTATGTGTTTCCCAC 
CCACTTGTTCTTTTGCTGTTTCTTTCATTTCAAAGATTAAAAAAAATTCCATCAAAAGAT 
CTTAAATACTGTATTCTTACCGACTGTCTTCCAGGGCACTGTGACGTACTATCTGATACT 
GGACAATCGTTTCCGTGCCTCTAGTGGTTATCTCGGGGCTGAGTTTCAAGAGACCATGGT 
TAGTCTTTTTTGTCCTTTTCGACTTTAGCAAAAGATCTTTGACGTAATGCTTCATTGTTT 
GATTTAATCAGGAAGGTACTCCCCGTATGCATCCAGCAGAAAGCGTTGCTTCACCTGTTA 
GCCATCGGCTTCCAGGACTGATGGAATATCAAGGAGTTGGCTTGAGATCTCAATACCCTG 
TTGAGAGAAAATGGGCTCTTGGACTTCAGGTTTTGATATTTTCTGTATTTATGGTATAAA 
GACTTCAGCTTTTGATATATATGTGATTAATATTGTAACAATTTGATCGCACAGTCTCGG 
GCTCATCCCCGTGAAATAATGACGGAAGTCCTGAAAGCCCTGCAAGATTTGAATGTATGT 
TGGAAGAAGATAGGGCACTACAACATGAAGTGCAGATGGGTTCCTAACAGCAGCGCAGAT 
GGTATGCTCAGTAACTCGATGCACGATAACAACTACTTTGGAGACGAGTCCAGCATAATA 
GAGAACGAAGCAGCTGTTAAGTCGCCCAATGTTGTCAAGTTTGAAATTCAGGTAAATCCT 
CTTCTCCACTTCATGATACATATCGGTTTCCCGTACGACATTGTTTCTGATGTGTGATTT 
CGAGTGAAAGAAAGCTTTGTGTATTAGTGTCCATGGCCATTTTTGTAACTGAATTAGAAC 
TAGAGTGAATCTTCATGAATCTAACTATCAATCAATATTTTCTGGGCTTGATGACGTTTG 
TTATTGTTGATGGTGAAACAGTTGTATAAAACTCGGGACGACAAGTATCTACTGGATTTG 
CAGAGAGTACAAGGTCCTCAGTTCTTGTTCTTGGATCTGTGTGCTGCTTTTCTTGCTCAG 
CTCCGAGTCCTCTGAATACTAAACCGGACCTCTTCAAGAATAATCCCCACTTATTCCTTT 
TTTTTTTTTTTTCTTATTCGTCTAAGAAATTATTTAGAAAACGTAACCCTTTTTTTCTTC 
TTCTCTTTCTTTCTATTTCTATATGCGTGCTCTACTCAAATACCTCTTTTAACTTAAATG 
TAAGACTGAGCAAGAGTAAAAAAAAGACACTTTGTACATAACTTGTAGTGCATCATGCCA 
CCAAGATTGATTTTTGTTTTTGTTT
>AT3G01090.3 |  AKIN10 (Arabidopsis SNF1 kinase homolog 10) protein binding / protein kinase 
GCTGCATTTTTTGGTTCCGAATTTTCTCCTCCGCCTTTTTTAATTTTTGGTAAGTTTCGA 
TATCTCTCAATTTTCTTATTTCGGAAATAAAAAAAATTCTCGCCCTTTTGCAAATCAATG 
GATTGATCTTGAAATCGTCATTTCTGAATCGGGTACGAGAGATCCAGTAATCCTCTGCGA 
TTGAATTATTATTAGGGTTCATATTCCGAATTGGGGATAGTCTGAAAATTGCTATTTTAA 
GCTCTCTTCTTAGTGTTGGTTGGTTTATTCTGGATAATAAAAGGGATCCTAATTCTCGCT 
AAATTCTCATGTTCAAACGAGTAGATGAGTTTAATTTAGTTTCTTCAACGATCGATCACA 
GAATCTTCAAAAGTGTAAAAATTACTTGCTTTTTGTTCCTATTACTCTTTTGCAGTTTGT 
TTTGTGTGTTGTGTACTAGTAGATCTAATATCTCTCTCTCTTTTTTTGTAGAGAATGGAT 
GGATCAGGCACAGGCAGTAGAAGTGGGGTAGAATCGATTCTACCAAATTACAAGCTTGGG 
AGAACTCTTGGTATTGGTTCCTTTGGTAGGGTGAAGATAGCTGAGCATGCATTGACAGGA 
CATAAGGTTGCTATCAAGATCCTCAATCGTCGCAAAATCAAGAACATGGAGATGGAGGAG 
AAAGGTACAAGTTTTGTTTTGTGTATCCATTCCACCTTAGTTGTGACTTCACGGTACTCT 
TGGAATATATAAATATATAGCTTCTTTTTCGTCTTCCTTCCTTTGAACTTATTTGGTCTT 
TGATGCAGTGAGGAGAGAGATCAAAATCTTGAGACTATTTATGCATCCTCACATCATCCG 
TCTCTATGAGGTTATAGAGACTCCCACAGATATTTATCTTGTCATGGAGTATGTGAACTC 
TGGTGAGCTATTTGACTATATTGTTGAGAAGGGTAGATTGCAGGAGGATGAGGCGAGGAA 
CTTTTTTCAGCAGGTATGTTTTTATTTTATTTTATCAACATGTAACTTTCCAAGCAACCA 
TTCGATTTTATATTATATTTGAGAGTTAAGAATTAGCTACTTGGCTTTGATGTAGATAAT 
ATCAGGAGTGGAATACTGCCATCGAAACATGGTGGTTCACAGAGACCTCAAGCCTGAAAA 
CTTGCTTTTGGACTCTAAATGCAATGTAAAGATTGCTGATTTTGGCCTGAGCAACATAAT 
GCGAGATGGTCATTTTTTGAAGACAAGTTGTGGAAGTCCAAATTATGCCGCTCCAGAGGT 
AAGTGCTTCAGCCCTCAGGTATCTGAGGAATACTATAATTAGGCTTGTTTCAAATGATAG 
GTTATAGTCGAGATCTATAAATTGTTTCAGGTAATTTCGGGCAAGTTATATGCTGGCCCT 
GAAGTAGATGTCTGGAGCTGTGGTGTGATACTCTACGCTCTTCTCTGTGGGACGCTTCCA 
TTTGATGATGAAAACATTCCCAACCTTTTTAAGAAGATAAAGGTACATTCTATTACTCCT 
CCTCTTTCGTCTATTTGAACTAATGCTTGAATTTTTTATTTTATTTTTCGTATCACCCTT 
CGACTGTAACCTTTTTTTTTTCTCTTTTCGTCCTATAGGGAGGGATATACACATTACCTA 
GCCATTTATCTCCTGGTGCTAGAGATTTGATCCCCCGGATGCTTGTAGTTGACCCCATGA 
AACGAGTAACCATCCCTGAGATCCGGCAACACCCTTGGTTCCAAGCTCATCTTCCGAGGT 
ATTTAGCTGTTCCTCCTCCAGATACTGTGCAACAGGCAAAAAAGGTAAGCCTAACGTATC 
TACTCTTATTTTCATTAGAGAAATCTCTATTCCCATTTTTCGATAAAGGCGTAAAAGCGC 
TGTCTTCATTTGTAGATTGACGAGGAGATTCTCCAAGAAGTTATCAATATGGGATTTGAC 
AGAAACCACCTCATCGAATCGCTCCGCAACCGAACCCAGAATGATGTATGTGTTTCCCAC 
CCACTTGTTCTTTTGCTGTTTCTTTCATTTCAAAGATTAAAAAAAATTCCATCAAAAGAT 
CTTAAATACTGTATTCTTACCGACTGTCTTCCAGGGCACTGTGACGTACTATCTGATACT 
GGACAATCGTTTCCGTGCCTCTAGTGGTTATCTCGGGGCTGAGTTTCAAGAGACCATGGT 
TAGTCTTTTTTGTCCTTTTCGACTTTAGCAAAAGATCTTTGACGTAATGCTTCATTGTTT 
GATTTAATCAGGAAGGTACTCCCCGTATGCATCCAGCAGAAAGCGTTGCTTCACCTGTTA 
GCCATCGGCTTCCAGGACTGATGGAATATCAAGGAGTTGGCTTGAGATCTCAATACCCTG 
TTGAGAGAAAATGGGCTCTTGGACTTCAGGTTTTGATATTTTCTGTATTTATGGTATAAA 
GACTTCAGCTTTTGATATATATGTGATTAATATTGTAACAATTTGATCGCACAGTCTCGG 
GCTCATCCCCGTGAAATAATGACGGAAGTCCTGAAAGCCCTGCAAGATTTGAATGTATGT 
TGGAAGAAGATAGGGCACTACAACATGAAGTGCAGATGGGTTCCTAACAGCAGCGCAGAT 
GGTATGCTCAGTAACTCGATGCACGATAACAACTACTTTGGAGACGAGTCCAGCATAATA 
GAGAACGAAGCAGCTGTTAAGTCGCCCAATGTTGTCAAGTTTGAAATTCAGGTAAATCCT 
CTTCTCCACTTCATGATACATATCGGTTTCCCGTACGACATTGTTTCTGATGTGTGATTT 
CGAGTGAAAGAAAGCTTTGTGTATTAGTGTCCATGGCCATTTTTGTAACTGAATTAGAAC 
TAGAGTGAATCTTCATGAATCTAACTATCAATCAATATTTTCTGGGCTTGATGACGTTTG 
TTATTGTTGATGGTGAAACAGTTGTATAAAACTCGGGACGACAAGTATCTACTGGATTTG 
CAGAGAGTACAAGGTCCTCAGTTCTTGTTCTTGGATCTGTGTGCTGCTTTTCTTGCTCAG 
CTCCGAGTCCTCTGAATACTAAACCGGACCTCTTCAAGAATAATCCCCACTTATTCCTTT 
TTTTTTTTTTTTCTTATTCGTCTAAGAAATTATTTAGAAAACGTAACCCTTTTTTTCTTC 
TTCTCTTTCTTTCTATTTCTATATGCGTGCTCTACTCAAATACCTCTTTTAACTTAAATG 
TAAGACTGAGCAAGAGTAAAAAAAAGACACTTTGTACATAACTTGTAGTGCATCATGCCA 
CCAAGATTGATTTTTGTTTTTGTTT
>AT3G01160.1 |  unknown protein 
AATCAGTCTAACGATGGGTTCAAAGAATAAGAAGCAAAGGAAAGGAGAGAGCATTGAAGA 
AGCTAAAGGATCCAGTGGAGTCGCAGAGGAAGGAAACGAAATGATTAAGGATCCAAGGTT 
TTCGTCGGCGCACACGGACCCTAAATTCCGTAGGATGCGGAGGCGTGACTCCAAAGTCGC 
CATTGACTCCAGATTCCAGCCTATGTTCAATGATAAGCGATTTGCCACTGGTTCTGCTCC 
TGTCGATAAGCGTGGCAAGCGTAGAACAGGAGGCACTGGCAAAGATTCGCTTCGAGAGTT 
TTATCGAATTGAAGATGAAGGTAAGCAGAAAACTGAGGAGGAATCTGGGGATGAGAGCGG 
GAGTGAGACAGAGATAAATGATTTGAAATCCGAAAAATCTAGCCATGTAGAATCTGAGGA 
AGAGAGTGAGAGTGAGCTAAAGGTTGCTTCTTTGGATGATGAATCTGATGAGAAAGCAGA 
CTCTGAAGAGTTATCCTCGCAGGAGGAGGAAGAAGAAGAGGATGATACAGATGAGGACGA 
TGAAGCTATGTATGAAGATGAGGGACCAGAAATTCCGGTAAATTGCTCAACTTTGATTCA 
TGTGCCTTGTTCTTCTACTAGTTTTTGACAAGTAATTGATTTTCTCATGTTGCAAATTTG 
GTGATGATGATGATGATGGCTTCTAGGAAGAGAACATACCGCTTATCCAAGAAGAAACTC 
ATAGACTGGCTATCGTTAACATGGATTGGAGACATGTCTCTGTAAGTTCTCTCAATCTAT 
GATGTTTTGTTTCAATTTGGCCTTCTTTGACGTTAATATCTTTGCTATGGTTATGGAACG 
AATCTAAGATTAAGTAGAGCTTGTTTCTTTCTCTGCCTTGTCTAGACTCTAGAGTCACTG 
CTCTGTGATTTTTGGAGTTGTTCTTATGGATGATATCTTATTTTGTTACTTAGGCTAAAG 
ACTTGTACGTAGTGTTGAATTCGTTTCTGCCAAAAGATGGGCGCATTTTGTCAGTTGCGG 
TCTATCCATCTGAGTTCGGACTTGAGCGAATGAAAGAGGAGGAAATCCATGGGCCGGTAA 
TTGATGGCGACAAAAAGAATGACGCTAGTGATGATGAAGATGAAGAAGAGGAGGAAGATG 
AGGATGTCATCAACCAGAAGCTACGTGCCTATGAAATAAGTAGATTAAAGTAAGTTCGAA 
TCTGCCCGTCTTAAGCTATATGTGGTGGAGAGGGACTATTACTGAAACTCTGCTTTTACT 
ATTGCTTCAGGTATTATTTCGCTGTTGCCGAATGTGATTCAAGTGCTACTGCAGATTACT 
TGTACAAATCATGTGATGGAATTGAGTTTGAGAGATCATCAAACAAGCTCGACCTAAGAT 
TTATTCCGGATTCCATGGAATTCAAACATCCACCTCGTGATATTGCATCTGAGGTGTGTT 
ACCGCTACTTCCTTTTACTTGAGATCTTTTGGTTTCATTGTGAATACTTGTGATCTTATA 
GTTGTTATAAAAATATAGGCACCAGCTGGTTATGAAGGTTTAGATTTTCAGAGCCGAGCT 
CTGCAGATGAGCAAAGTTAATCTTTCTTGGGATGAAGATGAACCGCACCGGATTAAGACC 
TTAAATCAGAAATTCAATCCTGAACAGGTCTGTATACGGGTTTATAATTTATGTGATTAG 
GCTTAATTGCTTGCTTAAAAGCATCTCCATTGTTGTAGTGTTATTGTTCTGATAAAATTT 
TCTCAAATCATAGTTGGCAAATCTTGAGATGAAGGAGTTTTTAGCTTCTGATGAGAGTGA 
TTCTGATGAGGAAGACGACTTGGGCAATGAAGTTATTAACCAGAGTAAAAAAAAGGACAA 
GAAGAAAGATAAGTACCGAGCTTTAATAGAAGCCGAAGATGTTGATTCTGATAAAGACCT 
GGAGGAGGAGAATGACCAGGATATGGAGGTAACATTCAATACCGGTTTAGAAGATCTTAG 
CAAAGAGATTCTTAAAAAGAAAGACAACCAGTCAGAATCGGTGTGGGAAACATATCTAAG 
GCAGAGACGCGAGAAGAAGAGAGCCAGGAAGAATAAACAGAAGGATGATGATTCTTCTCC 
GGATGATGACGACGATTATAACATTGATAGAAAGGCAGTGAAAGATGATGGAGATGACGA 
TTTCTTTATGGAGGAACCTCCTCTTAAGAAGAAGAAGAAAGAAGGAAAGACAAAGAAGGA 
GGAAGTAGCAGCGGAAGAAAAAAGTAGAGCGGAGCTTGAGTTGTTACTAGCTGATGAGAA 
TGCAGGAGATGGTAATGGTCTGAAAGGGTATAATATTAAACGGAAAGCTAAAAAAGGAAA 
GACTGATATTTCGGAAGACAAGATACCTGCTGCTGAACTTGATGATCCGAGATTCTCAGC 
TCTATTCTCGTCTCCTTACTATGCCCTAGACCCTACGGATCCACAGTTTAAAAGGTACAT 
TGATGAATATTTGAATTTTTCTGAGAAGTGGAATTGCGAAAGTTTAAGAATTTTGGGGGA 
TATTTGTTTTGCAGGAGTGCGACTTATGCAAGGCAATTAGCTTTGAAGCAAAAGGAAGAT 
CCAAAAGGCCACGAGGATGTGAAAGCGCCAAAGGAGAAACAGGAGTTGAATTCAGATGGT 
AACTTGGGGTCTAAGAAGGAGAGACACGAACTGACTTCTACTGTCAAATCTTTGAAGATG 
AAGATGATGAACAAGGATTCTGAGAAGAAAAAAGCGGGAAATCCAGCGTCTTCATCGACT 
TTGGCTCAGCGAATTAAGAAGAAAGCCAAAGATTTATCCAAGAAATAATAATGTCTTTGT 
TTCCTTCTTCAAATCAATTTTGTTTTAAATTTAAAATTCTGAATTAATAACAATTTCAAC 
CTATATTGTACCCTTTCAAATCTGTTTATGTTTCATTTTGAG
>AT3G14100.1 |  oligouridylate-binding protein putative 
CATCTCGTGAACGATATAGTACCTGAACCCTAGCGGAGGAAAATCAAAAATTGTCTAGGA 
GAAACAAACAGAGATATCTTTCTTTCTTTTTATCAGTGGGGAAAAAAAATGCAGAATCCG 
AGACTGAAGCAACATCAGCAGCAACAACAACAACAAGCTATGATGCAGCAACAAGCTCTG 
ATGCAGCAACACTCTCTTTACCATCCTGGTGTTTTGGCTCCTCCTCAGGTTTTTATTTTA 
CCTTTATTACATCTTCGATGTGTCTAATTTTGGTCGAAATTGGATTTTTTTTTTTTTGTA 
CTGTCGTCTCTTTCGTGAGTCCTTTTATTCCGGGTCGGGTTTAGTTTGTGTTCTTCATTT 
GAAGATAATTTTTGTTCATATTCTGTGTTTCTTTTTCTCATTTGATTGAATGGATGGCTA 
GGGTTTCCAGATCCTGTAGGCTAGCAATTCGTTCCTTTTATCTGTTGTGATGTCTTTGTG 
TTTTAGTTTTGTTGCGTCATTACCAAATTGAGCTGATATTTACCTTCTCGTGCTTTTCTA 
ATGGGGATAGAAAAGAAATTGCAATCCTTTTCATTTTCTTTCTTTCTTACTTTTGGCAAT 
TGCAGTTAGAGCCTGTTCCAAGTGGAAACCTTCCTCCTGGTTTTGATCCCAGTACTTGCC 
GTAGCGTGTGAGTGAATTTTTTTAGCATCGCTTTGTCTGAAAGGTGCAGTTCCGAGTTTA 
TGTTTTAACTTCTCCAATTATTCTAATATTGGCAGGTATGTTGGAAACATCCATACACAG 
GTCACAGAGCCTTTGCTTCAAGAGATTTTTACAAGCACTGGCCCTGTTGAAAGCAGTAAA 
CTCATCAGAAAGGATAAGGTAGTTAGATTCTAAAATCCACCTGATTTCTACTTTATTGTG 
AAAGTGACCCTCTTATATAGTAGCTTTCTTGTTTTGGACGAGCATACCTCAACAATTGCA 
CATTTTTAATACTTTAAGGAAACTACTCTACTTGCTGCTTACTAAAAATGGACTCATAAA 
GCATGCATCTTTTTATTTATTTGCAGTCATCATATGGATTTGTTCACTACTTTGATCGAA 
GATCCGCTGCTCTGGCTATACTGTCTCTGAACGGAAGGCATCTGTAAGGAACAATTTTCA 
TAGTTTCCTTCCTCTCCTCTTCTTATCGTTCGAATGCTTTTGTTTAGGTTATAATCGTCG 
AGTTTACAGGTTTGGACAGCCTATCAAAGTCAATTGGGCGTATGCCACTGGTCAGAGGGA 
AGATACATCAAGTAAGTTTTGACTTTTTTTAAGTGTTGCATTTTGTTTGTATGTTTTTGA 
GGATACTCAATGTTTTAGTTTCCATGAGTTGCAGGTCATTTCAACATTTTTGTTGGAGAT 
CTCAGTCCAGAGGTCACTGATGCAACATTATATCAAAGCTTTTCTGTCTTTTCCAGTTGT 
TCGTAAGTTCTGTTGCTTGATCAGCTCCTTTTAACTAACTTATTCTACTTGGTTGTAAAA 
CAAATATCATAATCTCTGACTGTGTCTAATATTTTGAAGGGATGCGAGAGTTATGTGGGA 
CCAAAAAACTGGGCGCTCGAGAGGCTTTGGGTTTGTTTCCTTCCGCAATCAACAGGTAAT 
GTACATTCTTTAAATCATGCAGTGAGTTTTTGTTTTAGCTCAAGGATTGTTCGTGGTTTA 
CATTAATGTTAAATGTTGATTTCATTTGCAGGATGCTCAAACTGCCATTAATGAGATGAA 
TGGTAAGGATTATATAGTAGCTGAGATCTCAGTACTTCGTTCTCATGCTTTCTTGTTCTG 
AAGTGCTTAGAATTTGCATGCAACTGAATGATACTGTGCCTAGAAAGACCTGCTGAAAGT 
TTTCTTGATTTGTTAGTCAAGAGCTGCTGAAAGTTGCATAACTTCTGTTTCAGTGTCATC 
TAAAATTGAGGTTTTCTCTTTATTCTTAGCAATTAATCTTTGTTTCTATCACATCTTCTC 
AGGTAAGTGGTTAAGTAGCAGACAAATCAGATGCAACTGGGCCACGAAGGGCGCTACTTC 
TGGTGATGATAAGCTCAGTTCTGATGGAAAAAGTGTTGTGGAACTTACAACTGGCTCATC 
AGGTTGTCTTTCTATTACTGTGCAAATTCTTATGTTTTTTTCTCCTTCTCCTCAAATGGA 
ATTTACGAACCTACATTGATTTTCCCTGAGTAATATGAAAAACTTTAAGTTAACAAAGCC 
ATATTGGTCGTTTGATTGTGCAGAGGATGGTAAAGAGACATTAAATGAGGAAACACCTGA 
AAATAATTCTCAGTTTACCACTGTTTATGTGGGAAACCTTGCTCCAGAGGTACATTATCC 
ACTAGGAAGTGCTCCTTGTAATACTATCACAACAAAAACAGTTTATTTGAGGTTCTTTGA 
TGAAGTTTTACATTAGTAGATTTCGGGTACATCGTTACAGCTATCTATCTTGCAGGTAAC 
TCAGCTTGATCTACACCGTTACTTCCATGCTCTTGGCGCTGGAGTTATTGAGGAGGTCCG 
TGTCCAACGAGACAAAGGCTTTGGTTTCGTGAGATATAACACTCATCCCGAAGCTGCTCT 
TGCTATTCAGATGGGTAACACTCAGCCTTACCTCTTTAACAGACAGATAAAGGTACTTTT 
AAGTTTGGCTTACCACTCTAAACCCTCTCTATTTGATCTTACTGCTCCCAAAAGTTACTT 
CATCTGAAACTTAGCATGCAATCTGACATTTGTTATCATGTTAATTGTAGTGCTCATGGG 
GAAACAAGCCAACTCCACCAGGTACAGCCTCAAACCCACTTCCCCCACCTGCCCCAGCTC 
CAGTTCCTGGTCTATCTGCAGCTGATCTCCTAAACTATGAGAGGCAATTGGCACTTAGCA 
AGATGGCAAGTGTGAATGCGTTAATGCATCAACAGGGTCAACACCCTCTAAGGCAGGCTC 
ATGGAATAAATGCCGCTGGAGCAACTGCAGCCATGTATGATGGTGGCTTTCAGAATGTAG 
CCGCCGCACAGCAACTCATGTACTATCAGTAATAAACCTCAGTTCGTGGCGCCGATCTCA 
AGTTTCAATCTCTTTGCTTTTTCTCTTTTTTTTTTGTTTGTCTAGAACTTGTTTGTGTGT 
GTCTGTTTGTCTCTCACTTAAGTTATCTATATAAAGTTTTATCTGCAGTTGTATGATTAG 
TTATGTATTCCCATGGATTGTAAGACAAGCGAATTACATTCAATAAAAGGGATTTGGATA 
TCCA
>AT3G56510.1 |  TBP-binding protein putative 
ACACCACCGTCTTCTTCTTCTTCCGAACGGAGAGTACTAGTTGTTCGCCGACGGCACTAG 
CTTCTTTTTCTTTCTCACTTTCGGTAAAGTTTCCTGTTTTCCTTCAGAAACGAAGACAAA 
AAAGTAGAGATTTTTATGAAGATTCATTTTTTTTTTCATTAAATTTAGTGCGCTTTCATC 
TGCAAAACGTCGATTAAAGGGAGGTCCAGGAATTGAAATTTGTTGATTCGTGTGTCTAGG 
GTTTAAGGGTCCCTTTCATCTGCAAGTTACGAATTGCAAGTCCACACGTTTATGCAATTG 
TTGGTGTTAGTCCTATAATTTCAATGTAGCTAGAACTTTTGTAGATATGATAAAAGTTCA 
GACTTTTGTTCATTAGTCAGTTGAAAAATTGTTTTCTGTGATGGATTCAGCAGCTGCTGA 
AGAAGATGCAGAGTGAGGAATCTCACGAGCTTACGGATGGAATATCCGAGGAGAAGGAGT 
CCAAGGAAACGATGAAGAGTCAAAAGGCTGATAGAAAGAAAAAGAAGTTGAAAGAGAAAT 
TGCTTAAGGAAGCTTCGAAAGCTGACAATAGAGGTGTTTGCTACTTAAGTCGTATCCCAC 
CACACATGGATCACGTTAGACTTCGCCATATTCTCGCTCAATATGGAGAACTCGGAAGGA 
TTTATCTTGCACCTGAAGGTGAGGTTTTTTATCCTATCGAGTCCTCGTTTAATGTCAAAA 
GCACATCTTGGTCATATTAATGTGTTTCTGTATTGAAAAGTTAGCTGATACATTTGTCTA 
TTGCTATTCAGATTCTGAAGCACAAGTGCACCGTAAGCGGGCTGGTGGATTTCGTGGCCA 
AAGGTTTTCTGAAGGGTACGCTTAAGGATATGTGTTTCCCCCGCTAGTTATTGGCTTTTC 
CCTTGTCTGTTTGTTGTGTTCAAAACACTTCTCCACATTGATAATTTGGATTCTTTTAAT 
AATAGTTTTCGATATATTATTCTGTTCATTAACTGCAGGTGGGTGGAGTTTGCTAAGAAG 
AGCGTAGCTAAACGGGTTGCAGATATGCTAAATGGAGAACAAATCGGTATTCCTAATGAA 
TCATATCAGTATGCATAGTCGACAGGTTAAATCTATAAGCTTATATGATTGTTAATGTTT 
GCTGTTTTCTTTCCTCAGGGGGGAAAAAGAAGTCATCAGTATACTATGATATTTGGAACA 
TCAAATACTTGACCAAATTTAAATGGGATGATCTTACTGAAGAAATCGGTATTGTTAACC 
GCACAATATCTCTGCTGAAATTCTTGACAATTTTCTATGATATGATCTCTAATCTACAAA 
GGGATTGCTTTGTGCAGCATACAAAAGTGCAATACGGGAACAGAAATTAAATATGGTTCT 
TTCTGCTGCAAAGAGGGAGAAAGACTTTTATCTATCTAAAATAGAGAAGTCTCGTGCCAT 
GACCGAGATAGATGCACGAATGGAAAAGGTGCTCACACTTTCTAATATTGTAAATTCAGA 
AGTACTCTATCTTACTTGTTCGATGTCTGCTTGTCTGAAATTTATAGCTTGTGATCTTTT 
TATAAACTATAAATCCATTAAGTAAATGCTAACTTTTAGAGTTGGATAATAGGCCTTCTT 
GTTTGGAGGAATTCAATTCTTCGTTTCTCCCTTTGTAAATCTCACTACTCTAACCAGATG 
TTTGGTTTGTATTCTTCTGTATTTGCGGTGGGCAGAAACGAAAGATTCAAGAAGAATCGG 
GTAGCAATGCTGAAGCAGCACCAGTCTTTCCACCTAGGGCGATTTTCCAGTTTAGACAGA 
AGAAATCAATTGAAAATGAGACATCTCAAAGCAAGCCTGGGCTCTCCACTGATTTCCTAG 
CATCGGTCAGTACTTTTTTCTTTTATCTTTGAAGAACCAAGAAGATTTTTTATTAGAATT 
AGAAGCATCACAGGTCGTCTAGATAACAACATATATAGTAGCTGCTTAGCTGGGGTAGAT 
GAATGTCTTAAACCTGAATCGTATTCACATTATAACCTGGTGAACTATTGCATTGCTAGT 
CCAACTTGAGTTCGTAGACCTCGTTAGTATTCGTATTGGCTCTTATGCATAATCAATCGG 
TTATATCTTATGCTTAAATGATTATTAATGTCTGCTGGTTAGACTCGTATAGTTAGTATC 
TGTGTTCAGCTTTTCAACGCAAATATATCATATATGACCTCCGTATCGTATTGGCTGTTC 
CGGTTTAGAATGACTCATTTACATGCATATGTTATCAAATTTATGGTTTTGTTTATATTC 
TTTTTTCTGATTCAGGTATTTGGCGGTTCTTAAGGTTAAGAGGCATGTGACGTTGCGAAT 
TGATCATAGCTTGATGGAGAAATCAATGAGCAATTCCATTATGTATGAATGTCAATTAGT 
TTCTGCAACTCAACAGAGAAAATATTCACATACACTTAGCAATTTGTATACTTTTGTGTT 
CTCCTTATAAGGTTAGCTATATACTATTGTCAAGAAACATATATGTGAAATTTCCACCAC 
CAAAAAAAAAAAAGATTTAAAAGTGCATCAACATACACATAAGCACATGTTTTATATGAA 
CACATGGATACCAAATGGATTCATCACATGGATAGGAAAAAACAATCTTCTAGACAATCA 
GGACGGCACCATACTGGTTTTGTGAATAACGAAAGAGAGACTATGTGACATTATTGGTCA 
CCGAGACGACGAGAAGAAAGCAAGGGCTTTGGG
>AT3G56510.1 |  TBP-binding protein putative 
ACACCACCGTCTTCTTCTTCTTCCGAACGGAGAGTACTAGTTGTTCGCCGACGGCACTAG 
CTTCTTTTTCTTTCTCACTTTCGGTAAAGTTTCCTGTTTTCCTTCAGAAACGAAGACAAA 
AAAGTAGAGATTTTTATGAAGATTCATTTTTTTTTTCATTAAATTTAGTGCGCTTTCATC 
TGCAAAACGTCGATTAAAGGGAGGTCCAGGAATTGAAATTTGTTGATTCGTGTGTCTAGG 
GTTTAAGGGTCCCTTTCATCTGCAAGTTACGAATTGCAAGTCCACACGTTTATGCAATTG 
TTGGTGTTAGTCCTATAATTTCAATGTAGCTAGAACTTTTGTAGATATGATAAAAGTTCA 
GACTTTTGTTCATTAGTCAGTTGAAAAATTGTTTTCTGTGATGGATTCAGCAGCTGCTGA 
AGAAGATGCAGAGTGAGGAATCTCACGAGCTTACGGATGGAATATCCGAGGAGAAGGAGT 
CCAAGGAAACGATGAAGAGTCAAAAGGCTGATAGAAAGAAAAAGAAGTTGAAAGAGAAAT 
TGCTTAAGGAAGCTTCGAAAGCTGACAATAGAGGTGTTTGCTACTTAAGTCGTATCCCAC 
CACACATGGATCACGTTAGACTTCGCCATATTCTCGCTCAATATGGAGAACTCGGAAGGA 
TTTATCTTGCACCTGAAGGTGAGGTTTTTTATCCTATCGAGTCCTCGTTTAATGTCAAAA 
GCACATCTTGGTCATATTAATGTGTTTCTGTATTGAAAAGTTAGCTGATACATTTGTCTA 
TTGCTATTCAGATTCTGAAGCACAAGTGCACCGTAAGCGGGCTGGTGGATTTCGTGGCCA 
AAGGTTTTCTGAAGGGTACGCTTAAGGATATGTGTTTCCCCCGCTAGTTATTGGCTTTTC 
CCTTGTCTGTTTGTTGTGTTCAAAACACTTCTCCACATTGATAATTTGGATTCTTTTAAT 
AATAGTTTTCGATATATTATTCTGTTCATTAACTGCAGGTGGGTGGAGTTTGCTAAGAAG 
AGCGTAGCTAAACGGGTTGCAGATATGCTAAATGGAGAACAAATCGGTATTCCTAATGAA 
TCATATCAGTATGCATAGTCGACAGGTTAAATCTATAAGCTTATATGATTGTTAATGTTT 
GCTGTTTTCTTTCCTCAGGGGGGAAAAAGAAGTCATCAGTATACTATGATATTTGGAACA 
TCAAATACTTGACCAAATTTAAATGGGATGATCTTACTGAAGAAATCGGTATTGTTAACC 
GCACAATATCTCTGCTGAAATTCTTGACAATTTTCTATGATATGATCTCTAATCTACAAA 
GGGATTGCTTTGTGCAGCATACAAAAGTGCAATACGGGAACAGAAATTAAATATGGTTCT 
TTCTGCTGCAAAGAGGGAGAAAGACTTTTATCTATCTAAAATAGAGAAGTCTCGTGCCAT 
GACCGAGATAGATGCACGAATGGAAAAGGTGCTCACACTTTCTAATATTGTAAATTCAGA 
AGTACTCTATCTTACTTGTTCGATGTCTGCTTGTCTGAAATTTATAGCTTGTGATCTTTT 
TATAAACTATAAATCCATTAAGTAAATGCTAACTTTTAGAGTTGGATAATAGGCCTTCTT 
GTTTGGAGGAATTCAATTCTTCGTTTCTCCCTTTGTAAATCTCACTACTCTAACCAGATG 
TTTGGTTTGTATTCTTCTGTATTTGCGGTGGGCAGAAACGAAAGATTCAAGAAGAATCGG 
GTAGCAATGCTGAAGCAGCACCAGTCTTTCCACCTAGGGCGATTTTCCAGTTTAGACAGA 
AGAAATCAATTGAAAATGAGACATCTCAAAGCAAGCCTGGGCTCTCCACTGATTTCCTAG 
CATCGGTCAGTACTTTTTTCTTTTATCTTTGAAGAACCAAGAAGATTTTTTATTAGAATT 
AGAAGCATCACAGGTCGTCTAGATAACAACATATATAGTAGCTGCTTAGCTGGGGTAGAT 
GAATGTCTTAAACCTGAATCGTATTCACATTATAACCTGGTGAACTATTGCATTGCTAGT 
CCAACTTGAGTTCGTAGACCTCGTTAGTATTCGTATTGGCTCTTATGCATAATCAATCGG 
TTATATCTTATGCTTAAATGATTATTAATGTCTGCTGGTTAGACTCGTATAGTTAGTATC 
TGTGTTCAGCTTTTCAACGCAAATATATCATATATGACCTCCGTATCGTATTGGCTGTTC 
CGGTTTAGAATGACTCATTTACATGCATATGTTATCAAATTTATGGTTTTGTTTATATTC 
TTTTTTCTGATTCAGGTATTTGGCGGTTCTTAAGGTTAAGAGGCATGTGACGTTGCGAAT 
TGATCATAGCTTGATGGAGAAATCAATGAGCAATTCCATTATGTATGAATGTCAATTAGT 
TTCTGCAACTCAACAGAGAAAATATTCACATACACTTAGCAATTTGTATACTTTTGTGTT 
CTCCTTATAAGGTTAGCTATATACTATTGTCAAGAAACATATATGTGAAATTTCCACCAC 
CAAAAAAAAAAAAGATTTAAAAGTGCATCAACATACACATAAGCACATGTTTTATATGAA 
CACATGGATACCAAATGGATTCATCACATGGATAGGAAAAAACAATCTTCTAGACAATCA 
GGACGGCACCATACTGGTTTTGTGAATAACGAAAGAGAGACTATGTGACATTATTGGTCA 
CCGAGACGACGAGAAGAAAGCAAGGGCTTTGGG
>AT3G56510.2 |  TBP-binding protein putative 
CACACCACCGTCTTCTTCTTCTTCCGAACGGAGAGTACTAGTTGTTCGCCGACGGCACTA 
GCTTCTTTTTCTTTCTCACTTTCGGTAAAGTTTCCTGTTTTCCTTCAGAAACGAAGACAA 
AAAAGTAGAGATTTTTATGAAGATTCATTTTTTTTTTCATTAAATTTAGTGCGCTTTCAT 
CTGCAAAACGTCGATTAAAGGGAGGTCCAGGAATTGAAATTTGTTGATTCGTGTGTCTAG 
GGTTTAAGGGTCCCTTTCATCTGCAAGTTACGAATTGCAAGTCCACACGTTTATGCAATT 
GTTGGTGTTAGTCCTATAATTTCAATGTAGCTAGAACTTTTGTAGATATGATAAAAGTTC 
AGACTTTTGTTCATTAGTCAGTTGAAAAATTGTTTTCTGTGATGGATTCAGCAGCTGCTG 
AAGAAGATGCAGAGTGAGGAATCTCACGAGCTTACGGATGGAATATCCGAGGAGAAGGAG 
TCCAAGGAAACGATGAAGAGTCAAAAGGCTGATAGAAAGAAAAAGAAGTTGAAAGAGAAA 
TTGCTTAAGGAAGCTTCGAAAGCTGACAATAGAGGTGTTTGCTACTTAAGTCGTATCCCA 
CCACACATGGATCACGTTAGACTTCGCCATATTCTCGCTCAATATGGAGAACTCGGAAGG 
ATTTATCTTGCACCTGAAGGTGAGGTTTTTTATCCTATCGAGTCCTCGTTTAATGTCAAA 
AGCACATCTTGGTCATATTAATGTGTTTCTGTATTGAAAAGTTAGCTGATACATTTGTCT 
ATTGCTATTCAGATTCTGAAGCACAAGTGCACCGTAAGCGGGCTGGTGGATTTCGTGGCC 
AAAGGTTTTCTGAAGGGTACGCTTAAGGATATGTGTTTCCCCCGCTAGTTATTGGCTTTT 
CCCTTGTCTGTTTGTTGTGTTCAAAACACTTCTCCACATTGATAATTTGGATTCTTTTAA 
TAATAGTTTTCGATATATTATTCTGTTCATTAACTGCAGGTGGGTGGAGTTTGCTAAGAA 
GAGCGTAGCTAAACGGGTTGCAGATATGCTAAATGGAGAACAAATCGGTATTCCTAATGA 
ATCATATCAGTATGCATAGTCGACAGGTTAAATCTATAAGCTTATATGATTGTTAATGTT 
TGCTGTTTTCTTTCCTCAGGGGGGAAAAAGAAGTCATCAGTATACTATGATATTTGGAAC 
ATCAAATACTTGACCAAATTTAAATGGGATGATCTTACTGAAGAAATCGGTATTGTTAAC 
CGCACAATATCTCTGCTGAAATTCTTGACAATTTTCTATGATATGATCTCTAATCTACAA 
AGGGATTGCTTTGTGCAGCATACAAAAGTGCAATACGGGAACAGAAATTAAATATGGTTC 
TTTCTGCTGCAAAGAGGGAGAAAGACTTTTATCTATCTAAAATAGAGAAGTCTCGTGCCA 
TGACCGAGATAGATGCACGAATGGAAAAGGTGCTCACACTTTCTAATATTGTAAATTCAG 
AAGTACTCTATCTTACTTGTTCGATGTCTGCTTGTCTGAAATTTATAGCTTGTGATCTTT 
TTATAAACTATAAATCCATTAAGTAAATGCTAACTTTTAGAGTTGGATAATAGGCCTTCT 
TGTTTGGAGGAATTCAATTCTTCGTTTCTCCCTTTGTAAATCTCACTACTCTAACCAGAT 
GTTTGGTTTGTATTCTTCTGTATTTGCGGTGGGCAGAAACGAAAGATTCAAGAAGAATCG 
GGTAGCAATGCTGAAGCAGCACCAGTCTTTCCACCTAGGGCGATTTTCCAGTTTAGACAG 
AAGAAATCAATTGAAAATGAGACATCTCAAAGCAAGCCTGGGCTCTCCACTGATTTCCTA 
GCATCGGTCAGTACTTTTTTCTTTTATCTTTGAAGAACCAAGAAGATTTTTTATTAGAAT 
TAGAAGCATCACAGGTCGTCTAGATAACAACATATATAGTAGCTGCTTAGCTGGGGTAGA 
TGAATGTCTTAAACCTGAATCGTATTCACATTATAACCTGGTGAACTATTGCATTGCTAG 
TCCAACTTGAGTTCGTAGACCTCGTTAGTATTCGTATTGGCTCTTATGCATAATCAATCG 
GTTATATCTTATGCTTAAATGATTATTAATGTCTGCTGGTTAGACTCGTATAGTTAGTAT 
CTGTGTTCAGCTTTTCAACGCAAATATATCATATATGACCTCCGTATCGTATTGGCTGTT 
CCGGTTTAGAATGACTCATTTACATGCATATGTTATCAAATTTATGGTTTTGTTTATATT 
CTTTTTTCTGATTCAGGTATTTGGCGGTTCTTAAGGTTAAGAGGCATGTGACGTTGCGAA 
TTGATCATAGCTTGATGGAGAAATCAATGAGCAATTCCATTATGTATGAATGTCAATTAG 
TTTCTGCAACTCAACAGAGAAAATATTCACATACACTTAGCAATTTGTATACTTTTGTGT 
TCTCCTTATAAGGTTAGCTATATACTATTGTCAAGAAACATATATGTGAAATTTCCACCA 
CCAAAAAAAAAAAAGATTTAAAAGTGCATCAACATACACATAAGCACATGTTTTATATGA 
ACACATGGATACCAAATGGATTCATCACATGGATAGGAAAAAACAATCTTCTAGACAATC 
AGGACGGCACCATACTGGTTTTGTGAATAACGAAAGAGAGACTATGTGACATTATTGGTC 
ACCGAGACGACGAGAAGAAAGCAAGGGCTTTGGG
>AT3G56510.2 |  TBP-binding protein putative 
CACACCACCGTCTTCTTCTTCTTCCGAACGGAGAGTACTAGTTGTTCGCCGACGGCACTA 
GCTTCTTTTTCTTTCTCACTTTCGGTAAAGTTTCCTGTTTTCCTTCAGAAACGAAGACAA 
AAAAGTAGAGATTTTTATGAAGATTCATTTTTTTTTTCATTAAATTTAGTGCGCTTTCAT 
CTGCAAAACGTCGATTAAAGGGAGGTCCAGGAATTGAAATTTGTTGATTCGTGTGTCTAG 
GGTTTAAGGGTCCCTTTCATCTGCAAGTTACGAATTGCAAGTCCACACGTTTATGCAATT 
GTTGGTGTTAGTCCTATAATTTCAATGTAGCTAGAACTTTTGTAGATATGATAAAAGTTC 
AGACTTTTGTTCATTAGTCAGTTGAAAAATTGTTTTCTGTGATGGATTCAGCAGCTGCTG 
AAGAAGATGCAGAGTGAGGAATCTCACGAGCTTACGGATGGAATATCCGAGGAGAAGGAG 
TCCAAGGAAACGATGAAGAGTCAAAAGGCTGATAGAAAGAAAAAGAAGTTGAAAGAGAAA 
TTGCTTAAGGAAGCTTCGAAAGCTGACAATAGAGGTGTTTGCTACTTAAGTCGTATCCCA 
CCACACATGGATCACGTTAGACTTCGCCATATTCTCGCTCAATATGGAGAACTCGGAAGG 
ATTTATCTTGCACCTGAAGGTGAGGTTTTTTATCCTATCGAGTCCTCGTTTAATGTCAAA 
AGCACATCTTGGTCATATTAATGTGTTTCTGTATTGAAAAGTTAGCTGATACATTTGTCT 
ATTGCTATTCAGATTCTGAAGCACAAGTGCACCGTAAGCGGGCTGGTGGATTTCGTGGCC 
AAAGGTTTTCTGAAGGGTACGCTTAAGGATATGTGTTTCCCCCGCTAGTTATTGGCTTTT 
CCCTTGTCTGTTTGTTGTGTTCAAAACACTTCTCCACATTGATAATTTGGATTCTTTTAA 
TAATAGTTTTCGATATATTATTCTGTTCATTAACTGCAGGTGGGTGGAGTTTGCTAAGAA 
GAGCGTAGCTAAACGGGTTGCAGATATGCTAAATGGAGAACAAATCGGTATTCCTAATGA 
ATCATATCAGTATGCATAGTCGACAGGTTAAATCTATAAGCTTATATGATTGTTAATGTT 
TGCTGTTTTCTTTCCTCAGGGGGGAAAAAGAAGTCATCAGTATACTATGATATTTGGAAC 
ATCAAATACTTGACCAAATTTAAATGGGATGATCTTACTGAAGAAATCGGTATTGTTAAC 
CGCACAATATCTCTGCTGAAATTCTTGACAATTTTCTATGATATGATCTCTAATCTACAA 
AGGGATTGCTTTGTGCAGCATACAAAAGTGCAATACGGGAACAGAAATTAAATATGGTTC 
TTTCTGCTGCAAAGAGGGAGAAAGACTTTTATCTATCTAAAATAGAGAAGTCTCGTGCCA 
TGACCGAGATAGATGCACGAATGGAAAAGGTGCTCACACTTTCTAATATTGTAAATTCAG 
AAGTACTCTATCTTACTTGTTCGATGTCTGCTTGTCTGAAATTTATAGCTTGTGATCTTT 
TTATAAACTATAAATCCATTAAGTAAATGCTAACTTTTAGAGTTGGATAATAGGCCTTCT 
TGTTTGGAGGAATTCAATTCTTCGTTTCTCCCTTTGTAAATCTCACTACTCTAACCAGAT 
GTTTGGTTTGTATTCTTCTGTATTTGCGGTGGGCAGAAACGAAAGATTCAAGAAGAATCG 
GGTAGCAATGCTGAAGCAGCACCAGTCTTTCCACCTAGGGCGATTTTCCAGTTTAGACAG 
AAGAAATCAATTGAAAATGAGACATCTCAAAGCAAGCCTGGGCTCTCCACTGATTTCCTA 
GCATCGGTCAGTACTTTTTTCTTTTATCTTTGAAGAACCAAGAAGATTTTTTATTAGAAT 
TAGAAGCATCACAGGTCGTCTAGATAACAACATATATAGTAGCTGCTTAGCTGGGGTAGA 
TGAATGTCTTAAACCTGAATCGTATTCACATTATAACCTGGTGAACTATTGCATTGCTAG 
TCCAACTTGAGTTCGTAGACCTCGTTAGTATTCGTATTGGCTCTTATGCATAATCAATCG 
GTTATATCTTATGCTTAAATGATTATTAATGTCTGCTGGTTAGACTCGTATAGTTAGTAT 
CTGTGTTCAGCTTTTCAACGCAAATATATCATATATGACCTCCGTATCGTATTGGCTGTT 
CCGGTTTAGAATGACTCATTTACATGCATATGTTATCAAATTTATGGTTTTGTTTATATT 
CTTTTTTCTGATTCAGGTATTTGGCGGTTCTTAAGGTTAAGAGGCATGTGACGTTGCGAA 
TTGATCATAGCTTGATGGAGAAATCAATGAGCAATTCCATTATGTATGAATGTCAATTAG 
TTTCTGCAACTCAACAGAGAAAATATTCACATACACTTAGCAATTTGTATACTTTTGTGT 
TCTCCTTATAAGGTTAGCTATATACTATTGTCAAGAAACATATATGTGAAATTTCCACCA 
CCAAAAAAAAAAAAGATTTAAAAGTGCATCAACATACACATAAGCACATGTTTTATATGA 
ACACATGGATACCAAATGGATTCATCACATGGATAGGAAAAAACAATCTTCTAGACAATC 
AGGACGGCACCATACTGGTTTTGTGAATAACGAAAGAGAGACTATGTGACATTATTGGTC 
ACCGAGACGACGAGAAGAAAGCAAGGGCTTTGGG
>AT5G22110.1 |  ATDPB2 (ARABIDOPSIS THALIANA DNA POLYMERASE EPSILON SUBUNIT B2) DNA binding / DNA-directed DNA polymerase/ nucleic acid binding 
GAGAGCAAAAAGAGAGAAGTAGCGAGAATGAGCAGCACCAGTCAGAAGAGGAAGAAGATA 
CAGAAGAAATTCAAAAACAGAGGGTACAACCTCAAATTCGATGCCTTAGACGAGATTCTC 
GTTTTCGCCGATCAATTTCCCGACGACGATGACGGAGAAGCTATAGATCTTCTCCTCGAT 
AACCTCCAGGAAACGCGTATGCCGCCCAATTCGTTTCTCTCTCGTATTATTCTGCGTAAT 
TTGACATCGATTCTGAAGTCGTTGGGTATTTTGTAAAAAATGTTGCAGATAAATCATCCA 
CTGTCGACGCGGAATCAGTTCGAGGATTGATAAATCGCTTGTTAGGAGCTCATAACGCCC 
CGGAGGAACCTACAACATCTGCTTCTTCCTTGGCGATCATCGACGCGTTTCTGGTGCCAA 
AGTTTGGATATGATTCTGTTAAAAAAAAGTTCAACGAGTAAGTCCACTCTAATTTTCCTA 
CTAAGAGTGTGTCTAGTGAGTTTCTAGAGACGAGTTTGATAGGTGGCTTAGGGTTTATGT 
GTGGTAGATGATGGAACTTTATAGTGATGAATTGTAATGGTCGTTTGCGCGTTGTTGATT 
GTAGAATTGGACTGATTGAAGTAAATTTTAATTGATACTAGGCATACGAGTAGCTTGCCT 
ATTCACGGTGAGGCTTCTGCAAAAACAGCTTTATACAGGGAACGATTCATGTTGTTGTCG 
CAGAGAGTTTCTCGTGCAGAGCATTTTTCTAGGCCAGCATTTGATGCTGAAATGTCGCAG 
TTTGAGAACAATGAGGTTGGTCTACGTTTTCTGTCAAATGTGGTTGTTCTCATTTTTCTT 
TTGGGTTATTTTTGTGTTCAAAACTAAACTAAGGAGTTTGTACTGTGTTATGTCTAGTAG 
ATATCTTCAATCCAGTCTCTGATTTCTCAAAGGGGAAGGAAATGGGTGATGGGAGTGATA 
TCACAGTTGGAAGATGGACATTTCTACCTGGAAGACCTTTCAGCTTCTGTAGAGATTGAT 
CTGTCCAAAGCAATATCCTTTTTTTAAGTTGGTTCTAAAATCTGCAAAAACTGGACATAG 
CATTTCAACATATTGTTTAATGTCTCATGCTGATAAAGACATAGGAAGGAATTGCGTTTG 
AGTTTTTTGTGCTTTGAATAGTTTTCTTTGACAATCAGTACAAGATAACAACAGGATTCT 
TCACAGAGAATACTATAATTTTGGCAGAAGGCGAAATGCAGGTTAACGGTATCTTTCAGG 
TAATTAGAATTGAAGGTGGCAATTTTGGGCCTTTCTCTCCCCCATTCTGAGTTAATTACT 
TTTTAACTAGGGAGATATTTGTATAATTTGCTGAGGTGCACATTCATAGATTTTACGATT 
TTGTTTTATTTTTCATGTTGGGGTCAAGATATTAGGCTATTAGCTATATGAAGGATCATA 
GAACTAAGTCATGTATAGGGTCCTTTCTGTGACAAAACATACGTACACCTGTCTCCAATA 
AACACTTGATCAGATTGCCTGTAACAAAGCTCAGTTTTTCATAATATGTTCTTTGACCAA 
CTCATCCTCTTCTAAAAGTGTATTCTCATCTTGTGGTGAAGGTGATTACATGTGGATTTC 
CTCCCTTAGAAGACAGGGACAAAACACTAAAGGCGCATTCTGAATATGATTTCTTCGGAG 
GCGGCACACTAACTAAAGAAGAGATGGTAATCTTTGATTCGTTGTTTGTACTCGGATTGA 
GAATTTTGTAAATTTTCAATGCAATCCCTTACATAGTAGGTAAACCACACTAAAAATAAT 
GTGTTTTTTGCCTGCCAACAGATTAAACTTGCAGACCTTGAAAGACAAGCGGTGAATGAC 
ACATTTGTCATATTGTCTGACATATGGTTGGACGACGAAGAGGTGAGTTGGTGTACCAAG 
TACTCTATTTAGCATCAATATTTTGTGACATTGCTTGATCGCCACAATATGTTGTCCGTA 
GAGAAGGTTATGAGGAAGCTGGAAACTGTTCTTGACGGTTTTGAAAGTGTGGAGACAGTA 
CCCTCCTTGTTTGTTTTTATGGGAAATTTTTGTTCTCGCCCATGCAACTTATCCTTTGGT 
TCGTATTCAAGCCTTAGGTAAGGGATCATTGTAGTTAGAATCTTCAATTGTTAAATGGGA 
ATTTCTTCTTATATATTGTCGATAACCTGTGTCCATTTCTTTCGCAGGGAGCAGTTTGGT 
AAACTTGGGAGAATGATTGGAAACCATCCACGGCTTAAAGAAAATAGTCGGTTTTTATTC 
ATTCCAGGTCCTGAGGACGCAGGTACCATCATCACCACCATTACTATGTAAATAATCTTT 
AACTGAGATCCATGAGGTAACATGACTTATAAAATCTCATCATATTTGACAGGTCCCTCA 
ACAGTCTTGCCAAGATGCGCTTTACCGAAATATTTAACCGAAGAGCTTCGAAACATTATT 
CCCAATGCAATATTTTCAAGCAATCCTTGCAGGTGAGTTTTCTATACGATGTGTGAACTC 
TCTATTGCTCATCATTAGTTTTTTTTTCTTTTTCTTTTGAATTGTGAACATTTGCCACAC 
ATAATCTTGTCTTTGTAAAATGCAGAGTAAAGTTCTATAACCAAGAGATTGTGTTCTTCC 
GACAAGATCTTCTGTATCGGATGCGTCGTTCATGCTTAGTAACCCCTTCCTCAGAAGAAA 
CGAATGACCCTTTTAAGCATGTAAACACATCTCTCGTCTCTGTTATTTTCTTACGTATGA 
TTTAAAAGTTTTCCTGGTAAATGATGGAAACTCCTGAAACGTGTTGTTACAGCTTGTCTA 
CACAATAACTCATCAGAGCCATCTATGTCCTCTACCTCTCATGGTGCAACCCATCATTTG 
GAACTACGATCACGCTCTTCGACTGTACCCAACTCCTCATACGGTATTCATTTCTATATC 
AAATCCTGCACGAAACCCGCCTTATAACTAAGTATTGTTGTTGTTTCAAAACAGATAGTA 
TTAGGTGACAAGAGTGAGCAAGAGGTTTGCAAATTTGGGGGAACAACATGTTTCAATCCA 
GGCTCTTTCTCAACTGATAGCACATTCGTAGCTTATCGACCTTCCACTCAAGAAGTCGAA 
CTCTCTGCTTTGTGATTCTCCTTTTAAAATTCATCCCAGGAGATCAATTGAGTGCCATTT 
TTACCAGACAAGCCTGAGCTTAAAAGGTATACAGAAAGAGTGAAAAAAATACTTCATGCC 
CCATTCTTTGCTTCTCTGTTGTATACAAGTTGTATCCTTATAAATTAAGTATTCTTTTAG 
GATATGTCTTAAGGTAAACAAATAATAGTCATAAATTTATATCAGACAAGGGTCGATCTA 
AAGTAAAAAATGCATAAATTT
>AT5G22840.1 |  protein kinase family protein 
ACTTTCTTCTCTTCCATAGAACCTCAAATTTCTAGGGTTTTAGGGGTTTTTCCTGAATTG 
AATTTCCCAGATCGAGATTCGCTGTTTCTCGATTGGGGGTACTTTTCAACTATTCCGGCG 
ATGGCGGATGAGAAGAACGGTGGACGTCTGAGTGACGCTAGTGACTACTCATCAGAGGAC 
GAAGGAACAGAAGATTACAGAAGAGGAGGTTACCATACGGTTCGAGTCGGTGATACTTTT 
AAGAATGGATCTTATGTCATTCAAAGTAAGCTTGGTTGGGGACATTTCTCCACTGTCTGG 
CTCGCTTGGGACACTCTCAACTCTGTAAGTCACTACTTTCACTTCTATGCTTCGTTTCTC 
AGAGAATCAATTTTAGGGTTTTTAGATAGTAGGGAAAAGGAACTGGCTTGAGCTAGGGTT 
TAGGCAGTATATATTGAATTGCATTGTTGTGATTGAACTAGCTTTGTTAGAGAATGAGGA 
AGTTCTTGTAGTTAGAGAATTGAATCTTGCCTTTGAATTCATTTGTTTGTAGCGATACGT 
AGCTTTGAAAATCCAGAAGAGTGCTCAGCACTACACTGAAGCGGCCATGGATGAGATAAA 
GATATTGAAACAGATTGCAGAAGGCGATGCGGAAGATAAGAAGTGTGTTGTGAAGCTTCT 
TGATCATTTCAAGCATGCTGGTCCTAATGGGCAACATGTTTGTATGGTTTTTGAGTATTT 
GGGAGATAACCTCTTGTCGGTTATCAAGTACAGTGATTACCGAGGGGTTCCTCTTCATAT 
GGTTAAAGAGATCTGTTTTCATATCTTAGTTGGTTTGGATTATCTTCATCGTGAACTTTC 
TATTATTCATACTGATATCAAGCCGGAGAATATTCTGCTTTGTTCCACTATTGACCCTGA 
AGCAGATGCTCGGAAATCGGGGATTCCTCTTGTTCTTCCAACTGTGAAGGACAAGGCTGT 
TCCTGAGAGACCAGTTGAAAAAGAGAAACCTAAGAGTTATACGTATAGTGCGGATTTGAC 
TAAGAATCAGAAGAAGAAGATCCGTAAGAAAGCTAAGAAAGTGGAAGGTTCAGAGGAAAA 
TGAGAGAGACTCTTCTAACTCTGAGGCAAGACCAAATGGAAATGCAACTGTGGAGAGGTT 
GGAAGAGAGTTCTGAAAGAGTAAAAGATGCAGAGAATGTTAGTCAAAAGAGCCGGGGAAA 
TAGGAGAGGAAGCCAATCCACGAGGCAAAAGTTACTTGCGGATGTTGATCGGAAATGCAA 
GTTGGTGGATTTTGGGAATGCTTGTTGGACTTATAAACAGTTTACGAGTGATATTCAGAC 
AAGACAGTACCGGTGTCCTGAGGTTGTTCTTGGCTCAAAATACTCAACCTCAGCGGATAT 
GTGGTCATTTGCTTGCATTTGTTTTGAGCTTGCCACCGGAGATGTTCTATTCGATCCTCA 
CAGTGGTGAAAACTTTGAGCGAGATGAGGTATATATCTCTTATGTGATTTCTCATACTTT 
GTGAAAAAATAAAATCGTTTCATGTCGTTTGTACTCAATTGTAACACTAATGGACTTTGG 
TTTCAGGATCACTTGGCATTGATGATGGAGCTTCTCGGGATGATGCCACGAAAGGTAAAT 
CCAAAAACACAGTGTTCTCTTATTTATCAATATCAAGAATAGAGCTTTTTAAAGGGATTT 
TGTTAAATGTAGATTGCATTAGGTGGACGCCATTCGCGGGATTTCTTCAACCGACAGGGT 
GAACTACGGCACATCAGGCGGTTACGGTTTTGGCCACTTAGCAAGGTCTTAACAGATAAA 
TATGACTTCAGCGAGGAAGACGCAATTGCTATGCAAGATTTCATCACTCCCATTCTTCAA 
TTTGTACCTGAGAAGAGACCGACGGCTGCTCAGTGCCTAACGCACCCATGGTTGAATCCG 
GTCCCTAAATCACTGAAACCGTCATCGAGTCCACAAAATCCCAAAGAAGAAGAAGAGGAA 
GCGTCGGATGAGGATAAAGATAAGGAAAAGGTTGAGAGGGAAGCCATGGAGGCAGGTGTT 
GGAAATATCGCCATTGATGGCTCGGAAAGAAAGACCTCAGCAAGAGAAGGTCGTCAATCA 
GCTCGTGATCTTCGTACTTAAGAAACAAATATAAATGCCTGAAAAAGTTTTGTATTTGTC 
TTTGAATTTCTTCTCTGGGAATCGAAGATTTAGATACTGTATTGTTTTTTATCCCTTTAC 
TCTCGAAAACAGTTTTGATAAACCCTATATTTGAATTTTCATTTGCTTTCGAACCAGTTT 
ATTAAATGATACATTGATCTTACAACATTACCAAGCAATGAGGACATAGCACACAAGTCA 
CTGGGGTTCAATGGAGACCACAACAATAAATATTTATCAGACATTTGATGAACTCACCTC 
GCTCTAACTACTAGTAGGGGCCTAATGCCATAATGTAACTGTGATGAATGAAATTCACTT 
TCTTCACGGATTTTAAACCTGTAATATTTACGTATATTTTGAGCGCT
>AT5G61330.1 |  rRNA processing protein-related 
TTTACTTTTCCTCTGCTCGTAGACAGCTTTGTGCTTGAGACGATTCCCAGTTTCTGCGAT 
TCCAAGTCGAAGATATAACCTCTCCTATTTGCGTCTCAGCTTCTACAGAGCTTTTAGGTA 
AGCTCCTCTGCTTGTATGATTCCTTTTAATTTTCAAAATTCACTGCTTTCTCTTGCGTAT 
CTGCTCAAAGTCTCTCCCTTTTTCATTTAATCGTTTCTCTTCCTGAAACATTCGAACTCA 
TAAACTAGTTTGATTCAAAAGTTTTCTTGCTTTAAACTTGTGTTAGCTCTAGAATGTTGT 
TCTTTGTAATCTGTTTGTGACATTGTGGTGGAGATGATGAATGTTAAAGTAAAAGGTCTG 
AGCAGGTTATGAGTAAAGTGTGTGGCTTTTGATGTTTAATTTAGTTACGAGGAGTCAATC 
TTTGAACTTTATAGGAGAGGGCCCTTGTCCATGTCTTGAGCCATGGCATCTGTGGCTCCG 
CAACCTCTCCAACAATGAACCTGATTTGTGTGTGCAATCTGATGGGTCGATTTTTAAAGG 
CTTGGGGTTGCTTTCTATCATTGATTGTCAATCTAGAATTCTCCCTATATACATTTGTCT 
CCTTGTGCTTCCTTATCACCAATTAGCTACCCTCGTGATTCTGCACTGATCAAAGACCCT 
TTGACTGATCCACGTGAGCTGTTTTTATGAGATTATCTATAGGTCTCTGTTTTTTTTTTT 
TTTTTTTTTTTTTTTTTTTTTTTTTATGTTTGAAGCTTTTGACAAAGCTTGTTTGATGGT 
ATGGTTACCTCATTGTTGCTCTATATTTGGTCCTTCTTTATTTGTTTCAATATTTTTATT 
GCTTAATCCACTGTATAATAGTTTCTCCTTCCTCAATTGAGTTAGTTTTTCGTGATTGCA 
GCATTAAAAGTTGTTAAAATGGCTGGGGGGTCAAAGAGGTCTAAAAGAGCAAGACTTGAC 
AGTGAATCGGAAGACATAAGCGACCAAGAAAACCTTAAGGTATGTTTATGTTGCTTTTGT 
CTCGTTTAAGTTATTTAGATGGTATAGGTGAATTTATTTGGTTGAGGGTTCTCTATATTA 
TAGGCCGAAAGCGACAATGAAGATGATCAATTACCTGATGGGATAGAGGATGATGAAGTA 
GATAGCATGGAAGATGATGAGGGAGAGAGTGAGGAAGACGATGAAGGAGATACCGAGGAA 
GATGATGAAGGAGATAGCGAGGAAGATGATGAAGGAGAGAACAAGGAAGACGAGGATGGA 
GAAAGCGAGGACTTTGAAGATGGAAATGATAAAGAGAGTGAGAGTGGCGATGAAGGTAAT 
GATGACAATAAAGATGCTCAGATGGAAGAGCTTGAGAAAGAGGTCAAGGAGCTTCGTTCA 
CAAGAGCAGTAAGATTTCATTTGAACTAATCATTTTTAAATACTGTTATTTCTAAGATAG 
TGAATTCTTGTATGTGTTTCTTTCTAGAAACGGTAGATAGTCGTATTAAAGTTTCAACTG 
TTTAATCTAGATCAGCAAGGATGTTGGCTAGATTTAGAAGTAGGTTCGAACTCATTATAG 
CAATTGGATTTATTCGTGATTAGTAGAAAATATATACGTTTAAAAGGAAAAGAACAGACT 
TTTGCCAAAAGTTTTTGTCAGATACTGTCTTAATTCGGTTGCATCATTTAATTTTAAATG 
AACGATTGAGAGGCAAAAGAATGTTCTTTGTGTAATATGCGTGTTCCTGGTATAGGGATA 
TATTGAAGAACTTGAAGCGTGATAAGGGTGAAGATGCTGTTAAAGGTCAAGCGGTGAAGA 
ATCAGAAGGTATGACCTTGTTCTGCGGTTTGCGAAGTAGTCTAACTAGAAATCAGTTGCA 
GTTGTATATTCCTATTTTATGTTAATGAAGTTGATCTAGAGCGAATTTTTGACAATTCTT 
TCTTTGTGCTCTATGTAAAGGCTCTTTGGGATAAGATTCTGGAGTTCAGATTCTTACTTC 
AGAAAGCATTTGATCGTTCAAACAGATTACCACAGGTAAGCTATGCTCTTCTCCTCTTCT 
ATTTATGGTTGTTTGTTTCATCATACTTTATGACAGAAGGTACCCTTTTCAGGAGCCTGT 
GAAATCGTTATTTTGTTCAGAAGATGAGGATGTCTCAACAGCATATACAGATCTAGTTAC 
TTCATCTAAGAAGACATTAGATTCCCTCTTGGAGTTGCAAGAGGTATGTATGCATAGGCT 
TGATTCAGTAATTGTATGCTGTCTCTTAGTGTTTTGTCGCTCTGCCACGTTTGTTGACTT 
TTATTATTATTATCTAAATATGGATTTCTACAGGCTTTGTTTGAGAAGAACCCCTCGGTT 
GATCAACAAGTGAATGGTATGCCATATTAACAGATAACATAATTATCATCACTATAAGCG 
AGGGTCAATATAACATCTCCTTTCTTTTTCTATCTGTCAGCAACAGCTAGTGAAGAATCC 
AATAAATCAGATGCAGAAGATAGCGATGAATGGCAGCGAATATCTGACTTGCAGAAAAGG 
TATTCAAGACTAAATGTTCAACTGTCCAGCTTTAAAGTTCTGTCCAATCAAAAGAATTCT 
GTTTAGTAAAGCATGATTGACTTCATTTGGAGACCAGTCTCATAACCATTTATGTTTCAT 
CGTTAACACAAATTTGGTATTTGCTATGTAGAATGTCTGTGTTCCGAAACAAGGCTGTGG 
ACAAATGGCAGAGAAAAACACAAGTCACAACTGGTGCAGCTGCTATTAAAGGAAAGCTCC 
ACGCCTTTAACCAGGTATAGAAAGCAAACTCCGAAGATGATTTTGCTCTTATCTGGGGAT 
CAATCAGGAATCTAACTTTAAATTAATTTTCAAAACCAGAACGTTAGTGAACAGGTTGCT 
TCCTACATGAGGGATCCAAGTAGAATGATTAAACAGATGCAACAATCAAGATCTACTGTT 
GCTGTTTTTGGAACTGTAAGTTTTTGCTTTGATAATAAAAGCATAAACCATCTAAGAATT 
TGGCCTTTGGTGGTCAATAGATCAGCTTCTCTTCAATTTTTCCTGACTTTAAATTTAAAC 
ATCCACAGGTCCCTCAGGAAGCCATGGAACCAAATCCAGAGGTAAAATCACGGTTTTCTC 
TAACCATAAAGAGTATAAACATTTAATCAATCTCATTGATTATCTTGATACCCATTCTCT 
AACATGTGTACTCTTTCTTGTCCAGGAAAAACAAGAAGAAGGAGACCCTGAACTTGTGGA 
AGATGCTGAGTTCTATAGGCAGTTACTAAAGGAGTTTCTCGAGACTATCGATCCAGCTTC 
CTCAGGTATAGTAAAGAAAAACATCCTAGAATCATTAGATATGAAACCCCCCCTAGCGAT 
TGTTATGTCCAACAACTCAAGTGTAAAGAGTCTTTTTTATATTCTGAAATCTCAATATTT 
GCCATTGGCAGAGGCGGCTTTCTACGAGATGAAGAAGTTCCAGACGAAGAAGAGGAAAGT 
TGTGGATCGACGTGCCTCAAAGAGCAGAAAGATCAGGTAAATAAAACACACATAGTTTCA 
CCTCTTGGAGGTTTTCTCTTCCCATAATTCTCTCTTTTGAATCATTTTCTTGTAAAAAAT 
CGAAACAGGTATAATGTTCATGAGAAGATTGTCAACTTTATGGCTCCACGACCAGCGAAG 
ATTCCTCCAAACACGGCGGATTTGCTTAAGAATCTCTTCGGTCTCAAGACCAGAAACGTT 
CAGTCTGAAGCTTAATATCAAACAAACCACAATTTTGAAACGCTGTAATAGATCGTCCCT 
TTTTCTGTGGTGTGTTGTAATACTACTATTGACACCGTTTCTATCGAAAGCCATATGTGA 
AAGCATCTAGTTAATTTTTGTTAAAATCCAAATG
>AT5G65900.1 |  DEAD/DEAH box helicase putative 
AGAACACTCTCGAATTCGAAGAAAATACGTAGCAAAACCCTTATTTTTGAATTTCAGACG 
AATTCCGATTTCTTAATCAAAAATCCGATAAGAGCTTTGGATTTGGCGGCGAATAAGAAA 
ACATGGCGAATTTGGATATGGAGCAACATTCATCCGAAAACGAAGAGATTAAGAAGAAGA 
AGCATAAGAAAAGAGCGAGAGACGAAGCTAAGAAACTAAAGCAGCCAGCAATGGAAGAAG 
AACCCGATCATGAAGATGGTGATGCCAAAGAGAACAATGCGTTAATTGACGAAGAACCGA 
AGAAGAAGAAGAAGAAGAAAAATAAGAAGCGTGGAGATACTGATGATGGAGAGGACGAAG 
CGGTAGCAGAAGAAGAGCCGAAGAAGAAGAAGAAGAAAAATAAAAAGCTACAGCAGCGTG 
GAGATACTAATGACGAAGAGGACGAAGTGATAGCAGAAGAAGAAGAGCCGAAGAAGAAGA 
AGAAGAAACAGAGGAAGGACACGGAAGCGAAGTCTGAAGAAGAAGAAGTAGAAGATAAGG 
AAGAAGAAAAAAAATTGGAAGAAACTAGCATAATGACTAATAAAACGTTTGAGTCATTGT 
CATTATCTGATAACACTTATAAATCTATCAAGGAGATGGGTTTTGCACGCATGACTCAGG 
TAATGTTTTTGGAATTGAAGCTTTATGTTTTTGTATAGCAAAGATTCAACCTTTTACAGT 
TTGGAATTTGGTTGGATTTCAACACTTTTGCAGATACAAGCTAAAGCAATTCCACCATTG 
ATGATGGGAGAAGATGTACTTGGAGCTGCCAGGACCGGTTCTGGTAAAACCTTAGCTTTT 
CTTATTCCTGCTGTTGAGCTTCTTTACCGTGTTAAGTTTACTCCTCGCAATGGAACTGGT 
GTTCTTGTTATTTGCCCAACAAGAGAGCTTGCTATTCAGGTTCTAATTCTCTCACAATTT 
TCTATATAGTCTGTAGAATATGCTAAAAGTGATACTTACTATACATCATTAATGTTTCAG 
TCTTATGGAGTGGCAAAAGAACTTCTTAAGTATCATTCACAGACTGTGGGAAAAGTTATT 
GGCGGTGAGAAAAGAAAGACAGAAGCTGAGATTCTTGCGAAAGGTGTTAATTTATTAGTA 
GCTACCCCTGGAAGACTTCTCGACCACCTTGAAAATACTAATGGTTTTATTTTCAAGAAC 
TTAAAGGTAAACACAAATTTCTGATTTCAGTTTTGGGTATACTGGTATTGATTTAATGCA 
ACATTTTTTATTCGTTAATTTGCAGTTTCTTGTAATGGATGAGGCTGATAGGATATTGGA 
ACAGAACTTTGAAGAAGACCTCAAGAAGATTTTGAACCTTCTACCAAAGGTATTCTCGTG 
GCTTGCATAGTGAAGTCACCTCAACATTCTGAATCATAGAGATGTAAATTTCGTTTCATG 
TCAATGTGTTGTTGATAATGGTAAACCGTCTTTTTGTATTGCTGCAGACTAGACAGACGT 
CACTATTTTCAGCCACACAGAGCGCAAAGGTCTGCTTACCAATCAGTATAGTTTTCACTT 
AATTCTTTATTAGTGTCAGTTTATTAAAATTACTGGAACTTGATTAAACCATCAGGTTGA 
GGATCTTGCTCGGGTGTCACTTACCTCACCTGTTTATATTGATGTGGATGAAGGACGAAA 
AGAGGTAGCTATTAACACAATTTCTATTATCTTTTCTCGCAATTTACTTTGTGACCAAAA 
CAGGCCTTTTTCAATTATAAGAAAACTGGAAAGTGCAGGTTACAAATGAAGGCTTGGAGC 
AAGGTTATTGCGTTGTGCCAAGTGCGATGCGGTTACTTTTTTTACTTACCTTCTTGAAGA 
GATTCCAAGGGAAAAAGAAAATTATGGTGTTTTTCTCTACATGCAAGTCGACAAAGTTCC 
ACGCCGAGCTCTTTCGATATATCAAATTCGATTGCCTTGAAATCCGTGGAGGGATAGACC 
AGAACAAAAGAACTCCAACATTTTTGCAATTCATAAAGGCGGAAACCGGTATTTTGTTGT 
GTACTAATGTCGCTGCCCGAGGTCTTGATTTTCCTCATGTGGTATGCTTTCTTAACAACT 
TTAATGTTTTAATAATCTGGATTGGTTGGTCTTTAATCAAATTATTGTCTGCTTGTTTAG 
GACTGGATTGTGCAGTATGATCCTCCTGATAACCCAACGGTATGTTGCTTATAATTTAGG 
GTTTTTATGCAAACACGCGGAAGAATAAGGGATAAGAAATCACTCAAATTCTTGAATGTT 
ACTTTTGATTTAGGATTATATTCATCGAGTTGGTAGAACAGCTCGTGGTGAAGGAGCAAA 
AGGAAAGGCTCTGCTTGTCCTAACTCCACAGGAGTTGAAGTTTATACAGTATCTCAAGGT 
AAATTATTTTCATTCAATAAAAACTTTGATAATTTTTCAAATTATAGAAATTTTGATAAA 
AGAATCTGTTTCCAACTGTATAATTTGCAGGCGGCGAAAATTCCTGTTGAGGAACATGAA 
TTTGAAGAAAAGAAATTGCTCGATGTGAAACCTTTTGTGGTAAAACATTCTTGCTCTTTC 
AAATAAGTTTTACTACACTGAAGAAACAAAAGTTGAGAGATTTATTTAAAATGTTATTGC 
AGGAGAATTTGATATCTGAAAACTATGCATTGAAGGAGTCAGCAAAAGAAGCATACAAGA 
CATACATTTCAGGATATGATTCTCACTCTATGAAAGATGTCTTTAATGTTCACCAACTCA 
ATCTCACGGTAACCAAATCTGCAGCATACATATAACAATACGAAACGTCATGAAATCAGG 
AATACAATTTGTTTTTGTTTTCTGCAATTTAAACGTTAACCGAAGGTCTTTGTTTATGTG 
CAGGAGGTTGCGACTTCGTTTGGTTTCTCAGATCCTCCCAAAGTTGCTCTGAAGATAGAT 
CGAGGAGGGTACAGAAGTAAGAGAGAACCGGTTAATAAGTTTAAGAGAGGTCGTGGTGGT 
GGTAGACCCGGCGGTAAAAGCAAGTTCGAGAGGTACTAAAAATACAGTTGCACAAACAAC 
GTCATACTTAGTAGTATGGCACATGCCTTTTAACGAATGTTGTATCTTATTTTTGGATTC 
ATTTACGATTGTGTTGTCTTAAGCTGTTTCCAGAGATATCAGACGAGATACCAGTTTTGT 
CCCCGTTACTTAGAAATATTGATCATTTTGTTTTGCGAATAAACTTGGTCTTATATAT
>AT5G66100.1 |  La domain-containing protein 
CACAAGTCTTCCAAACGGAGGAGCCACCGGCGTTGTTAGCTTTCTCTTTGGCTGATTCCT 
TCTTCTTCTTCTCTAATTCTTTTCCTTGGTTTCAGAGTATAATAATCCCCAGCTTCTTTG 
ATCCTCTCTCTCTCTCTCTTCCTCTGTTACATGATGGCTACGACGGCGAGTAGTGCCGCT 
AATTCTGCATCTCGCTTCTCCATTGATTCCTCTATCTCGCGATCACGTCACGGCGATTCC 
TCTCCCTGGTTGTTACCTTCTGATTCCCATGATCATCCGACTCTTTCCCTCTCCCAGGAC 
GATCCCTTCTCAGCGCCTTCGGTCTCCCCGCCCACCGGAAATAACTCTTCCGACTACGAC 
AATGCTGATAAGAAGCCTCCTCCTGTCTGGAACATGCCTTCTTCTAATAGCTCCTCCGAT 
GTCGGCCCTGTCATGGGCGCCGCCGAATCCTGGCCTGCTCTCTCTCTTTCTGCTCGCTCT 
TCTTCCATCAAGTCTCCCTCTTTGGATGCTTCCAAACCTTTTCCTGATGGATCATCGTCA 
TCAATACCGCCTCCCCAGGTCGTTTCTTTTTGCTCTCCAATTATGTCATTACAGAATATT 
AGGGATTCACCAGTATCTACCTATTATAGGCTTGTGGTTTCAAGTTTCATTTCTCAAGCT 
CCTTCTTTTGCATGTTTCGAATCCAAAGAGGATAATTTAGTCTAGTCGTCAATATGCTTG 
TTTGATTGCCTATAGTAGATACATATATCCGCTTTTGCTCATTATCCATCCATATATATT 
GCAGGCTACTTCCAACACCAGCACCAATGCCAATGCAGGCTCGAGTGTTTCTGCTACCTC 
ATCTGAAAACAGTGCTGTTAATAATAGCCAGAGGAAACCTTTTAGACGGAATAACAACAC 
ATCATCTTCCAGTACCAGTAGTAACGTCTCCAATGCTGCGCCTTTAAACACCAGAGATCA 
GAATCACAGCCAAAGGGGTGGTGGCTCTTTTGGTTCAGGGAATTTCCGTAATTCTCAGAG 
GAATCGCAACAGCAGCTCTTACCCTCGTGGGGAAGGTCTTCACCATGGAAACAGGCGCAA 
TTATGAGCATGGCAACCAAAGCGGCTTTTCTCACCGTAACTATAGTGGGAGAGACATGCA 
CTTGCAACCGCAGAGGGGTGTTGGGATGATTAGACCGCAGATGCTGATGGGGCCACCATC 
TTTTCCTGCCAGTAGTGCGCAATATATGGCAGCGCCTCAATTAGGTTCATATGGTGGCCC 
CATTATCTACCCAGGTATGGTTTTGCTCATCTTATGCTCTCTCATACATTCCCATTTCTA 
ATTCATTCATTCTGCTATGTTACATCTTCAGATTATGCACAGCATGTCTTTATGCCACAT 
CCATCTCCAGATCCGATGGGTTTAGTTGGACCCTTCCCACTTCAACCCATGTATTTTCGC 
AATTTTGATGCCATCTTGTACAATAAGATATTGACACAAGTAGAATATTATTTCAGGTAA 
TCGTTTCAGTTTTATTTGGTTGTGTTTGCACTTTTCTACTTGTTTATGGGTTACCCCAAT 
GCTCCATTAGATGCATCTATCAGAAGTGTGAATTACAAATTTTATCCTTTGTTAATTTTT 
AAACGCAGCGCTGATAACCTGAGCAGAGATGAACATTTACGGGATCAGATGAATGATGAA 
GGTTGGGTTCCTGTTAGAGTAATAGCAGCATTCAGGAGAGTAAGTGGTTTTCCATCTTCT 
ATTCTGAAGCTGACATGCGTTAATCACTTTACAATGTCTACTGCAGAAAGTATTTCTTAT 
TGTATCAAGGTGTTACTTATATTAGTTGTGTTTGTTTGTTTACGTGACCTTGGAAGTAGT 
AGTCTTAGTTTAGTAAGTGTATTGGTGGTAAAAAAAAGAGTAATTCTTTGAAATTTTTGC 
AACTTTTGCAGCTTGCGGAACTGACCAATAACATCCAGACTATATTGGAAGCACTGAGAA 
GTTCAGAAGTCGTGGAAATTCAGGTATGTAAGATGAGCATCCTTGTCTCTCATTCATTGA 
TGGATATAAGATAAGAAGTAAAGTGGAAAGGTGTAAAGATAAAAAAAGGCATAGAAAGAC 
TAAAGGTAGAATGTGGATGGGATTGTAGGGTGAAACATTAAGGAGGCGAGGAGATTGGGA 
CAAGTATTTATTGCCTCGTGAGCCTTCAAGGTCCGGTCCAGCTGCGGGGGCTAGCAACAA 
TGCCTCACTGGTGTCTCAAATTGAGAGCATGACTCTATCAGAGAGGAGCAGAGAGGGAGT 
GTAAGAGAGATGCTACTAAGAGAGAGAAAGAAAGATGTGTTTGCAAGCCTATCTCTCTTC 
CTTTCCTTTTTTGTGTTTTGTCGAGAATTGGATATGAACTGATTGATACTCAGTCTCATA 
AGAAAAAAAACAATAATATGCTGCTCAACTTTTTTTGAACTTTTCTGGTTTTTAAAATTT 
TTTTGGATAGGAAACTTTAATAGTTGGTGTTTGGCTGATCATTGATTTAGTCATCCTT
>AT5G02530.1 |  RNA and export factor-binding protein putative 
CTCGCGGTGCGTAATTCCATCTTTGAAATCTCAGAGCAACAAAACCCTAGCTACATTTCT 
CGATATCGGAGAAAAGATCCGGCGAAGATGTCAGGTGGCTTAGATATGTCACTTGATGAT 
ATCATCAAATCTAATCGAAAACCTACTGGATCTCGCGGCCGAGGAGGCATTGGAGGTGGC 
AATAACACCGGTGGTCGCGGTGGTTCCGGTTCTAATTCCGGTCCGTCTCGTCGGTTTGCT 
AACCGCGTAGGAGCCAGAACGGCGCCGTATTCAAGGGTCAGCCCATTGATTTTATATCTC 
TCCCTTTACCTTCTCTTCCTTCAAGAATCAGAGAATTCCTTTTAGGGTTTTTGTGAAATC 
AAAAAAAGCTGAGATCTGTTTTCGTTTCTTCTTTGACGAATAAAACAGCCGATTCAACAA 
CAACAAGCTCATGATGCGATGTGGCAAAACGACGTCTTCGCGACTGATGCGTCTGTGGCG 
GCGGCTTTTGGGCATCATCAGACTGCTGTTGTTGGTGGTGGCTCGTCTATCGAGACTGGA 
ACTAAGCTTTACATTTCAAACTTAGACTATGGTGTCTCCAACGAAGATATCAAGGTTTGT 
GCTTTAGAAGTTTATTATAGTTCCAGTCTTACTTATGAGAAAAATTGTGGTTTTGTTTCT 
GATCTTGAGATGGTTTTGCTTGTAGGAGCTTTTCTCTGAGGTTGGTGATCTTAAGCGATA 
TGGGATTCACTATGATAGGAGTGGAAGATCAAAGGTACTTACTTGATAAGCTTTATTGTG 
CTTCAGAGATTTGTTTATTGAATCGTCTTGTCATGATTAAACTTAATGATGCTTTCAGGG 
GACTGCTGAAGTTGTTTTCTCGAGGCGTGGGGATGCATTGGCAGCTGTCAAGCGTTACAA 
CAATGTTCAGTTGGATGGAAAACTGATGAAGATAGAGATTGTTGGGACTAATCTTTCTGC 
TCCAGCTCTTCCCATTCTTGCTACAGCTCAGATTCCTTTTCCTACTAATGGGATACTTGG 
CAACTTTAATGAGAACTTTAATGGCAATTTCAATGGCAACTTCAATGGAAACTTCAGGTT 
TGTCTTGTTTCCACACTTTGTTCAATATGGAAACTTCATAGTATCATTTGCTAGGGTCTA 
TCAATCTATTGCTAAGTCAGTTAGTATCTTGATGAAATACTTATGTTTTGTTCTTCTGTT 
AAGATGGCCTATGTTTTGTTCTTGAGTTAGTATATTGACGAAATGCTTTTTTGGTTAGGC 
CAAGTATATCCTGATAGGTAGATTACACGAACCTTGTACTCCTATTAAATATTTTGGATA 
ACCTGTTATGCCACAGAGGCAGAGGAAGAGGCGGTTTTATGGGGCGTCCTCGTGGTGGTG 
GTTTTGGCGGTGGTAATTTCAGAGGTGGCAGGGGAGCTAGAGGACGTGGTGGTCGTGGCA 
GTGGTGGAAGAGGACGTGATGAAAACGTATCTGCAGAGGATCTTGATGCTGAATTGGACA 
AGTACCACAAAGAGGCAATGGAAACAAGTTAGAAAGGGGAGATTAAACCTATTGCATGTC 
TACATGTATTCCTTCCTTTAGTGCCGATATGCTTTTGTATTAGTATGATCTTTAGATTGA 
ATGTCAATGGGTCTGACATTTTCGAGCTTTAGCTTTTGTTTTTTCTTCTCTTGGTGAGCT 
TCTTAGCTTTTTGCAGTTGAGTTCAGAGAAACAAGCATTGTGTGTACCGTGGAACTCAAA 
ACTCTTCTAAAATATCAATTCAAAACACAATTCTATCTA
>AT1G22760.1 |  PAB3 (POLY(A) BINDING PROTEIN 3) RNA binding / translation initiation factor 
CAATTTTATCCCTCTTTACTCTTCTTGATAATCGGAGGAAACTAAAAAAGGAAAAAAAAA 
AATCTAAATAAGAATAAAATTCCTAAAAAATAAATAAATCAAAAATTGTGAAGAAACAAA 
TCCTCGAGTCATGTTGTTTACAGAAAATCTCTTTCTCACTTAAAACCCTTACAGAAACAA 
ATCATCGAATCTTTGTTTTTTTAGAATCAGTGATTTTGTTTCCTTTCACGAGACGAAAAT 
AACAAATCGTCTTGTAAAAAGTAAACTCATAATCATGGCGGCGGCGGTTGCCACAGGTGT 
TGCACCGGCGACAATGGTTGATCAAGTTCCCAGTCCGACGGCGCAGACTTCGGTTCAGGT 
TCCGGTTTCAATACCTCTTCCATCCCCGGTCGTGGTAGCCGATCAAACCCACCCGAACTC 
GTCGCTCTATGCCGGTGATCTGGACCCGAAAGTTACTGAAGCACATCTATTTGATTTGTT 
CAAACATGTTGCTAATGTCGTCTCGGTAAGAGTTTGCCGCGATCAGAATCGTCGATCTTT 
GGGATATGCCTACATCAATTTCAGTAACCCTAACGATGGTAAATACAATTCTATATCGCT 
TCAATTGCAAGTTAGGGTTCATGTCTTGCAAAACAAAATATATATATTATCATGAATTGC 
ATTACAATAAGAAAAAGTGTTTTGATTTGATTTTTTTCAATCTCAATTTTTTATTAGACA 
TGGTAATTAATTTTGATCAGTATCATGTTCCTGTGCGAATCATCTTTTTTTTTGTCTAGA 
AATTAACATATAATCAATATTCTATATTGTAGTTCATCTCTACTATACCATGATTCTGCT 
ACATTGATATGTTTCGTTTGAATATCAAAGCTACAACATTTATTTTAGTAGTTGATGCAT 
CAGTCTCTTATATTATGATTTTTCTTAATTAGTTCAATTTAATACGTGAAATTTGTTTGA 
AATTGTTCTTTCAATCTCATTAATTGTAGAAACTATAGGTATTTGTGCATTTATAAATAT 
CATAGATGCTGGTTTTCTATAATGAATTGAGATCTTATTTGCCTATGTTTATATGTTGAT 
TTATGTTTGCAGCTTACCGTGCAATGGAGGCCTTGAACTACACTCCCCTCTTTGATAGGC 
CCATTCGGATCATGCTTTCGAACCGTGACCCAAGCACGCGATTGAGCGGCAAAGGAAACA 
TTTTCATCAAAAACCTTGACGCTTCAATCGACAACAAGGCCTTGTTCGAGACGTTTTCAA 
GTTTTGGAACCATCCTCTCATGCAAAGTTGCAATGGACGTGACTGGCCGGTCCAAGGGGT 
ATGGATTTGTCCAGTTCGAGAAGGAGGAATCGGCTCAAGCCGCAATTGACAAGCTAAACG 
GAATGTTAATGAACGACAAGCAAGTTTTTGTGGGACACTTCATCAGACGTCAAGAGCGTG 
CTCGTGATGAAAACACCCCTACACCGCGTTTCACTAACGTGTACGTCAAGAATCTCCCCA 
AGGAGATTGGTGAGGACGAGCTACGAAAAACGTTTGGTAAATTTGGAGTGATATCGAGCG 
CAGTTGTAATGAGGGACCAGAGCGGAAACTCGAGGTGTTTCGGGTTTGTGAATTTTGAGT 
GCACTGAAGCAGCGGCTTCGGCGGTTGAGAAGATGAATGGAATTAGCTTAGGGGATGATG 
TGTTGTACGTTGGGAGGGCGCAAAAGAAGTCTGAGAGAGAGGAAGAGCTAAGAAGGAAGT 
TTGAGCAAGAGAGGATAAACCGGTTTGAGAAATCTCAAGGAGCGAACCTGTATTTGAAGA 
ATCTTGATGATAGTGTTGATGATGAGAAACTCAAGGAGATGTTCTCTGAGTATGGAAATG 
TGACATCCTCCAAGGTAATAATTAATTAAAAACTCATACATATATTCATAAATATATATG 
TTGTTGATGTTACGTTGTCTTTGACACAATCCTTTAACTAATGTAGGTTATGCTTAATCC 
ACAAGGAATGAGCAGAGGATTTGGTTTTGTTGCTTATTCCAATCCTGAAGAAGCTTTAAG 
AGCCGTGAGTTACTAAAACTATAATATATTCTTCTTTTATTGTTCGTCTCTTTTGATATC 
TGAGAGATTGTTACATATGAGACAATGCAGCTGAGTGAAATGAATGGGAAGATGATCGGA 
AGAAAACCTCTATACATAGCTCTTGCGCAGCGCAAAGAAGATAGACGAGCACACTTACAG 
GTTTTTTAAAAACTCTTTTAACATATTTAAAAGAAATGGGTTTGTTAAAGCTATATGTGT 
GACTAAGTACATAAGTTTGCAATTTTTTCAGGCGTTGTTTTCACAGATTAGAGCACCAGG 
GCCAATGTCAGGGTTCCATCACCCGCCAGGTGGACCAATGCCCGGTCCACCTCAACACAT 
GTACGTAGGCCAAAACGGAGCAAGTATGGTCCCGTCCCAGCCCATTGGATATGGATTCCA 
GCCTCAGTTCATGCCCGGGATGCGTCCAGGTTCTGGCCCGGGCAACTTCATCGTGCCTTA 
TCCGCTTCAAAGACAACCTCAGACCGGTCCTCGTATGGGATTCAGGCGTGGTGCTACTAA 
CGTGCAACAACACATCCAACAACAACAAGTATGTTACTAAACTGAGTCTGTTTATAGTTT 
TCAACAATCATGAAACTGAGTTGGATTGAATATTGACAGCTTATGCACCGTAACCCGTCC 
CCGGGAATGAGATATATGAACGGTGCGAGTAACGGGAGGAACGGAATGGATTCGAGTGTT 
CCTCAAGGAATCTTACCTCCTATCATTCCTTTGCCAATAGATGCTTCTTCGATCTCTCAC 
CAGAAAGCTCCTCTCCTTCCAATCTCTAAGCTCACTTCTTCCTTAGCTTCTGCTAGTCCA 
GCTGATCGCACTCGGGTTTGCCTCTTTTCCTTCCATCTCAGCTAAACATTTCTTTGTTTT 
GCGTTTTCTTTTGCATTTGGTGTATAACTTTTGAATAATAAACCCTTAACTCTAAACATA 
TGTTTTCAATTGTTGATGCAAAACCAAACGCAAAGAGAGGTCAGTCACATTTGCATTTTA 
TCTTACAAAATATTTCCTGAATAACTGAAAAATGTTTTGGTGAATTTTGTTTCTTAACAT 
CAAATGTTTGAAAGAATTATGGTCTTATAACAAATAAATAAAAGTTAAAGTCACATAAAT 
ATATAGTTGATAGAGATTGGCATATCTATATATTTATATGTTTACTGATTTTTATTTTTA 
AAAAATTGGTTGGGAACAGATGCTTGGAGAACAACTGTACCCACTTGTGGAAAGGCACGA 
ACCACTTCACGTGGCTAAAGTCACAGGAATGTTGTTGGAGATGGATCAAGCTGAGATCTT 
GCACCTGATGGAGTCACCAGAGGCACTCAAGTCTAAAGTATCCGAGGCTTTGGATGTTCT 
CAGGCTATCTGTTGATCCAACTGATCATGATCTTGGTTTCTCTACCACCGACTGAAATTT 
GCAATGCGTTTGCTCAACTCTGTTTTCTTCTTTTAGTTTTGATATCGACTCCTTTTCTTT 
TCTTTTTTGGGTTTTAGTCTTCCTTTACTATTTTAGCAGTTTTTTTTTGTTTACTTAGTT 
TATGGTTTTTGTGTCTTTAACTTAGTTTATGGTGTTTTTCTTTTTCTTTGGACAATGATG 
ATTTCTTAATAATCTGAGTAGACTTCTTCTT
>AT4G35890.1 |  La domain-containing protein 
GAGAGAGAAGAGAAGAGAAGAGGAGACTACACTGCTCCATCATCTTCTCCTTCTGGGGAT 
TTTTTTTTGGAAAAATCGTTCTGTTACCTTTTTTTTGCCCATTACTCAAACCCTAACCCT 
AATTTTCTGAAATCGCAGAGAGAGAGAGAGAGAGGTTTCTTCGAATTCTTTCATCATCAA 
TTCGCTAACTTTGTTTTTTTGGGGTTAAATCGATTAATCGTTATTTTATTAGATACTGTC 
GATCGGAGCTAATCGACTCTCTCTTAACAAACCCTAATTTTTTGGTCCTCTCTCATGGCT 
TCCGCCACTTCCAATAACCCTGCTTCTTCTTCTATGTCTCCTCGTCGTATCAGCGGGAAT 
CACGGCAGCCCCACCGCTTCCGTAGCACAATCACCTCGCCGTCCTTCTCGGCAGGTTTCT 
TCTCCGTGGACTCAAATCGTCCGCGGCGAATCAGAGCCGATCGCCGCCGCCGCCGCTGTA 
GCCGGTCCTTCCTCTCCTCAATCCAGGGCTCCGATCGAGCCGATTGCTTCTGTATCCGTT 
GCTGCTCCAACTGCTGCTGTTTTGACGGTGGAGGCGGCGGCTGGTGATGAGAAATCGGAA 
GCATCTGGTGGTCAGGACAATGCTGGAAAGAAACCAGTTTGGAAAAGGCCGTCTAATGGG 
GCTTCTGAGGTTGGACCTGTCATGGGAGCTTCTTCGTGGCCTGCTCTTTCTGAGACCACC 
AAAGCTCCTTCCAACAAGTCTTCTTCTGATTCGTTAAAAAGTCTCGGTGATGTACCATCA 
TCATCGTCAGCATCATCATCTGTCCCCGTTACTCAGGTACGAAACGATTATTATGACCTT 
ATTGATTATGTGGTTACTGAAATGCTTCATGGAAGTATAGAAAAGTTTGAGCTTTTGCAT 
ATTGACTATTTGTGTCGTATTGACTATAACTGTTTATCATAGAGAATAATGTAAATTCTT 
GGTTTGTGAATGAATCTTAGCTTAAGCTTTTTTTGTTGGATTTTGTATACTGCAACTTCG 
TTATCTGAATGTTTGTTGACTAACTAGGATAAAGGCAGATGCGTCTTAATACCTTCCTGT 
CGGATTGTGATGCATATTGAGCATCAATGTATAAAAGTCTTTGAGTAGTTTCTGTTCAAA 
GTTCTCTCTTTTTATTTACTGAATTTGTAATGTCGATACTTAAATGCTTATTTTGATGTA 
CGCCTTCATTTATCAGTGTGTTATCCAACTCTCAGTAATTCTATTTATCCTGATTCAATA 
GTAAAGATGCTTCTTTGTCTTTAATTTAGGGAATTGCAAATGCTTCTGTTCCTGCACCAA 
AGCAAGCTGGCCGTGCAAACCCTAATCCAACTCCAAATCACTCGCGCCAGAGATCATTTA 
AACAACGCAATGGCGCCTCTGGATCAGCTAATGGTACTGTTTCTCAACCATCAGCGCAGG 
GTTCATTTACCGAATTGCCTTCGCACAACCCTTCTCCTAGAGGCCAAAACCAGAAGAATG 
GCTTTGCGTCACAAAACCATGGTGGTACTGAAAACCCATCTCAACGAGACTCCTACAGGA 
ACCAAAACGGTAATCATCACCAAAGTCACGGTGGCAGGCGCAATCAGGAGCACGGGAATC 
AAAATTGGACTTTTCAAAGAAGTTTTAACGGGAGAGAAGGAAATGCGCAATCGCAAAGAG 
GTACTCCAGCTTTTGTAAGACATCCATCACCAACTGTGCAGCCAATTCCTCAGTTTATGG 
CAGCTCAGCCTTTTCCCAGTCATATACCCTTCCCTACTGGTGAGACACATTGAAAATCAC 
GTCTTTGAATTTCATTTATGATTTGCTAATGCGTCTTCTCCGTTTCAGAATTGGCACAGT 
CGTCGTATTATCCCCGTATGCCTTACATGACACCTATTCCGCATGGTCCGCAGTTCTTCT 
ACCATTATCAAGATCCTCCGTTACACATGAAACTGCATAAGCAAATACAATATTATTTTA 
GGTAGTACCCTCGTATTTAATTTCTCTTATTCTTCTCGACGATGAAATTCCCACTGATCA 
ATTCACTATAGGGAAATACTAATTTAGATGCAAATGTGTCTTTTGTTACAGTGATGAAAA 
TTTGATTACAGACATATACCTTCGAGGGTTCATGAATAATGAGGGTTTTGTTCCGCTACG 
TGTGGTAGCTGGTTTCAAAAAGGTAAACTAGATGTATTGTCTTTCATACTGGCCCAGTTC 
ACTTCTCTCCGTTTATATTATAAACAGTAGAATTAAGAGTTTCATTTCTGTATAATTCAA 
CAAATGTTTTTTTTACTGATTAGGATTAAGGCGAATTTGTACTTACTACTTAGTCCAATA 
GGATCTTTGATTCTTTTGTGACTATTTATATAAAGATGTGGCATGCATGTACAAACTTTC 
AGCAAATGGATATGCTCTTAAGATAGTTGAAATATGTTAACAGTGGGCATGTATTGAGAA 
ATTCGATTGTGAATCCTTCGTTTGTTCTTATATACTGTGTTGCATAATGTTGAACCTGAA 
CAAGTAGGACTTATTAGCTAGCTGCACAGTAGGCTCTACACCAATTTTTTTTTGCTTTTC 
TTTTTCCTTATCCTAGTTACTATAACATTTTGTTGCTTTGTACTCGTCAAGAGTTCTGTT 
ATTATTCTCTGTGAATTTTATCTATGTTTTGTTTTTTCTCTCTCCTACTTCAGGTTGCAG 
AACTTACAGATAATATCCAGCAGATAGTGGAGGCTCTTCAAAATTCACCTCATGTTGAAG 
TGCAGGTATTTTTTGTATTATGTGTCCTTTAATGTGTAAACTATTGAATTCCATCGTCTT 
TCCTTGCTAGTAGTATGGTAGTGTGTGATTGAACTTAAACCTTTCTATTAGGTATTTGAT 
TTTGATTATTCTGAGAGATAGCTTATCAAAACTGGTGGAACTGAAAAAATAATCTTCGTG 
TTACCTCTTTGTGTGCTTGGAAAACTTTTACCTTTATTTAATTGGACATACTTTTTTCTT 
CTTCTCAGGGTGACTTCATAAGGAAGCGCGATAATTGGCAAAATTGGGTGCTAAGGAGGA 
ACCCTACAGGTTCCGGCCCCCAATCTGTTGATAGGGCAGATGCAGTGGCAAAACGACTTG 
GAAACTTGTCAGTTGATCAGAGTTCGGCTGATCCCATTGGTGGTTCGAGCAGTCAGTTGC 
AACCTACAGAAGCTCTTTCAGATGATCAGCAACAGTCTTCTAGTACTGCTCCAGTGAGCA 
ACCACAACGCCCCAGATGGTGCAAACCGTTGAACCATCAAGTTTGGGGGCTGTTGGTTAG 
TGTTGGACATGAATATATTATTTTGTCTTGCCCAAAATGAGGAAAACAATAATGAAGGGG 
AATCAAAAAAGAAAGAAAAGAGATAAAAGCATAAAGAGAAGAGACGCATATGAAAAAAAA 
AAAAAAAGGATCAAACATTTGTGATTCTTCTAGCTAGCGGAAACTTTGGCATATTTATGG 
GTTCTTTTTTTTTTTGGTTATTTTTGGATGCTAATAACTTTTTTTTATGTTTATGCTACA 
TATGCTATGATCATTATTATGGTTGCTTGTAGCCATTGTTATGGTCTGGGATTTATTGGT 
TTTGCTTGCTAATACTCTCTTATAACCCCTGTTACTGTTTTTTTGTTCTGTTCTGGATTT 
CAATATTTCGATTGTTTTTATGGGTTTGAGAGAGT
>AT2G40010.1 |  60S acidic ribosomal protein P0 (RPP0A) 
ATGGCGGTGAAAGCAACAAAGGCGGAGAAGAAGATCGTTTACGATTCAAAGCTTTGTCAG 
CTTTTGAATGAGTACTCTCAGATTCTTGTCGTTGCAGCTGACAATGTTGGATCAACTCAG 
CTTCAGAACATAAGGAAAGGTTTACGAGGTGATTCAGTTGTTTTGATGGGGAAGAACACA 
ATGATGAAGAGATCTGTGAGGATTCATGCTGATAAAACTGGCAATCAAGCTTTCCTCAGT 
CTCCTTCCTCTTCTTCAGGTTTCATTTCTCTTGTCTTGAATAGTTTGTTTTCATTTGGAT 
ATAAAGTATTGATTTTTTGGTTTTGTGGAGAATTTGATTTGGTTTGGTGTTAGAATCTAT 
TTAACAGGGGAATGTTGGGTTGATCTTCACTAAGGGTGACTTGAAGGAAGTCAGTGAAGA 
GGTTGCTAAGTACAAGGTTTGTTTCTTTGGCTCAATTGATGTTATTGTTGTTGTTAAGCT 
TTAGTAGAGTTCAAATATGGATTGATAGCTTGGAAAGTGAAAGTTTGTATTTTTGAGTTT 
GAAATGAAATCATATGTGTTCTTGCTTAAAATGCAGCCACATTCTAATTGAGATTATTAT 
GATTCGTTGAGCTTTGAGGAGATTACATTTTCATTGATTGGTTTATTACTTAGTTTGGTT 
AGTTTTATGCTGTATCTGATTATCTCTAAGTAAGCAAGAATGCAAGGTGTTGTATTATTC 
GATTTTAAACACAAATGCAAACTTTCACTTTCCAAGCAAATAGGGTTGATTAGATTATAG 
TACTAGTTATTTTGGTTCATTGAGGTTTGAGGAGACGACATTTGTAGTTTCTGTTTTGTG 
TTTTGATTGATTGGTTTATTTTTAGCTTCTACTGTTACTTGATGATTTAGTCAGTTTATG 
ATCATCCTTTAACCTATGGCTTTAGGTTATTAACTTGTAAGGTGGATAGGTGATAAAGTT 
TGCATTTTGGTTTAAATTGGAACTCAAAACCTCTATTTTCTGTCTTGAAACGCAACCACA 
TTCAAGAAACTTACTTGAGAGTCTACTAGTTTCCTAGGCTCACATTTTTGTAGCGTCCTT 
TCATGTTGTTGGATTGATTGATTTTTTCAACTTAGTCTTGTACTGTTAATTGATGAGAAA 
TTCATTGTCCTTTTTTTGACAGGTTGGAGCTCCTGCTCGTGTAGGTTTAGTCGCTCCAAT 
TGATGTGGTCGTGCAACCAGGCAACACTGGTCTTGACCCTTCACAGACCTCCTTCTTCCA 
GGTGCTTAACATTCCAACCAAAATCAACAAAGGTACGGTTGAGATCATAACCCCTGTGGA 
GCTCATCAAGAAAGGCGACAAAGTCGGTTCATCCGAGGCTGCGCTTCTTGCCAAGCTTGG 
AATCAGGCCCTTTTCGTATGGTCTCGTTGTTGAGTCAGTCTACGATAATGGGTCAGTGTT 
TAACCCTGAAGTGCTTAACCTCACTGAAGACGACCTTGTTGAGAAGTTTGCAGCTGGTGT 
CTCGATGATCACTGCGCTTTCTCTTGCAATCTCTTACCCAACCGTAGCAGCTGCGCCTCA 
CATGTTCCTCAATGCTTACAAGAACGTTCTTGCTGTTGCCTTAGCTACTGAGTACTCTTT 
CCCTCAGGCTGAGAATGTGAAGGAGTTCCTAAAGGTTTGTCCTCTTTCATTTTGCGTTTC 
AGATATTGGGATTAGTAGTCATGAAATTGTTTGTTAACTGTACATTTATGGATCAGGATC 
CAACCAAGTTTGCAGTTGCAGTGGCTGCACCGGTTTCAGGAGAGTCTGGTGGAGCAGTGG 
TGGCAGTAGCTGTTGAGGAAGAAGCTGCAGAAGAGTCTGATGGGGACATGGGATTTGATC 
TGTTCGGTTAAAATACACCGTCTTATCTTTTGCCAGCCTTTCCTATTTATTTTATGGACC 
TTTAAAACTTTCACGTTCAGAATTTCTTTGTTACGTTTATGGATATTTTGTTTCTTCATC 
AAAACTACCTTTCTGGTTTTAATTTCTCTCCGTTGAGGAATTTTCTGAACCCAATTATAT 
TGGTTAACAATGTCATTGTCTGATTCTGTC
>AT2G29400.1 |  TOPP1 (TYPE ONE PROTEIN PHOSPHATASE 1) protein serine/threonine phosphatase 
AATATTGACTAATCTCAGAGCACACACCAGTCTTCGGGTCTCTCCTCCTCGCGGCTCGAA 
ACGCAAGCTTCACGCTTGAAAATCTCCGTTCGTTTTCTACCTCGTTTAGATCGGAGATGG 
CGGAGAAGCCGGCGCAAGAGCAAGAGCAGAAGCGAGCGATGGAACCTGCAGTTCTCGACG 
ATATTATTCGTCGTTTGGTTGAGTTTCGGAACACGAGACCTGGATCGGGGAAGCAAGTTC 
ATCTCAGTGAAGGTGAAATTCGTCAGCTTTGTGCTGTCTCCAAAGAAATATTTCTTCAAC 
AGCCCAATCTGCTTGAATTGGAAGCTCCCATCAAGATCTGCGGTCAGATTTTTGTTCCCT 
TTAGTTTAGAAAGAGTGCTTTTTTGGATTGGGGTTTTAGTTTTGATTGATTTTTAGAAGC 
GAATTTAGTGCATGTTTAGATAAAGTATCAAGCTTTGTTCAGTAGTAATGAGTTGAATTC 
TTAAAGCTATGTACATATCTAAGTGACTGAAGAAAAAATGTGAGATTTTGATTGTCTTTT 
GAGTTCAGAACAATGAAATCAAGCTAATGGGTAGTATAAAGTTTGAATTTTTATTACTAA 
AAGTCTTAGATAGGCTTAGGAGTTTTGACTGGTTCTATGAGGTTTGATTCATTTTATCTT 
AATGTTGACTAGTCAAGTTATGTGTTTTGATTGGGTCTGATAAAACATTTCCTGCAAAAG 
TTTAACGTTGACTAGTAGTATCTGATATGCCATGTTTTCTTAGATGTAATGGTTATATTT 
TGTCTTTTACTTTATAGGTGATATTCATGGGCAGTATTCAGATCTATTGAGGCTTTTTGA 
GTATGGAGGGTTCCCTCCCGAAGCTAATTATTTGTTCTTGGGTGATTATGTTGACCGTGG 
CAAGCAAAGCTTGGAAACAATATGTCTTCTTCTAGCTTACAAAATCAAGTACCCTGAGAA 
CTTCTTCTTGTTGAGAGGGAATCATGAATCTGCTTCCATTAATCGTATTTACGGTTTCTA 
TGATGAGTGCAAACGCAGGTTCAATGTCAGACTCTGGAAAATATTCACCGATTGCTTTAA 
CTGTCTTCCTGTGGCCGCCTTAATTGATGACAGAATACTATGTATGCATGGTGGGATTTC 
CCCAGAGCTGAAAAGTTTGGACCAGATTAGAAATATTGCACGGCCGATGGATATTCCGGA 
GTCTGGTTTGGTATGTGATTTACTATGGTCGGATCCTAGTGGAGACGTAGGCTGGGGCAT 
GAATGATCGTGGTGTTTCATACACTTTTGGAGCTGACAAAGTCGCAGAGTTCTTGGAGAA 
ACATGACATGGACCTTATCTGTCGTGCCCACCAGGTTTTAACTTGAGTTATATCTGCCAT 
TTAGTTTATTATGAAAACTGTGCAACCTTAATTTGAGTGTATTGGCTCTGTTTATAGGTT 
GTTGAAGATGGGTATGAGTTCTTTGCAGAAAGACAACTTGTTACAGTATTTTCAGCTCCC 
AACTATTGCGGGGAATTTGACAACGCTGGCGCAATGATGAGCATTGATGAGAGCTTAATG 
TGCTCATTCCAGATTCTAAAGCCGTCAGAAAAGAAGTCGCCTTTTCTGTGACACCGATTA 
TCCAGTGACCACCATTGCTTCAAATTAACAATTCTACAAAAGGTAAAAACTTTTTTATGC 
TATGGTAGCACCACATTTGTGTAACCCTGATTCAACATTCTCTGCTTCATGTTTAGCTTG 
TTCACCGTATCTAGCTTTTACTCTGAGTGGTACATACATATCAGCCTCAGGAAAATGAAA 
TGGAAAACATGTATTCGTTAAGCTAGTTATAATGGGTTTTTTTGAGTTCCTGTCACAGAG 
ATGAGTTCAAAATCACACAATAGTTTTCTTCTCTTACATTTCTGTGTAATTAGCTCATGT 
TGCTTATAATTTGTCATCAAGAAACAGTGTTAATCTTTGAGGTTTGGTCACTGTATGCTG 
AATGTTCTTATGTGGCTCAGCTTTTGATTATCATTTTGCATTTTGTTAATTTGCTGCAGT 
TGTATACTGGCAAGAGGATCTAGAGACGGAAACTGCTCAATTGGGACCTTAATGGTACTG 
ATAATAGAGCATTAGACATGTAGCTGTTGACAGTGATGGCATCGAGCAGAAGGAACAAGT 
CAAGTCTGTACTGTGATTTTAGCATCTCTCACATCTATGTTTGTCTAAAATGTGTGTGTG 
TTTTTAGTCTTCTCTCTGAATAATATTAGATTCTCATTTGTACTCTCTATTTATTTAGGA 
GAACCCAAATTCAAAACTTTTTTTAGTCTCTTCACCACC
>AT1G73840.1 |  ESP1 (ENHANCED SILENCING PHENOTYPE 1) 
ACAGGTTAAGCTCGGTAGCGATTACCGACGAGAACCATGGCGGGTAAGCAGATCGGCGGA 
GACGGAGGTTTACCGGCAAATCTCGCCGGAATGACTAAAAGTCAGCTCTATGATATTATG 
TCTCAAATGAAGGTTCTCTCTTCTTTCTTTTCTATACTTTTCCGATTATCAGCTATAACA 
CTATCCTTTACGGATTTGAATAGAGAACAATTGATTTCTTCTTCTTTTTTTCGAATTCTG 
TTTTTTTGATCAGTCGAATCTAATTGTGCAGACGTTGATTGATCAAAACCATCAACAAGC 
GAGGGAGATTCTGATTCGGAACCCTCTTTTGACGAAGGCTCTTTTCCAGGTTCTTCTTCA 
CTTCGCTAATCTTTTCCATCTTCTAAATCTGCAATCCGTGTGGTCTTATAAGCAATGAGG 
AATTCTGATTTGGAGCTTCTTACTTGAGTAAATTGATTGGACTAGTTTGGGTTTAGTATT 
GTTGAAGAAGCAGGTAGGTTAACAATTAGGGTTTTGTGTTAGTTTCCAGATATGAACAAT 
CTTTAGGTTTATGCCTCTATTTACAAATAGATTTCAGAATTTGTATATGGTGATGATGAT 
GCTATGTTTGTTGAAATGCCAGGCACAAATCATGCTCGGAATGGTTCAGCCTCCTCAAGT 
GGTATGTACTTGCGTCCTCTTAAGTCATTTTGTTAATAGATTTCATTTCAAGCATCTTAA 
ATTTTACAAAAATCTGTTTCTATTAGACTCCGAAAGTTGAGCCACAAGCTGTACAACAAC 
CTCAACAATCTCATCAATCTATCCCGCCAAAGCCAAACGTTCAAGCTCATATGTCTTCTT 
TCCAAGGCGGTGGCAGTGTACATGAGCCAGCCAATACGATGCAGCCACAAGCCCCGATTC 
GAAAACACCCAACACCACAACCAATGCCTATGCCTCCACCACCGCCTTCTGTTTCTGCAA 
ATAGTGCTCAATCACAGCCTCGTTTTTCGCATCCCCAGCGTCAGGGACATCTGAATCCTG 
CTGTCACTTCTATGTCTCATCCACAGTCTTCTCAAGTTCAAAACGCGCCTCCTCCGGCTT 
CCCATCATCCAACATCCCAGCAACCTCCTTTTCATCATCTTGATATACCAGCTTCCTCCA 
CTCAGTTGCAACAACAACCAATGCACTCTGGTGGAGGTCCTCATGTGGCACAGCAACAGT 
CTAGACCATATCATCATCAATATGGACAAGCTCAAACTGGTCCAAACACTGGATTTCAGC 
ACCATGGCGCACCTACTCAGCATCTTTCTCAACCCATGTATCATGTGAGTCAGAGTTATG 
ACTTATGAGTAGCTATTGTCGGTTTCCTTTTATTTCCCTCATTGTGAATTATGAAGTTTT 
TGACTGACTAGAACTCGTTATTTGAGCCAATTTTGCAGTCAGGCAACAGACCCCCTGCTT 
CCGGTGGACCTCAATTCCCGCAGGGACAGCCACATCTGCCTAGTCAGCCAACATATCAGG 
TATTGATACTCTTACTTTTTGACCTTTAGGCGATATGTTTGATGTTTTGCAGACTGAGTA 
TGAAATTATGTTGCTTTATCTATGTGCTTTCTTCCGAGCACTACACCTTCAACGAGTAGA 
GATTACCCTTTAATGAGAATTCTCTCAAACATCTATCATTGTTATTCTTAATCAGATATG 
AGAAATGATTTCTTCTGGCAATAATTCTTCTCATCTTTTTTCATTGTCAAGCTATCATCA 
TATTTCTAGACTTCTAGTTCTGATTCCGTTAAAATCATGTTCTGCTTTAGATTAATAAAT 
CATCTAAATGGAAACTCTACATCTTTTTGGTTTTGCTTTTGGGTCTCACTGCTTGTAATC 
TTGTTTATTGTTTCAGGGAGGAGGTCAATATCGTGGAGACTACAACAATAACCAATTAGC 
AGGTCTGATGGCTCAAGACAGAGGTCCTTCTTGGATGGCTGGCCAATCAGAGAGCTCGAA 
CATTACTCATCTGCCAGGCTTAGGACCGGTGCCTCCACCAAGCCAAGTTGGGCCTGGAGG 
TGGCCCACCACCTCGCCCTGCACCGGTAATTTATCTTTTAACTGCAAGGCACAGCCATTG 
AACCGCTGTTACTGCTAGGATGTATATTCATGTCGATGACTCTGTAGTTTTATTAGCCCC 
CCCAAATCAATCAAATTCGACGTTCCTTTCCAGTAGATGTTGTAGTTGTCTTTTGCCGGA 
ATTCAAAATGAGAATTTCTGATTACAGAGCAAAGAGCTTTTGTTATTTTTTGCTGATGAT 
TGTGTTTTTCTTACTTGTGCAGATATCTGCAGAGATGGAGAAGGCACTACTTCAACAAGT 
GATGAGCCTTACACCAGAGCAGATCAATCTGCTGCCACCAGAACAGAGAAACCAAGTCCT 
TCAGCTTCAACAGATTCTCCGACAGTGAATCTCATAGATAATCGCTTGGTCTCCTCCATG 
TTAGAACTTTGAAGAGACAGGTTTTGGCTTTGAATGTAAGGCCTGAGTTAAGTTTGGGAT 
AATTTGTAAAAAGAAGAAAAGTAATTAGATTTTTTCAAAGTTCAAGGTATCACTAAATAC 
CTTTGGTCATATCCCCTGGAGAAAATTTATGTGTTCTCTTTGATTTAATGTTCAGTAACA 
ATTTTCTTCCTGAATTTCAAAGTTACGAAATCTTGCTTAC
>AT3G48960.1 |  60S ribosomal protein L13 (RPL13C) 
ATGAAGCACAATAATGTTATCCCCAATGGTCACTTCAAAAAGAAGTGGGAAAACTATGTC 
AAAACTTCGTTCAACCAACCTGCCATGAAAACCAGAAGAAGAATTGGTTAGTAGTAATGT 
CACCACTACTACTGCTTTTGCTATCTTAATGTCACCACTACTATATTTTTTTTTGGTTTT 
ATGTGCCATGGTTTTATTAGAAGTTTTACCATAATCCCATCTCAATTTGATTATTTGGTG 
TGTAATGTTTACTCAGCGAGGCAGAATAAGGCTGTGAAGATCTTTCCCCGTCCCACTGCT 
GGACCTATCCGACCTGTTGTACATGCTCAGACTCTTACGTACAACATGAAAGTCAGAGCC 
GGTAAAGGATTCACTCTTGAAGAGCTAAAGGTTTGTAATATCTCTCTGTTCTTCATTAGC 
TTTTGTGTTTTGTTTCTTGTTGGATATCGTTTAAATTGTTTTTTCTTTCTGATTGTTGAT 
AAATTTAGGCTGCTGGTATCCCCAAGAAGTTGGCTCCTACAATCGGTATTTCTGTTGACC 
ATCATCGCAAGAACCGGTCTTTGGAGGGTTTTCAAACCAACGTCCAGAGGCTGAAAACCT 
ACAAGGCTAAGTTGGTTATCTTCCCGCGCTGTGCCCGAACGGTCAAGGTACTCCTTCGCA 
AGCAACTGGTTTAGGGTTCAGTGGACTGTATGAATGGAATGGATTTGGATATGATCTCTT 
TGTTGTTATGCTTTTGTTTGTGTTTAGGTTGGTGATTCTGCACAACAAGAGTTGGCCAAT 
GCAACACAAGTCCAAGTAGATCACATGCCTATCGTTCGTGAAATGCCAACAATGGAGCTT 
GTGAAGCTGACATCTGACATGAAATTGTTCAATGCTTATGACAAGATCCGTCTAGAGGGC 
ATAAACAAGAGACATGCTGGTGTTAGAGCCAAGAGAGCTGCTGAGGCTGAGAAAGAAGAG 
AAGAAGTGA
>AT1G17370.1 |  UBP1B (oligouridylate binding protein 1B) mRNA 3-UTR binding 
GATTGCTTCCTTCGCTTTCTATCAAGAGACTTCCTTTTTTTTTTCCTGTTCTTCATTTTT 
TTTTTGTTATTAATATTTTGTCATTTTTCTTACATTTTTCTCGAACACCGAAAACACTTT 
CGAACCCTAAAAGACAGAACACTGTGTCAATTTTCATTACCTGGGAACGAAAAGCAAAAT 
CAAAGACAATAATTTTTTCCCCGAGAGAGAAAATGCAGAGGTTGAAGCAGCAGCAGCAGC 
AGCAACAAGTTATGATGCAGCAAGCTCTTATGCAGCAACAGTCTCTCTACCATCCTGGTC 
TCCTTGCCCCGCCACAGGTTTGCTCTATTCTTCTTCCATTTCCATGCTCGATTTGGGTTT 
CTAGGCTCTTTTTCCCAAGCTCGATTTCACTGGTTTTTCTCTCTTTTTTGTTGTATAAGG 
TCCAAGATTAGGAACTCGAGATTTTTGGTTTCATTTTCTATGATTGAAGATGCTTGTTTC 
TCTTGTTTTTTGTTTCATTTTTGATTGGTCAAACGAGAAAAAGTTTTGAAATTTATGGGG 
ATTACCACTAATAGACTTGCTTCTTGTGTATTCGTTACATTTCTTTTAAAGTGTTTGTCT 
TATTATCTGATATTTGGTTCAACAACTCCATGAAAATCTTTGAGGTGAGACTGATTCGTT 
ATCGTAGCTTAGTTGCTGAGACTTTAGGAAGTAAAGTTTTTTCCTTTATTTCTTTCTTTT 
TCATTTTCTTTGGCTTCCTATTTTTTTCCTTTTTGCAGATAGAACCAATCCCAAGTGGAA 
ATCTCCCCCCTGGTTTTGATCCAAGTACTTGCCGCAGTGTGTGAGTGTTAGGTTTCGTTT 
TTTCTTTTGGTATTTTTGTTCACTTTTTATGTATGTTTTGGTGTTTTGGCTTTAAAAGTT 
TCAGTAGTGAACTCAAGTTTTCAGTTTGTCACTCTCAAAGCTAGTCCAGGGAAACACTTC 
TGCATTGTAGTTATGTACTATATTATATAGTTCATACTTGTACAGTTGAATTTGACAACG 
TTTCTCTAAAGACTTGTTTCTATTTTCTAGAAAAGGTGATTCTTTGTTATGATGCCCTCA 
TAGGTGATTCTTCTTGATGTTGAGGGACTTGTAGCCCTGCTAATTTTTATGTTTTTGTTT 
CATTGTTCTGTTTCTTGTTTAGATTTTTAGTCTGCCTGCCTTTGAGAAATTGCAGGTACG 
TTGGAAACATCCATATTCAGGTGACGGAACCTCTGCTTCAAGAGGTTTTTGCTGGCACTG 
GTCCTGTAGAAAGCTGTAAACTAATTAGGAAAGAAAAGGTGTGTTATGTTACACTTTTAT 
AACATTCTAGTAGTAATCTTCAGGATGTTTAATCTTTTATGTTGAAACTTTTGCTTTTGG 
TATTGGCTATGATTGACACATTTATCTGATGCAGTCTTCTTATGGGTTTGTGCACTACTT 
TGATCGAAGATCGGCTGGTCTTGCAATCCTTTCTCTCAATGGAAGGCATTTGTAAGTTAA 
TGGACATGATTATTAGCCTTTGGGCATTTTAGCATGAACAAGATACTCTGTTTTCCAAGT 
TTTGGATTACATTGTTTACTCTAATGTGCAGGTTTGGGCAACCTATCAAGGTTAACTGGG 
CTTATGCGAGTGGCCAGAGGGAGGATACATCAAGTTGGTTCACAATCTTATGCTTGATTT 
CTTGCTAAAACAGTATTTTGGGTGTTCTATTGATACAATAACGCACTTCTGTGATCTTCA 
TGTGCAGGTCACTTCAATATATTTGTTGGGGATTTGAGTCCGGAGGTTACTGATGCAATG 
CTGTTTACTTGCTTCTCTGTCTACCCGACTTGCTCGTAAGTTTTTTATACCATCCTCAGC 
ATTCTTGTATTGGAAATGGAAGTTTAAGATTTGCAGAAACTCTTCCGACAATTGCTATTG 
TATGTAGGGATGCAAGAGTTATGTGGGATCAGAAAACTGGGCGTTCAAGAGGATTTGGAT 
TTGTTTCCTTCCGTAACCAACAGGTACTTGACTGTCTAACTCTCAGTCCTTGTGTATAGA 
TTGGCTTTTACTTTAAACACTGATCGATTGCTGCAAATCTTATTTCCTTATGCAGGATGC 
CCAGACTGCAATAGATGAGATAACTGGTGAGTGTTGCAATTTGTTTTCCCCCTTGATAGT 
TGATGTTAATATTTTGTTATTTTAGCTTTGTGTTTTTGAGCTTATTGTAATTGGTGGGAG 
ATTCTCTTCTGCTTTTCAGGGAAATGGCTTGGTTCCAGGCAGATACGTTGCAACTGGGCG 
ACAAAGGGAGCCACTTCTGGTGAGGACAAACAGAGCTCTGATTCCAAAAGCGTCGTGGAA 
CTTACCAGTGGTGTCTCGGGTATGTTTAACTATTACCTATCATGAAATAGAAAATCAAAT 
GGAAATAGAGAAAAGCCTCAAATAAACTTAATTCTTAACCCTTTGATGTTTATACATTGG 
CTTATTTGTTCCTGCAGAGGATGGTAAAGATACTACTAATGGTGAAGCTCCTGAGAACAA 
TGCTCAGTACACAACTGTTTACGTCGGTAATCTTGCTCCAGAGGTAAAATAGAAAAACTG 
TTATAGGTATTCTGTGACTTAACTCAACCATCATCCATACCTTTTTTGAATCAAAGATAT 
TTTCGTTATCCAGGTGTCCCAGGTTGATCTTCACCGCCACTTCCATTCCCTTGGTGCTGG 
GGTCATAGAGGAAGTCCGTGTTCAAAGAGACAAAGGTTTCGGATTTGTGAGATACTCTAC 
TCATGTAGAGGCAGCCCTCGCTATTCAGATGGGAAACACACATTCCTACCTTAGTGGCAG 
GCAAATGAAGGTAAAACTAACTAACTTAAACTGTTCTTTTGTGGGACTCACCATTCTTTT 
TGGTTTGGGAATGCTAAAATTGTTGTGTTCGTTGTTCCTACAGTGTTCTTGGGGAAGCAA 
GCCAACTCCAGCAGGAACAGCTTCAAACCCGCTTCCTCCACCAGCTCCTGCACCAATCCC 
GGGATTCTCAGCGAGTGATCTCTTGGCTTACGAGAGGCAACTAGCGATGAGCAAGATGGC 
AGGAATGAATCCGATGATGCATCACCCGCAGGGACAACATGCTTTTAAACAAGCTGCAAT 
GGGAGCCACTGGTTCAAACCAGGCAATATATGACGGTGGTTACCAGAACGCGCAGCAGCT 
CATGTACTACCAGTAAGATCTTCCTCGGAGCCGTTACTTGAGCGAAGAGTTCTTTCTTTT 
CTTCTTTTTTGTTATGTAACGTCTTTATTGTATCTTTTTCTTTTCTTCTAACTTATGTTC 
TTGTTATAATGTTATCATGTAGCTGTGGGTTTGTGGTTTGTGTTCCACGTTTTTTCTTTT 
GTTAACTACTACGGTTTACGTTTTTGCACATCTTCAACTTCTTTCTCTTTCTCTTTCTCT 
AACTTAATCTTATTTATTGGGTCGTAAGTTCGTATATCTTATGTAGAACCATTATAATTT 
GAAGTTTTTACCTCTC
>AT1G17370.1 |  UBP1B (oligouridylate binding protein 1B) mRNA 3-UTR binding 
GATTGCTTCCTTCGCTTTCTATCAAGAGACTTCCTTTTTTTTTTCCTGTTCTTCATTTTT 
TTTTTGTTATTAATATTTTGTCATTTTTCTTACATTTTTCTCGAACACCGAAAACACTTT 
CGAACCCTAAAAGACAGAACACTGTGTCAATTTTCATTACCTGGGAACGAAAAGCAAAAT 
CAAAGACAATAATTTTTTCCCCGAGAGAGAAAATGCAGAGGTTGAAGCAGCAGCAGCAGC 
AGCAACAAGTTATGATGCAGCAAGCTCTTATGCAGCAACAGTCTCTCTACCATCCTGGTC 
TCCTTGCCCCGCCACAGGTTTGCTCTATTCTTCTTCCATTTCCATGCTCGATTTGGGTTT 
CTAGGCTCTTTTTCCCAAGCTCGATTTCACTGGTTTTTCTCTCTTTTTTGTTGTATAAGG 
TCCAAGATTAGGAACTCGAGATTTTTGGTTTCATTTTCTATGATTGAAGATGCTTGTTTC 
TCTTGTTTTTTGTTTCATTTTTGATTGGTCAAACGAGAAAAAGTTTTGAAATTTATGGGG 
ATTACCACTAATAGACTTGCTTCTTGTGTATTCGTTACATTTCTTTTAAAGTGTTTGTCT 
TATTATCTGATATTTGGTTCAACAACTCCATGAAAATCTTTGAGGTGAGACTGATTCGTT 
ATCGTAGCTTAGTTGCTGAGACTTTAGGAAGTAAAGTTTTTTCCTTTATTTCTTTCTTTT 
TCATTTTCTTTGGCTTCCTATTTTTTTCCTTTTTGCAGATAGAACCAATCCCAAGTGGAA 
ATCTCCCCCCTGGTTTTGATCCAAGTACTTGCCGCAGTGTGTGAGTGTTAGGTTTCGTTT 
TTTCTTTTGGTATTTTTGTTCACTTTTTATGTATGTTTTGGTGTTTTGGCTTTAAAAGTT 
TCAGTAGTGAACTCAAGTTTTCAGTTTGTCACTCTCAAAGCTAGTCCAGGGAAACACTTC 
TGCATTGTAGTTATGTACTATATTATATAGTTCATACTTGTACAGTTGAATTTGACAACG 
TTTCTCTAAAGACTTGTTTCTATTTTCTAGAAAAGGTGATTCTTTGTTATGATGCCCTCA 
TAGGTGATTCTTCTTGATGTTGAGGGACTTGTAGCCCTGCTAATTTTTATGTTTTTGTTT 
CATTGTTCTGTTTCTTGTTTAGATTTTTAGTCTGCCTGCCTTTGAGAAATTGCAGGTACG 
TTGGAAACATCCATATTCAGGTGACGGAACCTCTGCTTCAAGAGGTTTTTGCTGGCACTG 
GTCCTGTAGAAAGCTGTAAACTAATTAGGAAAGAAAAGGTGTGTTATGTTACACTTTTAT 
AACATTCTAGTAGTAATCTTCAGGATGTTTAATCTTTTATGTTGAAACTTTTGCTTTTGG 
TATTGGCTATGATTGACACATTTATCTGATGCAGTCTTCTTATGGGTTTGTGCACTACTT 
TGATCGAAGATCGGCTGGTCTTGCAATCCTTTCTCTCAATGGAAGGCATTTGTAAGTTAA 
TGGACATGATTATTAGCCTTTGGGCATTTTAGCATGAACAAGATACTCTGTTTTCCAAGT 
TTTGGATTACATTGTTTACTCTAATGTGCAGGTTTGGGCAACCTATCAAGGTTAACTGGG 
CTTATGCGAGTGGCCAGAGGGAGGATACATCAAGTTGGTTCACAATCTTATGCTTGATTT 
CTTGCTAAAACAGTATTTTGGGTGTTCTATTGATACAATAACGCACTTCTGTGATCTTCA 
TGTGCAGGTCACTTCAATATATTTGTTGGGGATTTGAGTCCGGAGGTTACTGATGCAATG 
CTGTTTACTTGCTTCTCTGTCTACCCGACTTGCTCGTAAGTTTTTTATACCATCCTCAGC 
ATTCTTGTATTGGAAATGGAAGTTTAAGATTTGCAGAAACTCTTCCGACAATTGCTATTG 
TATGTAGGGATGCAAGAGTTATGTGGGATCAGAAAACTGGGCGTTCAAGAGGATTTGGAT 
TTGTTTCCTTCCGTAACCAACAGGTACTTGACTGTCTAACTCTCAGTCCTTGTGTATAGA 
TTGGCTTTTACTTTAAACACTGATCGATTGCTGCAAATCTTATTTCCTTATGCAGGATGC 
CCAGACTGCAATAGATGAGATAACTGGTGAGTGTTGCAATTTGTTTTCCCCCTTGATAGT 
TGATGTTAATATTTTGTTATTTTAGCTTTGTGTTTTTGAGCTTATTGTAATTGGTGGGAG 
ATTCTCTTCTGCTTTTCAGGGAAATGGCTTGGTTCCAGGCAGATACGTTGCAACTGGGCG 
ACAAAGGGAGCCACTTCTGGTGAGGACAAACAGAGCTCTGATTCCAAAAGCGTCGTGGAA 
CTTACCAGTGGTGTCTCGGGTATGTTTAACTATTACCTATCATGAAATAGAAAATCAAAT 
GGAAATAGAGAAAAGCCTCAAATAAACTTAATTCTTAACCCTTTGATGTTTATACATTGG 
CTTATTTGTTCCTGCAGAGGATGGTAAAGATACTACTAATGGTGAAGCTCCTGAGAACAA 
TGCTCAGTACACAACTGTTTACGTCGGTAATCTTGCTCCAGAGGTAAAATAGAAAAACTG 
TTATAGGTATTCTGTGACTTAACTCAACCATCATCCATACCTTTTTTGAATCAAAGATAT 
TTTCGTTATCCAGGTGTCCCAGGTTGATCTTCACCGCCACTTCCATTCCCTTGGTGCTGG 
GGTCATAGAGGAAGTCCGTGTTCAAAGAGACAAAGGTTTCGGATTTGTGAGATACTCTAC 
TCATGTAGAGGCAGCCCTCGCTATTCAGATGGGAAACACACATTCCTACCTTAGTGGCAG 
GCAAATGAAGGTAAAACTAACTAACTTAAACTGTTCTTTTGTGGGACTCACCATTCTTTT 
TGGTTTGGGAATGCTAAAATTGTTGTGTTCGTTGTTCCTACAGTGTTCTTGGGGAAGCAA 
GCCAACTCCAGCAGGAACAGCTTCAAACCCGCTTCCTCCACCAGCTCCTGCACCAATCCC 
GGGATTCTCAGCGAGTGATCTCTTGGCTTACGAGAGGCAACTAGCGATGAGCAAGATGGC 
AGGAATGAATCCGATGATGCATCACCCGCAGGGACAACATGCTTTTAAACAAGCTGCAAT 
GGGAGCCACTGGTTCAAACCAGGCAATATATGACGGTGGTTACCAGAACGCGCAGCAGCT 
CATGTACTACCAGTAAGATCTTCCTCGGAGCCGTTACTTGAGCGAAGAGTTCTTTCTTTT 
CTTCTTTTTTGTTATGTAACGTCTTTATTGTATCTTTTTCTTTTCTTCTAACTTATGTTC 
TTGTTATAATGTTATCATGTAGCTGTGGGTTTGTGGTTTGTGTTCCACGTTTTTTCTTTT 
GTTAACTACTACGGTTTACGTTTTTGCACATCTTCAACTTCTTTCTCTTTCTCTTTCTCT 
AACTTAATCTTATTTATTGGGTCGTAAGTTCGTATATCTTATGTAGAACCATTATAATTT 
GAAGTTTTTACCTCTC
>AT1G17370.2 |  UBP1B (oligouridylate binding protein 1B) mRNA 3-UTR binding 
GATTGCTTCCTTCGCTTTCTATCAAGAGACTTCCTTTTTTTTTTCCTGTTCTTCATTTTT 
TTTTTGTTATTAATATTTTGTCATTTTTCTTACATTTTTCTCGAACACCGAAAACACTTT 
CGAACCCTAAAAGACAGAACACTGTGTCAATTTTCATTACCTGGGAACGAAAAGCAAAAT 
CAAAGACAATAATTTTTTCCCCGAGAGAGAAAATGCAGAGGTTGAAGCAGCAGCAGCAGC 
AGCAACAAGTTATGATGCAGCAAGCTCTTATGCAGCAACAGTCTCTCTACCATCCTGGTC 
TCCTTGCCCCGCCACAGGTTTGCTCTATTCTTCTTCCATTTCCATGCTCGATTTGGGTTT 
CTAGGCTCTTTTTCCCAAGCTCGATTTCACTGGTTTTTCTCTCTTTTTTGTTGTATAAGG 
TCCAAGATTAGGAACTCGAGATTTTTGGTTTCATTTTCTATGATTGAAGATGCTTGTTTC 
TCTTGTTTTTTGTTTCATTTTTGATTGGTCAAACGAGAAAAAGTTTTGAAATTTATGGGG 
ATTACCACTAATAGACTTGCTTCTTGTGTATTCGTTACATTTCTTTTAAAGTGTTTGTCT 
TATTATCTGATATTTGGTTCAACAACTCCATGAAAATCTTTGAGGTGAGACTGATTCGTT 
ATCGTAGCTTAGTTGCTGAGACTTTAGGAAGTAAAGTTTTTTCCTTTATTTCTTTCTTTT 
TCATTTTCTTTGGCTTCCTATTTTTTTCCTTTTTGCAGATAGAACCAATCCCAAGTGGAA 
ATCTCCCCCCTGGTTTTGATCCAAGTACTTGCCGCAGTGTGTGAGTGTTAGGTTTCGTTT 
TTTCTTTTGGTATTTTTGTTCACTTTTTATGTATGTTTTGGTGTTTTGGCTTTAAAAGTT 
TCAGTAGTGAACTCAAGTTTTCAGTTTGTCACTCTCAAAGCTAGTCCAGGGAAACACTTC 
TGCATTGTAGTTATGTACTATATTATATAGTTCATACTTGTACAGTTGAATTTGACAACG 
TTTCTCTAAAGACTTGTTTCTATTTTCTAGAAAAGGTGATTCTTTGTTATGATGCCCTCA 
TAGGTGATTCTTCTTGATGTTGAGGGACTTGTAGCCCTGCTAATTTTTATGTTTTTGTTT 
CATTGTTCTGTTTCTTGTTTAGATTTTTAGTCTGCCTGCCTTTGAGAAATTGCAGGTACG 
TTGGAAACATCCATATTCAGGTGACGGAACCTCTGCTTCAAGAGGTTTTTGCTGGCACTG 
GTCCTGTAGAAAGCTGTAAACTAATTAGGAAAGAAAAGGTGTGTTATGTTACACTTTTAT 
AACATTCTAGTAGTAATCTTCAGGATGTTTAATCTTTTATGTTGAAACTTTTGCTTTTGG 
TATTGGCTATGATTGACACATTTATCTGATGCAGTCTTCTTATGGGTTTGTGCACTACTT 
TGATCGAAGATCGGCTGGTCTTGCAATCCTTTCTCTCAATGGAAGGCATTTGTAAGTTAA 
TGGACATGATTATTAGCCTTTGGGCATTTTAGCATGAACAAGATACTCTGTTTTCCAAGT 
TTTGGATTACATTGTTTACTCTAATGTGCAGGTTTGGGCAACCTATCAAGGTTAACTGGG 
CTTATGCGAGTGGCCAGAGGGAGGATACATCAAGTTGGTTCACAATCTTATGCTTGATTT 
CTTGCTAAAACAGTATTTTGGGTGTTCTATTGATACAATAACGCACTTCTGTGATCTTCA 
TGTGCAGGTCACTTCAATATATTTGTTGGGGATTTGAGTCCGGAGGTTACTGATGCAATG 
CTGTTTACTTGCTTCTCTGTCTACCCGACTTGCTCGTAAGTTTTTTATACCATCCTCAGC 
ATTCTTGTATTGGAAATGGAAGTTTAAGATTTGCAGAAACTCTTCCGACAATTGCTATTG 
TATGTAGGGATGCAAGAGTTATGTGGGATCAGAAAACTGGGCGTTCAAGAGGATTTGGAT 
TTGTTTCCTTCCGTAACCAACAGGTACTTGACTGTCTAACTCTCAGTCCTTGTGTATAGA 
TTGGCTTTTACTTTAAACACTGATCGATTGCTGCAAATCTTATTTCCTTATGCAGGATGC 
CCAGACTGCAATAGATGAGATAACTGGTGAGTGTTGCAATTTGTTTTCCCCCTTGATAGT 
TGATGTTAATATTTTGTTATTTTAGCTTTGTGTTTTTGAGCTTATTGTAATTGGTGGGAG 
ATTCTCTTCTGCTTTTCAGGGAAATGGCTTGGTTCCAGGCAGATACGTTGCAACTGGGCG 
ACAAAGGGAGCCACTTCTGGTGAGGACAAACAGAGCTCTGATTCCAAAAGCGTCGTGGAA 
CTTACCAGTGGTGTCTCGGGTATGTTTAACTATTACCTATCATGAAATAGAAAATCAAAT 
GGAAATAGAGAAAAGCCTCAAATAAACTTAATTCTTAACCCTTTGATGTTTATACATTGG 
CTTATTTGTTCCTGCAGAGGATGGTAAAGATACTACTAATGGTGAAGCTCCTGAGAACAA 
TGCTCAGTACACAACTGTTTACGTCGGTAATCTTGCTCCAGAGGTAAAATAGAAAAACTG 
TTATAGGTATTCTGTGACTTAACTCAACCATCATCCATACCTTTTTTGAATCAAAGATAT 
TTTCGTTATCCAGGTGTCCCAGGTTGATCTTCACCGCCACTTCCATTCCCTTGGTGCTGG 
GGTCATAGAGGAAGTCCGTGTTCAAAGAGACAAAGGTTTCGGATTTGTGAGATACTCTAC 
TCATGTAGAGGCAGCCCTCGCTATTCAGATGGGAAACACACATTCCTACCTTAGTGGCAG 
GCAAATGAAGGTAAAACTAACTAACTTAAACTGTTCTTTTGTGGGACTCACCATTCTTTT 
TGGTTTGGGAATGCTAAAATTGTTGTGTTCGTTGTTCCTACAGTGTTCTTGGGGAAGCAA 
GCCAACTCCAGCAGGAACAGCTTCAAACCCGCTTCCTCCACCAGCTCCTGCACCAATCCC 
GGGATTCTCAGCGAGTGATCTCTTGGCTTACGAGAGGCAACTAGCGATGAGCAAGATGGC 
AGGAATGAATCCGATGATGCATCACCCGCAGGGACAACATGCTTTTAAACAAGCTGCAAT 
GGGAGCCACTGGTTCAAACCAGGCAATATATGACGGTGGTTACCAGAACGCGCAGCAGCT 
CATGTACTACCAGTAAGATCTTCCTCGGAGCCGTTACTTGAGCGAAGAGTTCTTTCTTTT 
CTTCTTTTTTGTTATGTAACGTCTTTATTGTATCTTTTTCTTTTCTTCTAACTTATGTTC 
TTGTTATAATGTTATCATGTAGCTGTGGGTTTGTGGTTTGTGTTCCACGTTTTTTCTTTT 
GTTAACTACTACGGTTTACGTTTTTGCACATCTTCAACTTCTTTCTCTTTCTCTTTCTCT 
AACTTAATCTTATTTATTGGGTCGTAAGTTCGTATATCTTATGTAGAACCATTATAATTT 
GAAGTTTTTACCTCTC
>AT1G17370.2 |  UBP1B (oligouridylate binding protein 1B) mRNA 3-UTR binding 
GATTGCTTCCTTCGCTTTCTATCAAGAGACTTCCTTTTTTTTTTCCTGTTCTTCATTTTT 
TTTTTGTTATTAATATTTTGTCATTTTTCTTACATTTTTCTCGAACACCGAAAACACTTT 
CGAACCCTAAAAGACAGAACACTGTGTCAATTTTCATTACCTGGGAACGAAAAGCAAAAT 
CAAAGACAATAATTTTTTCCCCGAGAGAGAAAATGCAGAGGTTGAAGCAGCAGCAGCAGC 
AGCAACAAGTTATGATGCAGCAAGCTCTTATGCAGCAACAGTCTCTCTACCATCCTGGTC 
TCCTTGCCCCGCCACAGGTTTGCTCTATTCTTCTTCCATTTCCATGCTCGATTTGGGTTT 
CTAGGCTCTTTTTCCCAAGCTCGATTTCACTGGTTTTTCTCTCTTTTTTGTTGTATAAGG 
TCCAAGATTAGGAACTCGAGATTTTTGGTTTCATTTTCTATGATTGAAGATGCTTGTTTC 
TCTTGTTTTTTGTTTCATTTTTGATTGGTCAAACGAGAAAAAGTTTTGAAATTTATGGGG 
ATTACCACTAATAGACTTGCTTCTTGTGTATTCGTTACATTTCTTTTAAAGTGTTTGTCT 
TATTATCTGATATTTGGTTCAACAACTCCATGAAAATCTTTGAGGTGAGACTGATTCGTT 
ATCGTAGCTTAGTTGCTGAGACTTTAGGAAGTAAAGTTTTTTCCTTTATTTCTTTCTTTT 
TCATTTTCTTTGGCTTCCTATTTTTTTCCTTTTTGCAGATAGAACCAATCCCAAGTGGAA 
ATCTCCCCCCTGGTTTTGATCCAAGTACTTGCCGCAGTGTGTGAGTGTTAGGTTTCGTTT 
TTTCTTTTGGTATTTTTGTTCACTTTTTATGTATGTTTTGGTGTTTTGGCTTTAAAAGTT 
TCAGTAGTGAACTCAAGTTTTCAGTTTGTCACTCTCAAAGCTAGTCCAGGGAAACACTTC 
TGCATTGTAGTTATGTACTATATTATATAGTTCATACTTGTACAGTTGAATTTGACAACG 
TTTCTCTAAAGACTTGTTTCTATTTTCTAGAAAAGGTGATTCTTTGTTATGATGCCCTCA 
TAGGTGATTCTTCTTGATGTTGAGGGACTTGTAGCCCTGCTAATTTTTATGTTTTTGTTT 
CATTGTTCTGTTTCTTGTTTAGATTTTTAGTCTGCCTGCCTTTGAGAAATTGCAGGTACG 
TTGGAAACATCCATATTCAGGTGACGGAACCTCTGCTTCAAGAGGTTTTTGCTGGCACTG 
GTCCTGTAGAAAGCTGTAAACTAATTAGGAAAGAAAAGGTGTGTTATGTTACACTTTTAT 
AACATTCTAGTAGTAATCTTCAGGATGTTTAATCTTTTATGTTGAAACTTTTGCTTTTGG 
TATTGGCTATGATTGACACATTTATCTGATGCAGTCTTCTTATGGGTTTGTGCACTACTT 
TGATCGAAGATCGGCTGGTCTTGCAATCCTTTCTCTCAATGGAAGGCATTTGTAAGTTAA 
TGGACATGATTATTAGCCTTTGGGCATTTTAGCATGAACAAGATACTCTGTTTTCCAAGT 
TTTGGATTACATTGTTTACTCTAATGTGCAGGTTTGGGCAACCTATCAAGGTTAACTGGG 
CTTATGCGAGTGGCCAGAGGGAGGATACATCAAGTTGGTTCACAATCTTATGCTTGATTT 
CTTGCTAAAACAGTATTTTGGGTGTTCTATTGATACAATAACGCACTTCTGTGATCTTCA 
TGTGCAGGTCACTTCAATATATTTGTTGGGGATTTGAGTCCGGAGGTTACTGATGCAATG 
CTGTTTACTTGCTTCTCTGTCTACCCGACTTGCTCGTAAGTTTTTTATACCATCCTCAGC 
ATTCTTGTATTGGAAATGGAAGTTTAAGATTTGCAGAAACTCTTCCGACAATTGCTATTG 
TATGTAGGGATGCAAGAGTTATGTGGGATCAGAAAACTGGGCGTTCAAGAGGATTTGGAT 
TTGTTTCCTTCCGTAACCAACAGGTACTTGACTGTCTAACTCTCAGTCCTTGTGTATAGA 
TTGGCTTTTACTTTAAACACTGATCGATTGCTGCAAATCTTATTTCCTTATGCAGGATGC 
CCAGACTGCAATAGATGAGATAACTGGTGAGTGTTGCAATTTGTTTTCCCCCTTGATAGT 
TGATGTTAATATTTTGTTATTTTAGCTTTGTGTTTTTGAGCTTATTGTAATTGGTGGGAG 
ATTCTCTTCTGCTTTTCAGGGAAATGGCTTGGTTCCAGGCAGATACGTTGCAACTGGGCG 
ACAAAGGGAGCCACTTCTGGTGAGGACAAACAGAGCTCTGATTCCAAAAGCGTCGTGGAA 
CTTACCAGTGGTGTCTCGGGTATGTTTAACTATTACCTATCATGAAATAGAAAATCAAAT 
GGAAATAGAGAAAAGCCTCAAATAAACTTAATTCTTAACCCTTTGATGTTTATACATTGG 
CTTATTTGTTCCTGCAGAGGATGGTAAAGATACTACTAATGGTGAAGCTCCTGAGAACAA 
TGCTCAGTACACAACTGTTTACGTCGGTAATCTTGCTCCAGAGGTAAAATAGAAAAACTG 
TTATAGGTATTCTGTGACTTAACTCAACCATCATCCATACCTTTTTTGAATCAAAGATAT 
TTTCGTTATCCAGGTGTCCCAGGTTGATCTTCACCGCCACTTCCATTCCCTTGGTGCTGG 
GGTCATAGAGGAAGTCCGTGTTCAAAGAGACAAAGGTTTCGGATTTGTGAGATACTCTAC 
TCATGTAGAGGCAGCCCTCGCTATTCAGATGGGAAACACACATTCCTACCTTAGTGGCAG 
GCAAATGAAGGTAAAACTAACTAACTTAAACTGTTCTTTTGTGGGACTCACCATTCTTTT 
TGGTTTGGGAATGCTAAAATTGTTGTGTTCGTTGTTCCTACAGTGTTCTTGGGGAAGCAA 
GCCAACTCCAGCAGGAACAGCTTCAAACCCGCTTCCTCCACCAGCTCCTGCACCAATCCC 
GGGATTCTCAGCGAGTGATCTCTTGGCTTACGAGAGGCAACTAGCGATGAGCAAGATGGC 
AGGAATGAATCCGATGATGCATCACCCGCAGGGACAACATGCTTTTAAACAAGCTGCAAT 
GGGAGCCACTGGTTCAAACCAGGCAATATATGACGGTGGTTACCAGAACGCGCAGCAGCT 
CATGTACTACCAGTAAGATCTTCCTCGGAGCCGTTACTTGAGCGAAGAGTTCTTTCTTTT 
CTTCTTTTTTGTTATGTAACGTCTTTATTGTATCTTTTTCTTTTCTTCTAACTTATGTTC 
TTGTTATAATGTTATCATGTAGCTGTGGGTTTGTGGTTTGTGTTCCACGTTTTTTCTTTT 
GTTAACTACTACGGTTTACGTTTTTGCACATCTTCAACTTCTTTCTCTTTCTCTTTCTCT 
AACTTAATCTTATTTATTGGGTCGTAAGTTCGTATATCTTATGTAGAACCATTATAATTT 
GAAGTTTTTACCTCTC
>AT2G07690.1 |  minichromosome maintenance family protein / MCM family protein 
GTTTAGAACTTTTTGATAAGAGAGAAAGAGATAGAGAAATTCGTAACGGAGACGAAGCAA 
CGATGTCAGGATGGGACGAAGGAGCAGTTTACTACAGCGACCAGCCGCAGTTCCCGGAGG 
CCGGAGACGCCGCAACCATCAGTCCCCACGCCGTCTTAACCAAATTTAAGGAATTCATTC 
GAAACTTCGAGATCGAACAGAATTGTTTCCCCTACAGAGAAGCTCTCCTCGATAACCCTA 
AGCGACTTGTTGTCCACCTCGAAGATCTCCTCTCCTTTGATTCCGATCTCCCCTCCTTAA 
TCCGATCTGCTCCTGCCGATTATCTCCCTGTGGTATGACTTCAAAAAAAATTAGGGTTCA 
TATAAGCTTTGTATTGAGTGAGTCAATCTTTGAATTGTAGTTTGAGAAAGCAGCTGGTGA 
AGTGTTGACTGGATTGAAAATGAGGGAGGCTAATGAGGGAGGGGTAATGGAGGAACCTCT 
GACTAGAGATGTGCAGATTTTGCTCACTTCAAGAGAGGATCCAGTATCAATGAGATTACT 
TGGGGTATGTCTGTTTTTTTGTTTTTAGTATCAATGAGATTACTTGGGGTATGTCTATAA 
TGTACTCTTTACTCTTGATAGGCACAGTACATCTCAAAGTTGGTGAAAATCTCTGGGATT 
AGTATTGCAGCTTCGAGAGTGAAAGCAAAGGCGACTTATGTGTTTTTGGTATGTAAGAAT 
TGTAAAAAGACAAGGGAAGTTCCATGTCGTCCGGGTCTTGGTGGGGCAATTGTTCCTCGA 
TCATGTGATAATATTCCACAGGTGAGTTCTTTTGATTCGTTTGTGATTTGAGTTTGTAGT 
TATCCTTGGTGTTGATTAGACCAAATTGGAATTTGTTTAGCCTGGAGAGGAGCCTTGCCC 
TCTTGATCCTTGGATGGTGGTTCCTGATAGGAGCCAGTATGTTGATCAACAGACCTTAAA 
GCTACAGGAGAATCCGGAGGTATAGATTTACATTGTAATGTTTTCGCTTTTTTTGCACTT 
GTATATATTAAATGCTTCTGAGTTTTGAAGGATGTTCCTACTGGAGAGCTTCCAAGAAAT 
ATGCTTCTCTCAGTTGATCGGCATCTTGTACAAACAATTGTACCTGGAACCAGACTGACA 
GTAATGGGTATCTACAGCATTTTCCAAGCTTCGTCATCATCTAACTCGTAAGCTTTGTAG 
TTTTATGTCAAATGAGAGTGTAGATTGTTTTCTGGGAGAGTTACACCACAACAATGATGG 
ACATCTTTTCCTACTTTCTGATGTAGGCATAAAGGAGCAGTTGCAATTCGCCAGCCTTAT 
ATCCGAGTTGTTGGACTGGAAGACACAAATGAGGCCAGTTCCCGTGGCCCTGCCAACTTC 
ACTCCTGACGAAGTTAGTATCGCATCATTTGGTTCTTTTTGTTTTCTCATTTGATAGCCT 
ATGTCATCCATGGTTTCACAATGAACTATTGAAGTTAACATGGCTGAATTATTGTTACTG 
GAAACCAAATGCCTTAGGTAGCTGTTGGCTCTATGAAATTCTTTGTGTAACTCCCAAATG 
AATGTGATGGTGTTTTCTGGAAATATTCTCTGTGCTACTAGTTTACTATGAAACATTTAG 
GCCTGCTTGGAAGCCTAGTTGTACAATTCCATTTATCAGTTTTGTCTTCCATAATATTAC 
TTTTAGGAGGAAGAATTCAAAAAGTTTGCTGATAGTCAAGATGTATACAAGAACATTTGC 
ACCAAGATCGCTCCTTCTATATTTGGCCATGAGGATGTGAAGAGAGCAGCTGCGTGTCTT 
CTCTTTGGAGGATCCAGGAAGGTAGGAAACTGTGATAGCAGTTTTTATTTTCTGTGCACT 
TTGTATACGTTTTTGATATATTTATATACATTTCTATCTTTGATTCAGAGCCTGCCCGAT 
GGAGTGAAACTAAGAGGTGATATTAATGTTTTGCTTTTGGGAGACCCATCAACTGCAAAA 
TCACAGGTTTGTAATGTGGTCTCAGTATCAATGGTTTATAATAAGTGTGTTATTCTTTTT 
ATATTTTCTTACGTCTCTCTTATTTGCTTGATATTCGTCTTACATCCTTCTGTTCAAGTG 
TTAGATTACAATCCTTACAAAATGTCTGTGTTATTTCCAACACCTGTAGCTTACATGTTT 
AAAGCTTAATTGCTTATTTTTTTTCTCTCTAGTTTCTTAAGTTTGTGGAGAAGACGGCTC 
CAATTGCTGTTTATACATCTGGAAAGGGTTCATCGGCTGCTGGGCTCACAGCTTCGGTGA 
TTCGAGATAGCAGCACTGTATGTCCTATCTTCAAGTGTTTTTCTATGATTTGTTTAAAAG 
TAGTTGCTATGACAGATTCTCAGTTATTTATACATATGTTCATTGCAGCGAGAGTTCTAT 
CTTGAAGGTGGTGCTATGGTTTTGGCTGATGGAGGTGTTGTGTGTATTGATGAATTTGAC 
AAGATGAGACCGGAAGATAGGTAATTCAAATCTGAATCATAGTGTTGACGAATCTAATTT 
TTCTCTATGAGTAGAATTGATGGAATGTTTTTTTTTTCTTTATAGGGTTGCTATTCATGA 
GGCAATGGAGCAGCAGACAATCTCCATTGCAAAAGCTGGGATAACAACTGTCCTTAATTC 
TAGAACCTCGGTGCTTGCTGCTGCTAACCCGCCATCTGGTCGATATGATGACCTTAAGGT 
TTGAAATCTGGTACTCTCCTTTGGCAATATCATGGTTTTCCCGATTCTTGTTTGCAATAT 
TCTTAAGAGATGGGTGTGTTTTTTTTTCTTTGGATTTGCAGACTGCTCAGGACAATATCG 
ATCTGCAGACAACAATTCTTTCTAGATTTGATCTTATCTTCATTGTCAAGGACATCAGGA 
AGTATTCCCAAGACAAGGTAAGCAAGGAAAGGAACAATTCTTTCAGAAATTTTATGTAGT 
TAAAAGGGAAAACAGAGATTAATGATGGAGGTCACTGTTATTGGAAAGTTTGCTTCGTTG 
CTTGCTTATTATGTAGACATGATTAATGTTTATAATCTTTTCACAGGAAATAGCCAGCCA 
TATTATAAGGGTTCATGCATCTGCAAACAAATTTTCGGATGAAAACACAGATTCTAAAGA 
AGATAATTGGCTCAAAAGGTGTGTTTTCATTCGTCGAGAAAACAATGTGTTCTCGCAGTT 
TTCTGTACAAAATCATGACTCTAAAATATAATGCTCTTTTTATGTTAGGTATATACAATA 
CTGTCGAGCAAGGTGTCATCCCCGTCTCTCAAAAGACGCTGCTGAGAACCTGCAGCGGAA 
ATATGTCACAATCAGAATGGTAATTGTCATTTACATTAGATTTGACAATAAGATGGTTAA 
AAAACAAAGTTGGTGTCAGTATAAAATTTTCGGCTAAACAGGATATGAAGAGACGTGCAC 
ATGAAACAGGAGAGGCTGCTCCGATACCTATCACAGTGAGACAACTCGAAGCTATTGTCA 
GACTGAGTGAGTCACTTGCAAAAATGAGACTGTAAGTAATCTTATTAACATAGAGATTCC 
TGATTCCTGAAACCTGATGGGATGTGCCGTCCATTGACATTGTTAAATATGTCAGGTCAC 
ACGAGGCCACACCAGATGATGTAGACAAAGCTTTTAAACTTTTTGATACCTCGACAATGG 
ATGCAGCAAGATCAGGGATAAATCAACAGATAAACATAACAGGCGAGATGGCCAATGAAA 
TCAAGGTTAGTTGCTTGTGGGGAAGAAAGAATCATCGTATCTCTAGATGTAATAACTAAA 
TTTGGTATTGGTGTGAAAAAACAGCAAGCGGAAACACAGATAAAGAGAAGAATGGGGATC 
GGAGCTCGATTATCAGAGAGAAGACTGATAGAGGATCTGGCTAGAATGGGAATGAACGAT 
TCAATGGTACCTAAGCTAACATCTTTGTTGTTTAATTTTCAGTAATGTGAATGGGATTTT 
TGAGGTAATGTGCATGTTAAAATGGCAGGTGAGGAGAGCTTTGTTGATAATGCACCAGAG 
AGGTGAAGTTGAGTACCAGCGAGAGAGACGTTCTATTGTCCGCAAAGCTTGATCGTCTAG 
GCATGCAATCTCTCTTCTTTAGTAGCAGCGATGACCAAACAAAACAAAATATTTAATATT 
ATCAAGTTAATTTGTAGGCAAAAAGTAGAAAGAGAAGCTTATGTCATGTGTATTTGATGA 
AGATTCTTAGTAAACTTTTACGCTTGCTTCAAACTAATGTATTCTCCACCTTTGTTGTCC 
TTAGTTAAAATGTCACGCCAATGTTAGG